Ecology

Habitat

Epipelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 5 - 4977
  Temperature range (°C): -1.103 - 25.462
  Nitrate (umol/L): 0.075 - 39.473
  Salinity (PPS): 33.620 - 37.091
  Oxygen (ml/l): 2.270 - 6.301
  Phosphate (umol/l): 0.052 - 2.810
  Silicate (umol/l): 0.899 - 180.924

Graphical representation

Depth range (m): 5 - 4977

Temperature range (°C): -1.103 - 25.462

Nitrate (umol/L): 0.075 - 39.473

Salinity (PPS): 33.620 - 37.091

Oxygen (ml/l): 2.270 - 6.301

Phosphate (umol/l): 0.052 - 2.810

Silicate (umol/l): 0.899 - 180.924
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neocalanus robustior

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTAAAATGGTTATGATCTTGTAATCATAAAGATATTGGTACGCTGTACTTACTTGCTGGGGCCTGGTCTGGAATGGTTGGAACTGGGCTCAGGATAGTCATTCGACTCGAGCTAGGGCAGGCTGGTTCACTGATTGGAGAC---GATCAGATTTATAATGTTGTTGTTACTGCACACGCGTTTATTATAATTTTTTTTATGGTTATGCCGATTTTAATTGGCGGATTCGGGAACTGGTTGGTCCCTCTTATGTTGGGGGCTGCAGACATGGCCTTCCCACGAATAAATAATATAAGATTTTGATTTTTAATGCCCGCTTTAGTTATACTGCTGTCTAGATCTCTTGTTGAAAGAGGGGCCGGGACAGGCTGAACAGTATACCCTCCATTGGCTAGAAATATTGCCCACGCAGGAGGGTCTGTAGATTTTGCGATTTTTTCCCTCCATCTGGCAGGGGTCAGATCAATCCTGGGGGCAGTAAATTTTATTAGTACCCTCGGGAACCTGCGGGTATTTGGTATACTATTAGATCGGATACCCCTATTTGCATGAGCAGTTTTAATTACTGCTATTTTACTTCTTTTATCTCTCCCTGTACTCGCCGGGGCGATTACAATGCTTTTAACGGATCGTAACTTAAATACCTCATTTTACGATGTCGGCGGAGGGGGGGACCCTATTCTCTATCAGCATTTATTTTGATTTTTTGGTCATCCTGAGGTCTATATTCTCATTCTCCCGGGGTTTGGACTAATTTCGCACATCGTGGCCCAGGAAAGGGGGAAAAAGGAAACATTTGGAGTTCTTGGGATAATTTATGCAATACTTGCCATTGGAATTCTAGGGTTTGTAGTGTGGGCCCACCATATATTCACAGTGGGAATGGACGCGGACACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neocalanus robustior

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!