Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits outer reef slopes or deep clear lagoons among rubble or clumps of algae; also in seagrass beds (Ref. 1602, 41878, 58302). Often in sheltered estuaries and harbors (Ref. 48636). Benthic and benthopelagic (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Indo-Pacific and is found from Eastern Africa and the Red Sea to the Hawaiian Islands and the Marquesas, north to Japan and south to Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to the Hawaiian and Marquesan islands, north to southern Japan, south to Vanuatu.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands, north to southern Japan, south to Lord Howe Island and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits outer reef slopes or deep clear lagoons among rubble or clumps of algae; also in seagrass beds. Found at depths greater than 15 m and recorded up to 100 m (Ref. 2334).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body variable from brown to yellow or green mixed with various color shades or spots. Males develop long filaments on the caudal fin (Ref. 48636). Young with a broad, dark lateral stripe which breaks into dark blotches in adults, the largest above distal pectoral fins. A small dark spot behind eye. Mouth terminal or lower jaw slightly projecting. Caudal fin of terminal males rhomboid, with central rays longest, and dorsalmost caudal-fin ray elongated into a short filament. A small species (reaching about 14 cm) (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits clear lagoon and seaward reefs, over rubble or sand, also found in seagrass beds, from two to 110 m (Lieske and Myers 1994, Allen 2000, Sadovy and Cornish 2000). There is no information on the reproductive biology or ecology on this species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 110 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 175 specimens in 1 taxon.
Water temperature and chemistry ranges based on 67 samples.

Environmental ranges
  Depth range (m): 0.915 - 110
  Temperature range (°C): 23.278 - 29.214
  Nitrate (umol/L): 0.052 - 2.632
  Salinity (PPS): 33.507 - 35.833
  Oxygen (ml/l): 4.230 - 4.778
  Phosphate (umol/l): 0.055 - 0.443
  Silicate (umol/l): 0.506 - 7.618

Graphical representation

Depth range (m): 0.915 - 110

Temperature range (°C): 23.278 - 29.214

Nitrate (umol/L): 0.052 - 2.632

Salinity (PPS): 33.507 - 35.833

Oxygen (ml/l): 4.230 - 4.778

Phosphate (umol/l): 0.055 - 0.443

Silicate (umol/l): 0.506 - 7.618
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 110m.
From 2 to 110 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits outer reef slopes or deep clear lagoons among rubble or clumps of algae; also in seagrass beds (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Oxycheilinus bimaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Oxycheilinus bimaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACCTTGTATTTGGTGCCTGAGCCGGGATAGTAGGCACTGCCCTTAGCCTGCTTATTCGAGCAGAGCTCAGTCAACCAGGAGCCCTCCTCGGAGATGACCAAATCTATAACGTAATCGTTACAGCCCATGCTTTCGTTATGATTTTCTTTATAGTAATACCAATCATGATTGGGGGCTTTGGAAACTGACTCATCCCCCTGATGATCGGGGCCCCTGATATAGCCTTCCCTCGTATAAATAACATGAGCTTCTGGCTCCTCCCTCCCTCCTTCCTCCTTCTCCTAGCATCATCCGGCGTAGAAGCAGGGGCTGGAACAGGATGAACAGTCTACCCTCCTCTAGCCGGAAACTTAGCCCACGCAGGTGCATCCGTCGACCTGACCATCTTCTCCCTTCACTTAGCCGGAATTTCATCAATTCTAGGGGCTATCAACTTTATTACAACAATTATCAACATGAAACCCCCTGCCATTACTCAATACCAAACCCCTCTGTTTGTCTGAGCAGTCCTTATTACAGCCGTTCTTCTCCTGCTCTCCCTCCCTGTCCTTGCCGCGGGAATTACAATGCTTTTAACAGACCGAAACTTAAACACTACTTTCTTCGACCCAGCCGGAGGGGGAGACCCGATTCTTTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
To, A., Liu, M., Rocha, L. & Craig, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the Indo-Pacific, and is common in some parts of its range. There are no major threats known to this species. It is listed as Least Concern. However, more information on population trends and its harvest level is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. It can be common in some parts of its range. There are occasional accounts on the relative abundance of this species.

In Pondoland coast of South Africa where only six individuals of O. bimaculatus were recorded from 261 underwater point-counts and resulting in fish density of 0.38/1000 m2 (Mann et al. 2006). In French Polynesia, a total of four individuals were counted in various UVC survey with body sizes of 709 cm TL (M. Kulbicki pers. comm. 2008). While in Northwestern Hawaiian Islands, O. bimaculatus was one of the top 35 most abundant fish species, with a mean abundance of 0.27 at each site (Parrish and Boland 2004). The underwater visual census in Okinawa seagrass beds also reported relatively high density of O. bimaculatus among all fishes recorded (Nakamura and Tsuchiya 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, atlhough it is utilized as both food fish and aquarium fish (Gell and Whittington 2002, Mulochau and Durville 2005, Shao 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for this species. However, this species distribution includes a number of Marine Protected Areas within its range. Individuals of this species have been recorded in several marine protected areas. However, details of their recent status is often lacking in many other countries. There are very few fishery management measures relevant to this species, and monitoring on its international trade is absent.


Country-specific
Madagascar
Labrids are not major catches in the reef fishes surrounding the south-west Madagascar in 1997 (Laroche et al. 1997), but catch-per-unit-effort is still relatively high in these fishing grounds. There are two marine protected areas, with no-take zones, located in the northwest region of Madagascar (McKenna and Allen 2005). This species was occasionally sighted during a rapid biodiversity survey in northwest Madagascar, and is likely protected within the protected areas (McKenna and Allen 2005).

Australia
Queensland
Marine parks are established within Queensland. Marine parks are zoned for different purposes and offer different levels of protection from recreational and commercial fishing activities (Environmental Protection Agency 2008). For fishery management, a minimum size of 250 mm TL and a bag limit of five fish apply to all wrasses (Department of Primary Industries and Fisheries 2008a). There are three, nine-day closure to the taking of all coral reef fishes in Queensland east coast waters, which are in October, November and December each year around the new moon phase (Department of Primary Industries and Fisheries 2008b). There is no specific management measure or regulation on this species in commercial food fish fishery.

Taiwan
There is no fishery management or regulations on this species in Taiwan. O. bimaculatus occurs within the Kenting National Park (Shao 2005). Its recorded occurrence in Tung Sha Tao (Pratas Island), which is now a protected area, offer protection to this species (Chen et al. 1995). This species is used in aquarium trade but quantitative data on its catcher are absent (Shao 2005). There is no information on the aquarium fish trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!