Overview

Comprehensive Description

Biology

Inhabits mud, sand or gravel bottoms (Ref. 44894). Sluggish species that prefers still or slow-flowing waters, usually in deep pools. During period of drought, it can tolerate stagnant conditions by breathing air, surfacing 1-2 times per hour; however, it lacks the ability to survive dry spells by aestivation; it is a facultative air-breather that will die if forced to depend on air breathing (Ref. 36739, 44894). The sound of the lungfish exhaling air at the surface prior to inhaling a fresh breath has been likened to that made by a small bellows. Nocturnally active (Ref. 44894). Feeds on frogs, tadpoles, fishes, shrimp, earthworms, snails, aquatic plants and native fruits fallen from trees overhanging the creeks (Ref. 36739, 44894). It browses among the detritus, using its electroreceptors to pick up hidden mollusks, worms or crustaceans. Protected by law. Fossil records show that this species remained virtually unchanged for over 380 million years. The Steinhart Aquarium in San Francisco had a specimen of 1 m length, 20 kg weight, and more than 65 years of age. In 1933, an Australian lungfish was transported as a fully mature male (10 yrs. old at maturity) to the Shedd Aquarium, Chicago (C. Skonieczny, pers. comm. 11/08, e-mail: CSkonieczny@sheddaquarium.org).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Oceania: southern Queensland, Australia in Burnett and Mary River systems. Introduced successfully in southeastern Queensland. International trade restricted (CITES II, since 1.7.1975).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Australian lungfish are found in south-eastern Queensland in Australia, in the Burnett, Mary, North Pine, and Brisbane Rivers, as well as in the Enoggera Reservoir. Their exact native distribution, however, cannot be verified due to the transplantation of several lungfish in 1898 to the Enoggera Reservoir, the North Pine River, the Brisbane River, and various other locations where they were previously believed not to exist (Kemp 1987). Many of these translocated populations may now be low in abundance if not completely absent from some areas. Australian lungfish are partially restricted to their current environment, because they cannot survive in saline water. This inhibits migration through seas to other potentially habitable locations. Also, the splitting of Pangaea is believed to have geographically isolated Australian lungfish (Alrubaian et al 2006).

Biogeographic Regions: australian (Native )

  • Alrubaian, J., J. Lee, R. Dores. 2006. Are lungfish living fossils? Observation on the evolution of the opoid gene/orphnin gene family. General and Comparitive Endocrinology, 148: 304-316.
  • Department of the Environment, Water, Heritage and the Arts, 2009. "Neoceratodus forsteri - Australian lungfish" (On-line). Department of the Environment, Water, Heritage and the Arts. Accessed March 26, 2009 at http://www.environment.gov.au/cgi-bin/sprat/public/publicspecies.pl?taxon_id=67620.
  • Kemp, A. 1987. The Biology of the Australian Lungfish, Neoceratodus forsteri. Centennial Supplement: Journal of Morphology, 1: 181-198.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Mature Australian lungfish possess a “wide flat head, a thick heavy body, a diphycercal tail, and paddle-shaped fins” (Kemp 1987). Lungfish range in size from about 82.5 to 112.5 cm, though some have measured up to 2 m. Large individuals can weigh up to 48 kg. Except for the anterior region of the head, Australian lungfish are enveloped with a network of at least four overlapping scales, which provides some protection for its more pregnable, underlying areas. Adults have a tiny mouth with relatively large teeth on the palate and the lower jaw. They are olive-green or grey-brown in color on the dorsal side, yellow-orange below, and also have some white on their ventral side. In contrast to adults, juvenile lungfish have a more circular head, shorter fins, a scrawny trunk, and their underside is a faint pink color. Males and females appear the same, though the belly color of males changes during the breeding season.

Australian lungfish have a single lung, as opposed to the paired lungs present in the other species of lungfish Lepidosiren paradoxa. This lung is used for aerobic respiration when it is more animated and needs additional oxygen. Increased dependency on oxygen in lungfish takes place only under specific circumstances, such as while grazing for food at night, during periods of flood when waters are highly turbid, and/or throughout spawning.

Range mass: 48 (high) kg.

