Overview

Comprehensive Description

Biology

Usually in groups on the outer reef (Ref. 30573). Caught with nets, and other types of artisanal gears.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Red Sea and Gulf of Aqaba. It does not appear to occur in the Gulf of Aden. A survey done in the eastern Gulf of Aden in 2005 recorded Chlorurus strongylocephalus (J.H. Choat pers comm 2009). The record from Socotra needs to be verified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Red Sea. The species complex comprise of Chlorurus gibbus in the Red Sea, Chlorurus strongylocephalus in the Indian Ocean and Chlorurus microrhinos in the west-central Pacific.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea endemic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

70.0 cm TL (male/unsexed; (Ref. 30573)); max. published weight: 4,000 g (Ref. 3488); max. reported age: 14 years (Ref. 13619)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is a large excavating Chlorurus up to 70 cm (Lieske and Myers 2004). It inhabits shallow reefs and adjacent sand areas of lagoons and bays at depths between about 2-30 m (G. Allen pers comm. 2009). It forms small schools.

There is limited information on its life history. The age record of 14 years (Choat et al. 1996) refers to C. microrhinos.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 3 - 27
  Temperature range (°C): 28.899 - 28.933
  Nitrate (umol/L): 0.094 - 0.118
  Salinity (PPS): 34.080 - 34.113
  Oxygen (ml/l): 4.527 - 4.531
  Phosphate (umol/l): 0.087 - 0.116
  Silicate (umol/l): 1.073 - 1.526

Graphical representation

Depth range (m): 3 - 27

Temperature range (°C): 28.899 - 28.933

Nitrate (umol/L): 0.094 - 0.118

Salinity (PPS): 34.080 - 34.113

Oxygen (ml/l): 4.527 - 4.531

Phosphate (umol/l): 0.087 - 0.116

Silicate (umol/l): 1.073 - 1.526
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Usually in groups on the outer reef (Ref. 30573). Feeds on algae, and inhabits on reef edge.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chlorurus gibbus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTCCTTATCCGAGCTGAACTAAGTCAACCCGGGGCCCTTCTCGGAGACGACCAGATTTATAATGTTATCGTTACAGCTCATGCATTTGTAATGATCTTTTTTATAGTCATGCCTATCATGATTGGAGGCTTCGGGAACTGACTCATCCCACTCATGATTGGAGCACCTGACATAGCCTTCCCTCGAATAAACAATATGAGCTTCTGACTCCTTCCTCCTTCCTTCCTCCTATTGCTCGCCTCCTCTGGCGTAGAAGCAGGAGCAGGTACCGGATGGACCGTTTACCCCCCTCTAGCAGGGAATCTTGCACACGCAGGGGCATCCGTTGACCTAACAATTTTCTCTCTTCACCTAGCAGGGATTTCATCTATTCTAGGCGCAATCAACTTTATCACAACCATCATTAACATGAAACCGCCTGCCATCTCCCAATACCAAACGCCCCTATTCGTATGAGCTGTTTTAATTACTGCCGTGCTTCTTCTCCTCTCGCTCCCTGTCCTTGCTGCAGGAATCACAATGCTTCTCACAGATCGAAATCTAAACACTACCTTCTTTGACCCTGCAGGCGGAGGAGACCCGATTCTCTATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chlorurus gibbus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Choat, J.H., Carpenter, K.E., Clements, K.D., Rocha, L.A., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is found in the Red Sea. It is fished throughout its range of distribution. It is more common in the northern part of its range and is found in a number of marine reserves. It is therefore listed as Least Concern.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is uncommon in the Red Sea. Mean density of 23.9 individuals per hectare was recorded at Duba, Saudi Arabia (A.M. Ayling pers comm 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range (i.e., Ras Muhammed Marine Protected Area).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!