Overview

Comprehensive Description

Biology

Grows to 3 m in length and 300 kg in weight (Ref. 28581). Reported length of 7 m SL (Ref. 6866) and 500 kg weight (Ref. 4537, 58490) are doubtful (Paxton, pers. comm.). Piscivorous throughout most of its life. Threatened due to over harvesting and habitat loss (Ref. 58490).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Asia: China, endemic to the Yangtze River and its tributaries. International trade restricted (CITES II, since 1.4.98; CMS Appendix II).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Chinese Paddlefish is endemic to the Yangtze River (including the brackish water of the mouth) in China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 7000 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

300 cm TL (male/unsexed; (Ref. 28581)); max. published weight: 300.0 kg (Ref. 28581)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head very long, snout extraordinarily long, pointed and paddle-like and base broad; mouth very large.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Yangtze River Demersal Habitat

This taxon is one of a number of demersal species in the Yangtze River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton.

The upper Yangtze basin consists chiefly of Paleozoic limestone and terrigenous sedimentary rock, with some granitic material. The most downstream element of the upper Yangtze basin is often termed the Sichuan Basin; here the Yangtze cuts through Triassic and Permian material before entering the Three Gorges. The Three Gorges area is a stretch of the Yangtze that runs approximately 660 kilometers, terminating at the site of the Three Gorges Dam. Prior to construction of the dam, the Three Gorges area was a site of exceptional natural beauty; after dam construction the gorge areas were filled with approximately 100 meters in depth of Yangtze water, and considerable amounts of the watershed were graded.

The lower Yangtze basin consists of anabranching river structures and Pleistocene coastal terraces. Prior to development of the Three Gorges Dam, the Yangtze Delta was replenished with a copious sediment load reaching the river mouth; however, the dam has now severely limited the natural flow and deposition of sediment to the delta region. Consequently, the integrity of the delta is been compromised, with scouring exceeding deposition, and the very stability of the delta is endangered.

Lower and middle basins of the Yangtze carry heavy pollutant loads. In the lower Yangtze basin nitrate levels are high, measuring at about 1000 tons per day at Datong; these levels accrue from high applications of chemical fertilizer applied and also considerable loadings of untreated sewage due to the large human population of the basin, with correspondingly little infrastructure for sewage treatment.

Heavy metal concentrations are also high in the lower Yangtze, with measurements of dissolved lead at 0.078 microgram/liter; cadmium (0.024 microgram/liter), chromium (0.57 microgram/liter), copper (1.9 microgram/liter), and nickel (0.50 microgram/liter). Levels of dissolved arsenic have been measured at 3.3 microgram/liter) and zinc at 1.5 microgram/liter), both notably higher by factors of 5.5 and 2.5 respectively than other typical large world rivers. In Yangtze River suspended sediment, arsenic comprises 31 microgram/gram, lead comprises 83 microgram/gram, and nickel comprises 52 micrograms/gram of sediment content

There are several large native demersal fish found in the Yangtze River, chiefly the 250 centimeter (cm) long endangered Yangtze sturgeon (Acipenser dabryanus), the 120 cm Chinese sturgeon (Acipenser sinensis), the 200 cm Giant mottled eel (Anguilla marmorata), the 122 cm black carp (Mylopharyngodon piceus), the 300 cm Chinese paddlefish (Psephurus gladius), and the 100 cm Silurus meridionalis. Furthermore, there are a few exceptionally large native benthopelagic fishes found in the Yangtze, namely, the 105 cm Silver carp (Hypophthalmichthys molitrix), the 200 cm Wuchang bream (Megalobrama amblycephala), the 200 cm yellowcheek (Elopichthys bambusa), the 145 cm common carp (Cyprinus carpio carpio), the 122 cm Mongolian redfin (Chanodichthys mongolicus), the 102 cm predatory carp (Chanodichthys erythropterus) and the 100 cm snakehead (Channa argus argus).. The demersal fish Silurus meridionalis also is found as a Yangtze River endemic species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This paddlefish is considered anadromous (spends at least part of it's life in the sea and migrates upriver to reproduce). This species occurs in broad surfaced main streams of large rivers, staying usually in middle and lower layers of the water column, and occasionally swims into large lakes. Its spawning period is in March and April. Spawning sites are located in the upper reaches of the Changjiang River. Available information also indicates that spawning took place in the lower Jinsha River between Shuifu and Yibin (Liu and Zeng 1988; Li et al. 1997).

