Overview
Distribution
European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, United Kingdom Exclusive Economic Zone
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Boxshall, G. (2001). Copepoda (excl. Harpacticoida), in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 252-268
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=1330
-
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One.
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
Epipelagic
-
Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=145459
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.
Environmental ranges
Depth range (m): 5 - 4977
Temperature range (°C): -1.103 - 25.462
Nitrate (umol/L): 0.075 - 39.473
Salinity (PPS): 33.620 - 37.091
Oxygen (ml/l): 2.270 - 6.301
Phosphate (umol/l): 0.052 - 2.810
Silicate (umol/l): 0.899 - 180.924
Graphical representation
Depth range (m): 5 - 4977
Temperature range (°C): -1.103 - 25.462
Nitrate (umol/L): 0.075 - 39.473
Salinity (PPS): 33.620 - 37.091
Oxygen (ml/l): 2.270 - 6.301
Phosphate (umol/l): 0.052 - 2.810
Silicate (umol/l): 0.899 - 180.924
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 21 samples.
Environmental ranges
Depth range (m): 5 - 4977
Temperature range (°C): -1.103 - 25.462
Nitrate (umol/L): 0.075 - 39.473
Salinity (PPS): 33.620 - 37.091
Oxygen (ml/l): 2.270 - 6.301
Phosphate (umol/l): 0.052 - 2.810
Silicate (umol/l): 0.899 - 180.924
Graphical representation
Depth range (m): 5 - 4977
Temperature range (°C): -1.103 - 25.462
Nitrate (umol/L): 0.075 - 39.473
Salinity (PPS): 33.620 - 37.091
Oxygen (ml/l): 2.270 - 6.301
Phosphate (umol/l): 0.052 - 2.810
Silicate (umol/l): 0.899 - 180.924
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Neocalanus robustior
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GTAAAATGGTTATGATCTTGTAATCATAAAGATATTGGTACGCTGTACTTACTTGCTGGGGCCTGGTCTGGAATGGTTGGAACTGGGCTCAGGATAGTCATTCGACTCGAGCTAGGGCAGGCTGGTTCACTGATTGGAGAC---GATCAGATTTATAATGTTGTTGTTACTGCACACGCGTTTATTATAATTTTTTTTATGGTTATGCCGATTTTAATTGGCGGATTCGGGAACTGGTTGGTCCCTCTTATGTTGGGGGCTGCAGACATGGCCTTCCCACGAATAAATAATATAAGATTTTGATTTTTAATGCCCGCTTTAGTTATACTGCTGTCTAGATCTCTTGTTGAAAGAGGGGCCGGGACAGGCTGAACAGTATACCCTCCATTGGCTAGAAATATTGCCCACGCAGGAGGGTCTGTAGATTTTGCGATTTTTTCCCTCCATCTGGCAGGGGTCAGATCAATCCTGGGGGCAGTAAATTTTATTAGTACCCTCGGGAACCTGCGGGTATTTGGTATACTATTAGATCGGATACCCCTATTTGCATGAGCAGTTTTAATTACTGCTATTTTACTTCTTTTATCTCTCCCTGTACTCGCCGGGGCGATTACAATGCTTTTAACGGATCGTAACTTAAATACCTCATTTTACGATGTCGGCGGAGGGGGGGACCCTATTCTCTATCAGCATTTATTTTGATTTTTTGGTCATCCTGAGGTCTATATTCTCATTCTCCCGGGGTTTGGACTAATTTCGCACATCGTGGCCCAGGAAAGGGGGAAAAAGGAAACATTTGGAGTTCTTGGGATAATTTATGCAATACTTGCCATTGGAATTCTAGGGTTTGTAGTGTGGGCCCACCATATATTCACAGTGGGAATGGACGCGGACACTCGTG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Neocalanus robustior
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
