Ecology

Habitat

Epipelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 5 - 4977
  Temperature range (°C): -1.103 - 25.462
  Nitrate (umol/L): 0.075 - 39.473
  Salinity (PPS): 33.620 - 37.091
  Oxygen (ml/l): 2.270 - 6.301
  Phosphate (umol/l): 0.052 - 2.810
  Silicate (umol/l): 0.899 - 180.924

Graphical representation

Depth range (m): 5 - 4977

Temperature range (°C): -1.103 - 25.462

Nitrate (umol/L): 0.075 - 39.473

Salinity (PPS): 33.620 - 37.091

Oxygen (ml/l): 2.270 - 6.301

Phosphate (umol/l): 0.052 - 2.810

Silicate (umol/l): 0.899 - 180.924
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neocalanus robustior

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTAAAATGGTTATGATCTTGTAATCATAAAGATATTGGTACGCTGTACTTACTTGCTGGGGCCTGGTCTGGAATGGTTGGAACTGGGCTCAGGATAGTCATTCGACTCGAGCTAGGGCAGGCTGGTTCACTGATTGGAGAC---GATCAGATTTATAATGTTGTTGTTACTGCACACGCGTTTATTATAATTTTTTTTATGGTTATGCCGATTTTAATTGGCGGATTCGGGAACTGGTTGGTCCCTCTTATGTTGGGGGCTGCAGACATGGCCTTCCCACGAATAAATAATATAAGATTTTGATTTTTAATGCCCGCTTTAGTTATACTGCTGTCTAGATCTCTTGTTGAAAGAGGGGCCGGGACAGGCTGAACAGTATACCCTCCATTGGCTAGAAATATTGCCCACGCAGGAGGGTCTGTAGATTTTGCGATTTTTTCCCTCCATCTGGCAGGGGTCAGATCAATCCTGGGGGCAGTAAATTTTATTAGTACCCTCGGGAACCTGCGGGTATTTGGTATACTATTAGATCGGATACCCCTATTTGCATGAGCAGTTTTAATTACTGCTATTTTACTTCTTTTATCTCTCCCTGTACTCGCCGGGGCGATTACAATGCTTTTAACGGATCGTAACTTAAATACCTCATTTTACGATGTCGGCGGAGGGGGGGACCCTATTCTCTATCAGCATTTATTTTGATTTTTTGGTCATCCTGAGGTCTATATTCTCATTCTCCCGGGGTTTGGACTAATTTCGCACATCGTGGCCCAGGAAAGGGGGAAAAAGGAAACATTTGGAGTTCTTGGGATAATTTATGCAATACTTGCCATTGGAATTCTAGGGTTTGTAGTGTGGGCCCACCATATATTCACAGTGGGAATGGACGCGGACACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neocalanus robustior

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!