The largest specimen recorded was 7 m in length and weighed over several thousand kg.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Lives in main streams of large rivers and occasionally swims into lakes (Ref. 45563). Feeds on fish and benthic crustaceans (Ref. 28581).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psephurus gladius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGTTGATTCTTTTCTACTAACCACAAAGATATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGTACGGCCCTGAGCCTTCTGATTCGTGCCGAATTGAGCCAACCCGGTGCCTTACTTGGCGAT---GATCAAATCTATAATGTCATCGTCACAGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAATTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCCTTCCCTCGCATGAATAATATGAGCTTCTGGCTCCTACCCCCATCTTTCCTTCTCCTTTTGGCTTCCTCTGGGGTAGAAGCCGGAGCTGGCACCGGATGAACTGTATACCCCCCTTTAGCAGGAAACCTGGCCCACGCAGGAGCCTCTGTAGACCTTACTATTTTCTCCCTCCACTTGGCTGGGGTATCATCCATCTTAGGGGCCATTAACTTTATCACTACAATTATCAACATGAAACCCCCTGCAGTATCCCAATATCAAACCCCCCTATTCGTTTGGTCTGTGCTAATCACAGCTGTTCTTCTCCTTCTCTCACTACCAGTTCTAGCTGCCGGAATTACAATGCTACTAACAGACCGAAATTTAAACACCACATTCTTTGACCCCGCCGGGGGAGGAGACCCCATCCTCTATCAACACCTATTCTGATTCTTTGGCCACCCAGAGGTATATATTCTAATTTTACCAGGGTTCGGCATGATCTCCCACATCGTAGCCTACTATGCAGGTAAAAAGGAACCCTTTGGGTACATAGGCATGGTGTGAGCTATGATGGCTATCGGTCTATTAGGTTTTATCGTGTGAGCCCACCACATATTTACAGTCGGAATGGACGTTGACACACGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Psephurus gladius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd;C2a(i);D

Version
3.1

Year Assessed
2010

Assessor/s
Qiwei, W.

Reviewer/s
Pourkazemi, M., Zhang, H., Du, H. & Smith, K.

Contributor/s

Justification
The population of the Chinese Paddlefish decreased due to historical overfishing and habitat degradation. In 1981, the construction of the Gezhouba Dam in the middle reaches of the Yangtze River blocked the migration route of this species, preventing adult fish moving to the upper reaches of the river to spawn. Only two adult specimens (both females) have been recorded since 2002, despite recent surveys to re-discover the species. Juveniles were last recorded in the lower reaches of the river in 1995. It is expected that there are less than 50 mature individuals left in the wild and this species is assessed as Critically Endangered (Possibly Extinct), though more extensive surveys are needed in areas across the species range in order to confirm whether or not individuals of this species remain.

History
  • 1996
    Critically Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
From the mid-20th century the population of the Chinese Paddlefish decreased significantly. Incidental capture data between 1982-2008 from the upper, mid and lower sections of the Yangtze River indicate the largest number of this species found during this period was in 1985, when 32 individuals were captured in the lower section (below the Gezhouba Dam) (Zhang et al. 2009). In 1995 juveniles of this species were recorded below the Gezhouba Dam of the Yangtze River (Chen 2008).

Two specimens (1.2 kg weight, 47 cm tail length; 1.3 kg weight, 50 cm tail length) were found in the Chongqing reach in 1992 (Chen 2007). In 2002, a female Chinese Paddlefish (body length 330 cm, weight 117 kg) was captured in the section of Jiangsu Nanjing, Yangtze River. Urgent attempts were made to save this individual, but it only survived in captivity for 30 days. On Jan 24th, 2003, a female (body length 352 cm) was accidentally caught in Yibin, Sichuan Province China (upper stream of Yangtze River). It was captured, tagged with an ultra-sonic tag and released by Dr. Wei’s team of the Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences. Unfortunately, after 12 hours of tracking, communication was disconnected. Between 2006 and 2008, Dr.Wei’s team used a number of boats to deploy 4,762 setlines, 111 anchored setlines and 950 drift nets covering a stretch of 412.5 km of the upper Yangtze River in a bid to catch the fish, but they failed to catch a single individual (Zhang et al. 2009). The team also used hydroacoustic equipment that beams sound through the water to create a picture of the river and anything in it. This identified nine possible targets, of which two could be paddlefish (Zhang et al. 2009). This species is considered to be the verge of extinction. Artificial reproduction has not been successful.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Critically Endangered (CR) (A2cd; C2a(i); D)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The Chinese Paddlefish has historically been overfished. The long-life history of this species (e.g. late sexual maturation and large size) means the population will take a longer time to recover from depletion.

