Overview

Comprehensive Description

Biology

Occur in coastal lagoons, rivers, streams, lakes, swamps and farm dams, but prefers riverine habitats (Ref. 26509, 44894). Usually found in deep waters of reservoirs well away from the shore. Mature adults undertake annual spawning migrations to oceanic waters (Ref. 44894). Mainly nocturnal feeders. Feed on crustaceans, mollusks, aquatic and terrestrial insects, fish including elvers and native trout. Maximum size for female longfin eel taken from Ref. 6390. A reasonably good angling fish which may grow to 22 kilograms (Ref. 44894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Asia and Oceania: New Guinea, eastern Australia, including Tasmania, Lord Howe Island and New Caledonia.
  • Allen, G.R. 1991 Field guide to the freshwater fishes of New Guinea. Publication, no. 9. 268 p. Christensen Research Institute, Madang, Papua New Guinea. (Ref. 2847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia and southwestern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

165 cm TL (male/unsexed; (Ref. 82796)); 158 cm TL (female); max. published weight: 22.0 kg (Ref. 82796); max. reported age: 41 years (Ref. 6390)
  • Chisnall, B.L. 2000 The Australian longfinned eel, Anguilla reinhardtii, in New Zealand. Conservation Advisory Science. Department of Conservation, Wellington, Notes No. 302, 14 p. (Ref. 82796)
  • Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve 1993 Australian fisheries resources. Bureau of Resource Sciences, Canberra, Australia. 422 p. (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by mottled color and tooth bands with a separated inner series. The only other species within its range with these characters is Anguilla marmorata, but that species has a longer dorsal fin (Ref. 9828).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 1 m (Ref. 57178)
  • Ocean Biogeographic Information System 2006 OBIS-extracted Depth Data. Harvested by E.Agbayani July 2006 at www.iobis.org. (Ref. 57178)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.3 - 0.3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Diadromous. They move fom marine to fresh waters as juveniles and return to the sea as adults. These eels live in a variety of freshwater and estuarine environments including coastal lagoons, rivers, creeks, swamps, lakes and farm dams (Ref. 26507). Longfin eels prefer riverine habitats (Ref. 26509). Glass eels enter estuaries mainly in summer and autumn. Mainly nocturnal feeders with a well developed sense of smell for locating prey. Diet includes crustaceans, molluscs, aquatic and terrestial insects (Ref. 26514), and bony fish (including elvers) (Ref. 26513, 26514). Feeding patterns follow the seasons - feeding is most intense at night during spring and summer (Ref. 2906).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla reinhardtii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGGACCGCACTAAGCCTTCTCATCCGTGCCGAATTAAGTCAACCAGGCGCTCTTCTTGGAGATGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTTGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGATTTGGCAACTGACTTGTACCCTTAATAATTGGCGCCCCGGACATAGCATTTCCCCGAATAAACAACATAAGCTTCTGACTTTTACCACCATCATTTCTTCTTTTACTAGCCTCCTCAGGGGTAGAAGCTGGGGCTGGAACAGGTTGAACTGTATATCCCCCTCTAGCTGGAAACTTAGCTCACGCCGGAGCATCTGTTGACCTAACAATTTTCTCACTCCACCTTGCAGGGATTTCATCAATCCTGGGAGCCATTAACTTTATCACTACAATTATTAACATGAAACCACCTGCCATCACACAATACCAAACTCCCCTGTTTGTATGAGCTGTTTTAGTAACCGCTGTTCTACTACTTCTATCCCTGCCAGTCCTAGCTGCAGGCATTACAATACTTCTAACCGACCGAAATTTAAATACAACCTTCTTCGACCCTGCAGGGGGCGGAGACCCAATCCTCTACCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTATACATTTTAATCTTACCAGGATTTGGAATAATCTCACACATTGTTGCTTATTATTCCGGTAAAAAAGAACCGTTTGGGTACATAGGAATAGTCTGAGCAATAATGGCTATCGGACTTCTAGGATTCATTGTATGAGCACATCATATGTTCACAGTAGGAATAGACGTAGACACCCGTGCCTACTTCACTTCAGCCACAATAATCATCGCAATTCCAACTGGGGTAAAAGTATTCAGCTGATTAGCCACATTACACGGAGGAGCCGTCAAATGAGAAACCCCACTCCTTTGAGCTTTAGGCTTTATTTTCCTATTTACAGTAGGGGGTCTGACAGGTATCGTACTAGCAAACTCATCAATCGATATTGTATTACATGATACATACTATGTAGTAGCCCATTTCCATTATGTCCTATCCATAGGAGCCGTCTTCGCTATCATAGGAGGCTTTGTACACTGATTCCCCCTATTCTCAGGCTACACACTACACGACACATGAACCAAAGTACACTTTGGAATTATATTCGTAGGGGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGACTAGCAGGAATACCACGACGCTATTCAGACTACCCAGATGCCTACACCCTATGAAACACAATCTCCTCTATTGGATCACTAATTTCTCTCACAGCCGTAGTCCTATTCCTATTTATCCTGTGAGAAGCATTCACTGCCAAACGAGAAGTAAAATGAGTAGAGCTTACAGAAACAAATGTTGAATGACTACACGGATGTCCTCCGCCATACCACACATTCGAAGAGCCAGCGTACGTCCGAGTTCAACCACCCTCAGATGACCAAAAATCAGAAGCCAAAGCCCACATTCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla reinhardtii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Speckled longfin eel

The speckled longfin eel, Australian long-finned eel or marbled eel (Anguilla reinhardtii) is one of 15 species of eel in the family Anguillidae. It has a long snake-like cylindrical body with its dorsal, tail and anal fins joined to form one long fin. It usually has a brownish green or olive green back and sides with small darker spots or blotches all over its body. Its underside is paler.[1] It has a small gill opening on each side of its wide head, with thick lips. It is Australia's largest freshwater eel, and the female usually grows much larger than the male.[1][2] It is also known as the spotted eel.

Description[edit]

Long-finned eels can grow to 1.6 metres and 22 kg (although generally to 1 metre) for females while males are much smaller at 650 mm and 600 g.[3] Landlocked eels have been reported to grow to 3 metres (10 feet).[2]

Distribution[edit]

The long-finned eel is a native of New Guinea, eastern Australia (including Tasmania), Lord Howe Island, and New Caledonia.[1] It can be found in many freshwater areas, including creeks, streams, rivers, swamps, dams, lagoons, and lakes although generally more often in rivers than lakes.[2]

Breeding and migration[edit]

References[edit]

  1. ^ a b c Allen, G.R.; Midgley, S.H.; Allen, M. (2002). Freshwater Fishes of Australia. Perth, Western Australia: Western Australian Museum. p. 64. ISBN 0-7307-5486-3. 
  2. ^ a b c Merrick, J.R.; Schmida, G.E. (1984). Australian Freshwater Fishes, Biology and Management. Sydney: Author. pp. 61–63. ISBN 0-9591908-0-5. 
  3. ^ Robert McDowall, ed. (1996). Freshwater Fishes of South-Eastern Australia (Rev Ed). Sydney: Reed Books. pp. 42–43. ISBN 0-86622-936-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!