Range length: 82.5 to 112.5 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1700 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

170 cm TL (male/unsexed; (Ref. 26188)); max. published weight: 40.0 kg (Ref. 5259)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body stout and elongate. Dorsal fin originating on the middle of the back, confluent with caudal and anal fins. Body covered with large, bony, overlapping scales. The head is flattened, with conical profile. The eyes are small; the mouth is reaching about half the distance to eye. The pectoral fins are large and flipper-like in ventral position just behind the head; the pelvic fins are also flipper-like, situated far back on the body.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Typical habitats of Australian lungfish consist of “still or slow-flowing, shallow, vegetated pools” in areas of constant, lasting water (Department of the Environment et al. 2009). Ideal environments are shaded and away from open water and are characterized by permanent water, little mud, and vegetation and a substrate composed of fine sand and gravel. Australian lungfish are found in deep water in winter and during the day and in shallower water in the spawning season and at night. In other areas, mature lungfish dwell in or near dense and overhanging vegetation. Young lungfish inhabit areas adjacent to complex weed banks and remain in such habitats for months or years.

Habitat Regions: tropical ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of Australian lungfish changes with their progressive development, especially as their dentition develops. When young lungfish first begin to feed, they possess several “sharp, cone-shaped teeth” that act to seize and hold their quarry (Department of the Environment et al. 2009). At this stage, they typically cull worms and small crustaceans such as brine shrimp. Young juveniles also may attempt to prey on animals similar in size to themselves, although this is not frequent, as digestion is routinely limited.

Eventually, the cone-shaped teeth of Australian lungfish expand and slightly erode into tooth plates. Adults are “benthic omnivores” (Department of the Environment et al. 2009). These mature fish feed on a variety of animals including “ frogs, tadpoles, fishes, shrimps, prawns, earthworms, aquatic snails, bivalve mollusks... moss, fallen flowers from Eucalyptus trees and aquatic plants” (Department of the Environment et al. 2009). Outside of their natural environment, adults have been observed consuming several additional foods, such as “insect larvae...meat, offal...dried dog or poultry food...and dead toads” (Kemp 1987). While hunting for food, lungfish often eat some plants, which pass through their body undigested. This vegetation may be ingested in order to also consume miniscule organisms bound to it.

Animal Foods: amphibians; fish; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: flowers; bryophytes

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Australian lungfish prey on a variety of organisms, but little else is known about their role in their ecosystem. They may compete with certain endemic fish, like Tilapia, for breeding sites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Certain endemic fishes, such as Tilapia, are speculated to feed on juveniles and the eggs of Australian lungfish. They also may compete with adult lungfish for breeding sites. Other predators of pre-mature, young lungfish also include insect larvae, small crustaceans, jewfish, and wood ducks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little is known regarding the means of sensory perception and communication of Australian lungfish. Young juveniles can undergo a color change as response to light stimulation, but this capability is slowly inhibited as the presence of pigment increases. Despite the common misbelief that eyes of lungfish are of little to no use, Australian lungfish do exhibit some level of phototaxy due to the presence of opsins, which allow the fish to “fine-tune [their] spectral sensitivity to environmental light” (Bailes et al. 2007). Three different types of cones equip lungfish with the potential to see in color. Some of these cones contain “brightly coloured oil droplets or spectral filters...thought to improve colour vision" (Bailes et al. 2006). These spectral filters also increase the ability of lungfish to distinguish between objects based on their color, “including those of ecological significance” (Bailes et al. 2006). This ability could aid lungfish greatly in the essentially transparent waters of their freshwater habitats. In addition to visual perception, lungfish utilize electroreception to detect faint, electric fields encompassing hidden, potential prey. Australian lungfish are also capable of picking up vibrations produced by other animals, which is useful for hunting and survival.

