Overview

Comprehensive Description

Biology/Natural History: This shrimp is one of the crangonids I most commonly find in 100 m depth trawls in the San Juan Channel. Crangonids are often parasitized by bopyrid isopods such as Argeia. Crangonids are active predators, eg. on polychaetes. In Puget Sound some shrimp appear to be hybrids between C alaskensis and C. nigricauda.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This shrimp has the typical extremely short rostrum characteristic of many crangonids (photo). The carapace is smooth and has a median dorsal spine but no submedian spine (photo). Abdominal segment 6 has no longitudinal dorsal carinae (photo) but the underside does have a median sulcus (photo). Abdominal segment 5 has no spines on the upper posterolateral margins (photo). The inner flagellum of antenna 1 is longer than the outer flagellum. The antennal scale is more than twice as long as wide, has a narrow lamella, and its spine is as long as or longer than the lamella (photo). The scale is shorter than the telson. Length to 6.5 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Bering Sea to San Diego, CA

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Crangon alaskensis elongata Rathbun, 1902
Catalog Number: USNM 25242
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1889
Locality: Off Santa Barbara, California, United States, North Pacific Ocean
Depth (m): 53 to 53
Vessel: Albatross R/V
  • Type: Rathbun, M. J. 1902. Descriptions of new decapod crustaceans from the west coast of North America. Proc. U.S.N.M. 24 (1272): 885–905.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Crangon nigricauda has a shorter antennal scale and spine and is much less slender.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 129 specimens in 2 taxa.
Water temperature and chemistry ranges based on 35 samples.

Environmental ranges
  Depth range (m): 2 - 265
  Temperature range (°C): 6.506 - 8.705
  Nitrate (umol/L): 13.007 - 32.802
  Salinity (PPS): 32.561 - 33.945
  Oxygen (ml/l): 2.301 - 5.506
  Phosphate (umol/l): 1.398 - 2.442
  Silicate (umol/l): 21.984 - 53.307

Graphical representation

Depth range (m): 2 - 265

Temperature range (°C): 6.506 - 8.705

Nitrate (umol/L): 13.007 - 32.802

Salinity (PPS): 32.561 - 33.945

Oxygen (ml/l): 2.301 - 5.506

Phosphate (umol/l): 1.398 - 2.442

Silicate (umol/l): 21.984 - 53.307
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 91 - 183
  Temperature range (°C): 7.344 - 7.344
  Nitrate (umol/L): 31.830 - 31.830
  Salinity (PPS): 33.917 - 33.917
  Oxygen (ml/l): 2.301 - 2.301
  Phosphate (umol/l): 2.390 - 2.390
  Silicate (umol/l): 48.841 - 48.841

Graphical representation

Depth range (m): 91 - 183
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Intertidal to 275 m. This species seems to be found more often in deeper, shelf waters than near the intertidal zone.

Habitat: Crangonids often live on sand, which they often burrow into.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crangon alaskensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAACTTTATATTTTATTTTTGGAGCTTGAGCTGGGATAGTAGGAACCGCACTAAGTTTACTTATTCGAGCAGAGTTAGGGTCTCCTGGAAGATTAATTGGTAATGACCAAATTTATAATGTAGTTGTTACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATACCTATTCTTATTGGTGGGTTTGGAAACTGACTGGTACCTTTAATGTTAGGGGCACCTGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGGTTACTACCACCTGCTTTAACTCTTCTTTTATCAAGAGGTCTAGTAGAAAGTGGAGTTGGAACTGGATGAACAGTCTACCCACCTCTTTCAGCAGGTATTGCTCATGCTGGAGCCTCAGTAGACATAGGAATCTTTTCTCTACATTTAGCAGGAGTTTCGTCTATTTTAGGAGCAATTAATTTTATTACAACAGTAATTAATATACGAGCTGCAGGAATAACTATAGACCGTCTACCTTTATTTGTTTGATCTGTATTTTTAACAGCCATTCTTTTATTATTATCCCTTCCAGTTTTAGCTGGAGCTATTACTATACTTTTAACAGACCGAAATCTAAATACTTCATTTTTTGACCCAGTTGGCGGAGGAGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crangon alaskensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!