Overview
Comprehensive Description
Biology
Inhabits freshwater streams, lakes and swamps, favouring coastal lagoons and the lower reaches of rivers. Spawning adults occur in marine waters. Sub-adults spend most of their lives in fresh or brackish waters (Ref. 44894). Found in large turbid rivers and small creeks (Ref. 2847). Occurs both in running and stagnant waters (Ref. 12790). Feeds mainly on fishes, crustaceans and mollusks.
-
Allen, G.R. 1989 Freshwater fishes of Australia. T.F.H. Publications, Inc., Neptune City, New Jersey. (Ref. 5259)
http://www.fishbase.org/references/FBRefSummary.php?id=5259&speccode=10550
Trusted
Distribution
Pacific Ocean: western New Guinea and Queensland, Australia to the Society Islands. A single specimen was recorded from a tributary of the Buffalo River, near King William's Town in South Africa (Ref. 3506), but this is questionable.
-
Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=295
Trusted
Physical Description
Morphology
Vertebrae: 102 - 108
-
Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=295
Trusted
Size
Max. size
110 cm TL (male/unsexed; (Ref. 5259))
-
Allen, G.R. 1989 Freshwater fishes of Australia. T.F.H. Publications, Inc., Neptune City, New Jersey. (Ref. 5259)
http://www.fishbase.org/references/FBRefSummary.php?id=5259&speccode=10550
Trusted
Diagnostic Description
Belongs to the group of anguillas which have a short dorsal fin which originates slightly before the anus (Ref. 48622). Most closely resembles Anguilla australis and A. bicolor, from which it can be distinguished with certainty only by the number of vertebrae. Also Ref. 2847.
-
Smith, D.G. 1999 Anguillidae. Freshwater eels. p. 1630-1636. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9828)
http://www.fishbase.org/references/FBRefSummary.php?id=9828&speccode=295
Trusted
Ecology
Habitat
Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 0.5 - 1
Temperature range (°C): 22.496 - 27.060
Nitrate (umol/L): 0.054 - 0.230
Salinity (PPS): 34.992 - 35.552
Oxygen (ml/l): 4.693 - 5.079
Phosphate (umol/l): 0.108 - 0.222
Silicate (umol/l): 1.141 - 1.623
Graphical representation
Depth range (m): 0.5 - 1
Temperature range (°C): 22.496 - 27.060
Nitrate (umol/L): 0.054 - 0.230
Salinity (PPS): 34.992 - 35.552
Oxygen (ml/l): 4.693 - 5.079
Phosphate (umol/l): 0.108 - 0.222
Silicate (umol/l): 1.141 - 1.623
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 4 samples.
Environmental ranges
Depth range (m): 0.5 - 1
Temperature range (°C): 22.496 - 27.060
Nitrate (umol/L): 0.054 - 0.230
Salinity (PPS): 34.992 - 35.552
Oxygen (ml/l): 4.693 - 5.079
Phosphate (umol/l): 0.108 - 0.222
Silicate (umol/l): 1.141 - 1.623
Graphical representation
Depth range (m): 0.5 - 1
Temperature range (°C): 22.496 - 27.060
Nitrate (umol/L): 0.054 - 0.230
Salinity (PPS): 34.992 - 35.552
Oxygen (ml/l): 4.693 - 5.079
Phosphate (umol/l): 0.108 - 0.222
Silicate (umol/l): 1.141 - 1.623
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Environment
demersal; catadromous (Ref. 51243); freshwater; brackish; marine
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Migration
Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Trophic Strategy
This species is known from Lake Te Rotonui which has a temperature range of 19.5°C to 30°C (Ref. 012581).
-
Jellyman, D.J. 1991 Biology of the shortfinned eel Anguilla obscura in Lake Te Rotonui, Mitiaro, Cook Islands. Pac. Sci.45(4):362-373. (Ref. 12581)
http://www.fishbase.org/references/FBRefSummary.php?id=12581&speccode=7511
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Anguilla obscura
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC0501-06|AP007247|Anguilla obscura| ACCCGTTGATTCTTTTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCACTA---AGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGAT---GACCAAATTTACAATGTCATCGTCACAGCACATGCCTTTGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGGTTTGGCAACTGACTTGTGCCATTAATG---ATCGGTGCTCCAGACATGGCATTCCCCCGAATAAACAATATAAGCTTCTGACTATTACCCCCATCATTTCTTCTTCTACTAGCCTCCTCAGGAGTAGAAGCTGGGGCTGGTACAGGTTGAACTGTATATCCACCTCTAGCTGGAAACTTAGCCCATGCCGGAGCATCTGTTGACCTG---ACAATTTTCTCACTTCACCTTGCAGGAGTTTCATCAATTCTAGGAGCCATTAATTTTATCACTACAATTATTAATATGAAACCGCCTGCCATTACACAATACCAAACCCCTCTGTTTGTATGAGCTGTTTTAGTCACCGCTGTTCTGCTACTCCTATCCCTGCCAGTCCTAGCTGCA---GGAATTACAATACTTCTGACTGACCGAAACTTAAATACAACATTCTTTGACCCTGCAGGTGGTGGAGACCCAATCCTATACCAGCACCTATTCTGATTCTTTGGCCACCCAGAAGTATACATTTTAATCTTACCAGGATTTGGAATAATCTCACACATTGTTGCTTATTACTCCGGTAAGAAA---GAACCATTTGGGTATATAGGAATGGTTTGAGCAATGATGGCTATCGGGCTTCTAGGATTCATTGTATGAGCACACCATATGTTTACAGTAGGAATAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Anguilla obscura
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1
Public Records: 2
Species: 2
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