Perception Channels: visual ; vibrations ; electric

  • Bailes, H., S. Collin, A. Trezise, W. Davies. 2007. Visual pigments in a living fossil, the Australian lungfish Neoceratodus forsteri. BMC Evolutionary Biology, 7: 1-8.
  • Bailes, H., S. Robinson, A. Trezise, S. Collin. 2006. Morphology, characterization, and distribution of retinal photoreceptors in the Australian lungfish Neoceratodus forsteri. Journal of Comparative Neurology, 494: 381-397.
  • Evans, C., M. Watt, J. Joss. 1999. Use of electrorecption during foraging by the Australian lungfish. Animal Behavior, 58: 1039-1045.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The lungfish spawns from August to October; the eggs resemble small transparent grapes and are frequently found attached to floating stands of water-hyacinth. Spawning appears to occur in a series of three phases: in the first, a pair of fish move together, roaming about an area, presumably in search of a suitable spawning site; in the second presumably the male follows the female, nudging her flanks; finally, the fish plunge through the surrounding weed, the male following the female and fertilising the eggs as they are shed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Length of each stage of development varies considerably among individual Australian lungfish. Egg persistence is highest in shallow water that is condensed with macrophytes. Each egg produced is enveloped in a “vitelline” and a three-layered jelly membrane. Cleavage occurs briskly, and after 36 hours a large-celled blastula forms. After about 3.5 to 4.5 days, the small-celled blastula develops, and invagination occurs after a large fluid-filled blastocoel is produced around 7 days. The “gastrulation stages” take place during the next day in most cases, and neurulae arise during the following 2 days. Four to 6 days later, head structures begin to appear as the head starts to extend forwards. Initial formation of pigment occurs around the 17th day. During this time, the vitelline expands and broadens, yielding various cracks until it is completely broken up and separated. As the embryo further develops, the middle layer of the “triple jelly” lining disintegrates from the inside, slowly inducing the expansion of the outermost layer or “capsule.” Just prior to hatching, lungfish express pigmentation and the lateral line system appears. Also around this stage in development, body proportions and position of mouth and dorsal fin change, and a pre-anal fin grows.

Hatching of Australian lungfish takes place as fish squeeze through a diminutive hole in the side of the capsule, which can occur as early as 23 days depending on environmental conditions. Hatching usually occurs after about 30 days. While the yolk is still available, the hatchling lies decumbently on its side. Feeding starts 4 to 6 weeks after hatching. In time, young Australian lungfish begin to feed more edaciously and act with less fear. They show no obvious external metamorphic activity and no definite distinction between individuals can be made until they become true adults. Most lungfish appear in close proximity to adults for 6 to 7 months after hatching. Adults retain some juvenile characteristics and “larval features”, suggesting that lungfish exhibit some paedomorphosis.

Development - Life Cycle: neotenic/paedomorphic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Australian lungfish can live 50 to 100 years.

Typical lifespan

Status: wild:
50 to 100 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male Australian lungfish reach sexual maturity at 15 years of age, while females reach sexual maturity at 20 years of age. Lungfish perform an elaborate routine of mating behaviors, but little is known about this process. Loud sounds made by lungfish when breathing air may also be involved in the mating process, though this is uncertain. Australian lungfish have been observed frequently and hastily circling in pairs near the water’s surface during mating season. Australian lungfish lay their eggs lying on their side while they are attached to a partner. Eggs are usually deposited individually, though occasionally in pairs, within waters of 16 to 26 degrees Celsius in temperature. Each female usually lays 50 to 100 eggs per mating, although each is capable of laying many more. About 95% of emerging eggs are immediately fertilized by the male and are carefully directed into a deligated environment. However, in contrast to this recorded act of deliberation, Australian lungfish have also been noted to “thrash their tails at the end of spawning...to disperse the eggs” (Department of the Environment et al. 2009). Eggs can be produced at any time during the day or night. Lungfish eggs best survive at depths of 200 to 800 mm.

Australian lungfish spawn from August to December, but eggs are most plentiful in September and October. Progeneration is initiated in correspondence to the increasing length of days and does not depend on rainfall or the water’s chemical make-up. Australian lungfish choose spawning sites with incredible specificity, though the manner of selection is unknown, as numerous suitable environments exist along riverbanks. Factors such as water depth, substrate composition, prevalence and composition of macrophyte species, and the height of surrounding macrophytes are crucial components of their choice of spawning site. Australian lungfish often choose a macrophyte species with “complex branching or leaf worls...because eggs that detach from the surface of these are less likely to fall to the bottom” (Department of the Environment et al. 2009). Ideal macrophyte beds contain an intricate network of algae, protozoa, worms, small mollusks and crustaceans. In the event that only an inadequate portion of the required spawning conditions can be met, Australian lungfish do not reproduce. Due to the specificity of breeding sites, complete progeneration has exclusively occured about every 20 years for more than a century. During breeding, Australian lungfish act very differently in stagnant water than in moving water. In calm waters, eggs are rarely found deeper than 50 to 100 mm, and lungfish opt to breed in areas where the substrate is sandy. In contrast, within flowing waters, eggs are often laid at depths of 200 to 600 mm in several different substrates.