In 1981 the Gezhouba Dam was built in the middle reaches of the Yangtze River, blocking the migration route of this species and preventing adult fish moving to the upper reaches of the river to spawn.

Fries of P. gladius form schools along the river, thus becoming easily captured in traditional Chinese fishing nets and set nets (Zhang et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
P. gladius is listed as a first-class state protected animal in China. Due to its endemicity and rarity, this species possesses significant academic and economic importance. This species was listed on CITES Appendix II in 1998.

An integrated rescue programme was initiated in 2005. This extensive programme hopes to re-discover this species. It is also investigating habitat and plans to conduct studies on foraging behaviours and instigate captive breeding programmes, propagation for release, preservation of genetic resources, and even cloning (Zhang et al. 2009).

The “Protective Laws of Aquatic Products Resources” should be implemented and increased awareness of the significance of the protection of the species is needed (Wei Qiwei et al. 2003).

Current studies hope to investigate artificial breeding with the hope of releasing captive bred fries into rivers, ponds and reservoirs. The success of this work depends upon finding wild adult specimens.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chinese paddlefish

Chinese Paddlefish, Psephurus gladius (simplified Chinese: 白鲟; traditional Chinese: 白鱘; pinyin: báixún), also known as Chinese Swordfish, are among the largest freshwater fish. It is one of two extant paddlefish species, the other being the American Paddlefish (Polyodon spathula). It is also called "elephant fish" (象魚; xiàngyú) because its snout resembles an elephant trunk. It is recorded sometimes in Classical Chinese as wěi-fish (鮪). More poetically, it is sometimes referred to as the "Giant Panda of the Rivers", not because of any physical resemblance to a panda, but because of its rarity and protected status.

The Chinese Paddlefish is the People's Republic of China's first-level protected animal. Its belly is white and back and head grey. They live mostly in the middle or lower part of the Yangtze (Chang Jiang), occasionally in large lakes. They feed on other fish, as well as small amounts of crabs and crayfish. Paddlefish are sexually mature at age seven or eight, with a typical body length of 2 metres and a weight of 25 kilograms.

It is said that the zoologist Bǐng Zhì (秉志) recorded around the 1950s that some fishermen caught a paddlefish of 7-metres, although the authenticity of the story is unconfirmed. It is said that the Chinese paddlefish can grow to 23 feet and weigh 1,100 pounds, but little research on a maximum size can be conducted today due to the species' scarcity.

Due to overfishing, the Chinese Paddlefish is critically endangered now, and officially recognized by the People's Republic in 1983 to prevent fishing of paddlefish young or adults. Paddlefish are also threatened by dams (such as the Three Gorges Dam) which divide the population into isolated groups. The fish are rarely seen, recently raising concerns that the species might already be extinct. During a three-year search conducted from 2006–2008 a research team from the Chinese Academy of Fisheries Science in Jingzhou failed to find even one specimen.[1] The last confirmed sighting of the fish alive occurred January 24, 2003 on the Yangtze.[1] However, a 3.6-meter, 250 kilogram specimen was captured by illegal fishing on January 8, 2007, in Jiayu County. Local villagers contacted officials who rushed to the site. Zeb Hogan of Monster Fish on National Geographic Channel and other conservationists transferred the fish to a holding pen in hope that it would survive. But shortly afterwards it died due to unrecoverable injuries sustained while thrashing in the net.[2]

References

  1. ^ a b Bourton, Jody (2009-09-29). "Giant fish 'verges on extinction'". BBC News (London: BBC). Retrieved 2009-09-29. 
  2. ^ "Chinese Paddlefish Dies in Illegal Fishing". CRIENGLISH.com (China Radio International). 2007-01-12. Retrieved 2009-09-29. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!