Overview

Comprehensive Description

Biology

Inhabits freshwater streams, lakes and swamps, favouring coastal lagoons and the lower reaches of rivers. Spawning adults occur in marine waters. Sub-adults spend most of their lives in fresh or brackish waters (Ref. 44894). Found in large turbid rivers and small creeks (Ref. 2847). Occurs both in running and stagnant waters (Ref. 12790). Feeds mainly on fishes, crustaceans and mollusks.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean: western New Guinea and Queensland, Australia to the Society Islands. A single specimen was recorded from a tributary of the Buffalo River, near King William's Town in South Africa (Ref. 3506), but this is questionable.
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)   http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=295 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 102 - 108
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)   http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=295 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

110 cm TL (male/unsexed; (Ref. 5259))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Belongs to the group of anguillas which have a short dorsal fin which originates slightly before the anus (Ref. 48622). Most closely resembles Anguilla australis and A. bicolor, from which it can be distinguished with certainty only by the number of vertebrae. Also Ref. 2847.
  • Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)   http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=295 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.5 - 1
  Temperature range (°C): 22.496 - 27.060
  Nitrate (umol/L): 0.054 - 0.230
  Salinity (PPS): 34.992 - 35.552
  Oxygen (ml/l): 4.693 - 5.079
  Phosphate (umol/l): 0.108 - 0.222
  Silicate (umol/l): 1.141 - 1.623

Graphical representation

Depth range (m): 0.5 - 1

Temperature range (°C): 22.496 - 27.060

Nitrate (umol/L): 0.054 - 0.230

Salinity (PPS): 34.992 - 35.552

Oxygen (ml/l): 4.693 - 5.079

Phosphate (umol/l): 0.108 - 0.222

Silicate (umol/l): 1.141 - 1.623
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

This species is known from Lake Te Rotonui which has a temperature range of 19.5°C to 30°C (Ref. 012581).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla obscura

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0501-06|AP007247|Anguilla obscura| ACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCACTA---AGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGAT---GACCAAATTTACAATGTCATCGTCACAGCACATGCCTTTGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGGTTTGGCAACTGACTTGTGCCATTAATG---ATCGGTGCTCCAGACATGGCATTCCCCCGAATAAACAATATAAGCTTCTGACTATTACCCCCATCATTTCTTCTTCTACTAGCCTCCTCAGGAGTAGAAGCTGGGGCTGGTACAGGTTGAACTGTATATCCACCTCTAGCTGGAAACTTAGCCCATGCCGGAGCATCTGTTGACCTG---ACAATTTTCTCACTTCACCTTGCAGGAGTTTCATCAATTCTAGGAGCCATTAATTTTATCACTACAATTATTAATATGAAACCGCCTGCCATTACACAATACCAAACCCCTCTGTTTGTATGAGCTGTTTTAGTCACCGCTGTTCTGCTACTCCTATCCCTGCCAGTCCTAGCTGCA---GGAATTACAATACTTCTGACTGACCGAAACTTAAATACAACATTCTTTGACCCTGCAGGTGGTGGAGACCCAATCCTATACCAGCACCTATTCTGATTCTTTGGCCACCCAGAAGTATACATTTTAATCTTACCAGGATTTGGAATAATCTCACACATTGTTGCTTATTACTCCGGTAAGAAA---GAACCATTTGGGTATATAGGAATGGTTTGAGCAATGATGGCTATCGGGCTTCTAGGATTCATTGTATGAGCACACCATATGTTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla obscura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!