Breeding season: Australian lungfish spawn from August to December.

Range number of offspring: 50 to 100.

Average age at sexual or reproductive maturity (female): 20 years.

Average age at sexual or reproductive maturity (male): 15 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

A nest or refuge is not produced by Australian lungfish parents. No protection or help is provided to offspring, as eggs are left on their own to develop after hatching.

Parental Investment: no parental involvement

  • Department of the Environment, Water, Heritage and the Arts, 2009. "Neoceratodus forsteri - Australian lungfish" (On-line). Department of the Environment, Water, Heritage and the Arts. Accessed March 26, 2009 at http://www.environment.gov.au/cgi-bin/sprat/public/publicspecies.pl?taxon_id=67620.
  • Kemp, A. 1987. The Biology of the Australian Lungfish, Neoceratodus forsteri. Centennial Supplement: Journal of Morphology, 1: 181-198.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neoceratodus forsteri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTATTACCCGTTGATTTTTCTCAACAAACCACAAAGACATTGGCACCCTGTATATAATCTTTGGTGCATGAGCTGGCATAGTTGGCACAGCCCTGAGCCTGCTAATTCGAGCAGAACTAAGCCAACCAGGCGCTCTACTAGGCGATGACCAAATTTACAACGTCCTCGTTACTGCGCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGCGGCTTTGGCAACTGGCTCATTCCCCTGATAATCGGGGCCCCTGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGGCTTCTGCCTCCATCCTTTCTCCTACTACTGGCATCTTCCGGGGTAGAAGCCGGAGCAGGCACCGGATGGACAGTATACCCTCCACTAGCCGGCAACTTGGCCCACGCTGGGGCATCAGTTGACCTAACCATCTTCTCGCTACACCTGGCAGGTGTGTCATCTATCCTCGGCTCCATCAACTTTATTACGACTATTATTAACATGAAACCACCAGCAATCTCACAATACCAAACACCCCTCTTTATCTGATCCGTGATAATCACTACAATCTTACTATTACTATCTCTCCCTGTACTAGCCGCCGGAATTACTATGCTACTAACCGACCGAAACTTGAACACAACATTCTTTGATCCGGCAGGAGGGGGAGACCCAATCTTGTACCAACACCTATTCTGATTCTTTGGCCACCCTGAAGTCTACATTCTTATCCTGCCCGGATATGGCATAATCTCCCACATCGTAGCCTATTATTCTGGAAAGAAAGAACCCTTTGGCTATATAGGAATAGTCTGAGCCATAATAGCTATTGGCCTATTAGGGTTTATCGTCTGAGCTCACCACATATTTACGGTCGGAATAGACGTTGACACACGAGCATACTTTACATCAGCAACAATAATTATTGCAATTCCAACGGGGGTGAAAGTATTTAGCTGGCTAGCCACACTGCATGGCGGGTCTATTAAATGAGAAACCCCACTCCTATGAGCCCTAGGATTTATCTTCTTATTTACAGTTGGAGGCCTCACCGGTATCGTGCTAGCCAACTCGTCCCTGGACATCGTTCTTCACGACACTTACTACGTAGTTGCCCACTTCCACTACGTTTTGTCAATAGGGGCTGTCTTTGCCATCATAGGGGGCTTTGTCCACTGATTCCCGCTGATAACAGGATATACTCTTCATAATACCTGGACAAAAATCCACTTCGGAGTTATGTTTATTGGGGTTAACCTGACATTTTTCCCTCAGCACTTCTTAGGCTTAGCGGGCATACCACGACGATACTCTGACTACCCAGACGCCTACACCCTATGAAACACTGTCTCCTCCATCGGTTCGCTAATCTCGTTAGTTGCTGTCATTATGCTACTGTTTATTATTTGAGAGGCATTCGCGGCAAAACGTGAAGTTATGTCTATTGAGCTGTCGCCAACTAACGTCGAATGACTACACGGTTGCCCGCCACCCCACCACACATTCGAAGAACCAGCGTTTGTCCAAGTACAGACCTCCCAACGATAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neoceratodus forsteri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

