Overview

Comprehensive Description

Biology

A common, but little-known inshore sluggish bottom shark (Ref. 13575) found on sandy and muddy bottoms of coastal waters, bays and inlets and rocky and coral reefs. Probably mainly feeds on bottom-dwelling invertebrates (Ref. 13575), also small fishes. Oviparous (Ref. 50449). Utilized for human consumption (Ref. 247). Possibly may occur in fresh water in the lower reaches of the Perak River in peninsular Malaysia (Ref. 43278).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East Indian Ocean, FAO fishing area 51, FAO fishing area 57, FAO fishing area 61, FAO fishing area 71, Kenyan Exclusive Economic Zone, Malindi Bay, Ungama Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Arabian Sea to India, Sri Lanka, Singapore, Thailand, Indonesia, Viet Nam, Taiwan, the Philippines, and Solomon Islands. Probably occurring in Korea and Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Country distribution range is uncertain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 650 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

65.0 cm TL (male/unsexed; (Ref. 247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Genus: Nostrils subterminal on snout; pre-oral snout long, mouth closer to eyes than snout tip; eyes and supraorbital ridges hardly elevated; no black hood on head or large spot or spots on sides of body above pectoral fins (Ref. 43278). Caudal fin with a pronounced subterminal notch but without a ventral lobe (Ref. 13575). Species: Light brown above, cream below, with numerous dark spots on body, tail, and fins, these often forming indistinct vertical bars and saddles (Ref. 31575). Dermal ridge on middle of back and two low lateral ridges (Ref. 4832).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Chiloscyllium indicum
Catalog Number: USNM 75953
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Jouy
Year Collected: 1882
Locality: (Locality doubtful) Japan? Collected in the areas of Shanghai and Hong Kong or the markets of Yokohama, Japan and/or the Japanese island of Tsushima., Japan or China, Pacific
  • Syntype: Fowler, H. W. 1941. Bulletin of the United States National Museum. No. 100: 89.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Chiloscyllium indicum
Catalog Number: USNM 40032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Australian Museum, Sydney
Locality: China Seas, Pacific
  • Syntype: Fowler, H. W. 1941. Bulletin of the United States National Museum. No. 100: 89.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Chiloscyllium indicum
Catalog Number: USNM 12623
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: No Data. Indo-Pacific
  • Syntype: Fowler, H. W. 1941. Bulletin of the United States National Museum. No. 100: 89.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; oceanodromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A common but little-known inshore sluggish bottom shark. It may possibly occur in fresh water in the lower reaches of the Perak River in peninsular Malaysia. Maximum total length (TL) is about 65 cm, with males maturing between 39 and 42 cm TL, and females at 43 cm TL. Chiloscyllium indicum is oviparous, and is inferred to feed mainly on invertebrates. Virtually nothing is known of the biology of this species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A common, but little-known inshore sluggish bottom shark (Ref. 13575) found on sandy and muddy bottoms of coastal waters, bays and inlets and rocky and coral reefs. Probably mainly feeds on bottom-dwelling invertebrates (Ref. 13575), also small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, deposits eggs in small, oval egg cases on the bottom (Ref. 247). Paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chiloscyllium indicum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATNTTNGGTGCATGAGCAGGAATAGTAGGCCTAGCTCTCAGCCTTTTAATCCGTGCTGAATTAAGTCAACCTGGATCCCTTCTAGGTGATGATCAGATTTATAATGTAATCGTAACAGCTCATGCTTTTGTAATAATCTTCTTCATGGTAATGCCTGTAATAATTGGAGGGTTTGGAAACTGACTAGTACCCCTAATAATTGGCGCACCCGATATAGCCTTTCCTCGAATAAATAATATAAGCTTTTGACTACTTCCTCCTTCATTTTTATTACTCCTAGCCTCTGCAGGAGTTGAAGCCGGGGCAGGAACAGGTTGAACCGTTTACCCCCCTTTAGCAGGCAATTTAGCTCATGCAGGAGCATCAGTTGATTTAACTATCTTTTCTTTACACTTAGCAGGAGTTTCATCAATTTTAGCCTCTATTAATTTTATTACAACTATTATTAATATAAAACCACCAGCAATTTCTCAATATCAAACGCCCTTATTTGTCTGATCTATCCTTGTAACCACTATTCTCCTACTACTTTCATTGCCAGTTCTAGCAGCAGGTATTACAATGTTACTCACAGATCGAAACTTAAATACAACATTCTTNGACCCAGCGGGGGGAGGCGATCCCATTTTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chiloscyllium indicum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Barratt, P., Cavanagh, R.D. & Kyne, P.M. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Justification
Chiloscyllium indicum is likely to be threatened by overfishing, destructive fishing practices and habitat modification, including the damage and destruction of coral reefs throughout much of its range. This species is regularly taken in inshore fisheries in India, Sri Lanka and Thailand where it is utilized for food. Virtually nothing is known of the biology of this small, sluggish, bottom dwelling shark. However, although common within parts of its range, it is assessed as Near Threatened, reflecting concern that it may meet the Vulnerable criteria due to the significant impact that considerable fishing pressure is likely having on this species in much of its range, and that will continue in future. There is a need for survey and appraisal of the status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No data are available on population size or subpopulations, though it is known to be common within parts of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Chiloscyllium indicum is of considerable interest to fisheries in some areas and is regularly taken in inshore fisheries in India, Sri Lanka and Thailand and utilized fresh for food. It is caught in demersal trawls, demersal gill nets and occasionally pelagic gill nets and is likely to be threatened by overfishing, destructive fishing practices and habitat modification, including the damage and destruction of coral reefs throughout much of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are currently no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Slender bamboo shark

The slender bamboo shark, Chiloscyllium indicum, is a bamboo shark in the family Hemiscylliidae found in the Indo-West Pacific Oceans between latitudes 40° N and 10° S, and longitude 65° E and 160° E. Its length is up to 65 cm.

Features: Mouth located in front of the eyes; Elongated slender precaudal tail; the shark has a brownish body with a number of dark spots and dashes. The dorsal fins are round, same size, and smaller than the pelvic fin.[1]

Habitat: Inshore bottom duelling shark. Found on sandy and muddy bottoms of coastal waters. Probably feed on small bottom dwelling invertebrates.[2]

Reproduction is oviparous (egg laying).

It is harmless to humans.

See also

References

  1. ^ Compagno, Leonard. "Sharks of the world." Shark Research Center Iziko-Museums of Cape Town. NO. 1. Vol 2. Cape Town South Africa: FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, 2002. Pg 173.
  2. ^ Compagno, Leonard. "Sharks of the world." Shark Research Center Iziko-Museums of Cape Town. NO. 1. Vol 2. Cape Town South Africa: FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS, 2002. Pg 173.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!