There are estimated to be fewer than 10,000 Australian lungfish currently in existence. In 2003, the species was declared a “vulnerable species” by the Environmental Protection and Biodiversity Conservation Act. Australian lungfish have been safeguarded by the Aborigines for thousands of years prior to the application of this protective label (Arthington 2008). Habitats of Australian lungfish have been negatively affected by environmental changes associated with agriculture, forestry, invasive species, and river impoundment. These changes to rivers reduce lungfish populations, disrupt the breeding process, and decrease juvenile recruitment. Man-made barriers, such as dams, change water quality downstream, as they frequently release oxygen deprived, sediment rich water that is detrimental to lungfish populations. Dams also limit lungfish movement, preventing the migration of adults to spawning areas. Dam induced flooding also destroys algal macrophyte beds. Macrophyte beds demolished within 6 weeks dam construction may need years to reform the dense beds that previously thrived. These floods also have the potential to kill hundreds of lungfish. Additional environmental threats to Australian lungfish include fertilizer and sewage runoff from agricultural activities, human effluents, and animal production facilities. Australian lungfish populations lack genetic diversity, which may further threaten the long-term survival of the species.

US Federal List: no special status

CITES: appendix ii

  • Arthington, A. 2008. Australian lungfish, Neoceratodus forsteri, threatened by a new dam. Environmental Biology of Fishes, 8: 211-221.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative impacts of Australian lungish on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Australian lungfish are important to research because of their position as "living fossils." Research on lungfish helps to elucidate the life history of ancestors of all land vertebrates.

Positive Impacts: research and education

  • Daczewska, M., A. Kacperczyk. 2008. The Australian lungfish (Neoceratodus forsteri)-fish or amphibian pattern of muscle development?. International Journal of Developmental Biology, 52: 279-286.
  • Joss, J. 2005. Lungfish Evolution and Development. General and Comparative Endocrinology, 148: 285-289.
  • Pearson, H. 2006. Dam project threatens living fossil. Nature, 442: 232-233. Accessed March 26, 2009 at http://www.nature.com/nature/journal/v442/n7100/full/442232b.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Queensland lungfish

The Queensland lungfish, Neoceratodus forsteri (also known as the Australian lungfish, Burnett salmon, and barramunda) is the sole surviving member of the family Ceratodontidae and order Ceratodontiformes. It is one of only six extant lungfish species in the world. Endemic to Australia,[1] the Ceratodontidae are an ancient family belonging to the subclass Sarcopterygii, or fleshy-finned fishes.

Fossil records of this group date back 380 million years, around the time when the higher vertebrate classes were beginning to evolve.[2] Fossils of lungfish almost identical to this species have been uncovered in northern New South Wales, indicating that Neoceratodus has remained virtually unchanged for well over 100 million years, making it a living fossil and one of the oldest living vertebrate genera on the planet.[2]

It is one of six extant representatives of the ancient air-breathing Dipnoi (lungfishes) that flourished during the Devonian period (about 413-365 million years ago) and is the most primitive surviving member of this lineage.[2][3] The five other freshwater lungfish species, four in Africa and one in South America, are very different morphologically from N. forsteri.[2] The Queensland lungfish can live for several days out of the water, if it is kept moist, but will not survive total water depletion, unlike its African counterparts.[1]

The small settlement of Ceratodus, Queensland, derives its name from that of the Queensland lungfish.

Range and distribution[edit]

The Queensland lungfish is native only to the Mary and Burnett River systems in south-eastern Queensland.[4] It has been successfully distributed to other, more southerly rivers, including the Brisbane, Albert, Stanley, and Coomera Rivers, and the Enoggera Reservoir in the past century. The Queensland lungfish has also been introduced to the Pine, Caboolture, and Condamine Rivers, but current survival and breeding success are unknown.[1] Formerly widespread, at one time at least seven species of lungfish were in Australia.[2]

Habitat[edit]

This species lives in slow-flowing rivers and still water (including reservoirs) that have some aquatic vegetation present on banks. It occurs over mud, sand, or gravel bottoms.[2] Australian lungfish are commonly found in deep pools of depths between 3 and 10 m[5] and live in small groups under submerged logs, in dense banks of aquatic macrophytes, or in underwater caves formed by the removal of substrate under tree roots on river banks. The lungfish is tolerant of cold, but prefers waters with temperatures between 15 and 25°C.[6]

The Queensland lungfish is incapable of surviving complete desiccation of its habitat, although it can live out of water for several days if the surface of its skin is constantly moist. Unlike the African species, Protopterus, it does not survive dry seasons by secreting a mucous cocoon and burying itself in the mud.[7]

The Queensland lungfish is essentially a sedentary species, spending its life within a restricted area. Its home range rarely extends beyond a single pool or, occasionally, two adjacent pools. It does not follow a set migratory path, but may actively seek out suitable spawning habitats between July and December.[8]

Physical description[edit]

Queensland lungfish

Queensland lungfish are olive-green to dull brown on the back, sides, tail, and fins, and pale yellow to orange on the underside.[4] They have been described as having a reddish colouring on their sides which gets much brighter in the males during the breeding season. This colouration is the only distinguishing sexual characteristic of the lungfish.[9] They have stout, elongated bodies and flattened heads with small eyes.[2] The mouth is small and in a subterminal position.[6] The lungfish can grow to a length of about 150 cm (4.9 ft), and a weight of 43 kg (95 lb).[4] It is commonly found to be about 100 cm (3.3 ft) and 20 kg (44 lb) on average.[2] Both sexes follow similar growth patterns, although the females grow to a slightly larger size.[6] They are covered in slime when taken from the water.[4]

The skeleton of the lungfish is partly bone, and partly cartilage. The vertebrae are pure cartilage, while the ribs are hollow tubes filled with a cartilaginous substance.[10] The body of the lungfish is covered with large, bony scales.[2] Ten rows occur on each side, grading to small scales on the fins. The scales are each embedded in their own pockets, and overlap extensively, such that vulnerable areas of the body are covered by a thickness of at least four scales. Two unusually large and thick interlocking scales cover the back of the head where the bony skull is thin. They have powerful diphycercal tails[6] that are long and paddle-shaped.[4] The pectoral fins are large, fleshy, and flipper-like. The pelvic fins are also fleshy and flipper-like and situated well back on the body. The dorsal fin commences in the middle of the back and is confluent with the caudal and anal fins.[2]

The dentition of the lungfish is unusual: two incisors, restricted to the upper jaw, are flat, slightly bent, and denticulated on the hind margin. These are followed by dental plates on the upper and lower jaws.[10]

Juveniles have different body proportions from mature adults. The head is rounder, the fins are smaller, and the trunk is more slender. The mouth is initially terminal, but shifts back as the fish grows. The dorsal fin typically reaches to the back of the head in young juveniles, and gradually moves caudally until it only extends to the mid-dorsal region in adults. They show a gradual change in body form as they develop, but no metamorphosis is externally detectable and no obvious point occurs at which they can be termed adult.[11] As a juvenile, the lungfish is distinctly mottled with a base colour of gold or olive-brown. Patches of intense dark pigment will persist long after the mottling has disappeared.[6] Young lungfish are capable of rapid colour change in response to light, but this ability is gradually lost as the pigment becomes denser.[9]

The lungfish is reputed to be sluggish and inactive, but it is capable of rapid escape movements with the use of its strong tail.[12] It is usually quiet and unresponsive by day, becoming more active in the late afternoon and evening.[6]

Breathing[edit]

A Queensland lungfish in the Frankfurt Zoological Garden

A distinctive characteristic of the Queensland lungfish is the presence of a single dorsal lung, used to supplement the oxygen supply through the gills.[2] During times of excessive activity, drought, or high temperatures (when water becomes deoxygenated), or when prevailing conditions inhibit normal functioning of the gills, the lungfish can rise to the surface and swallow air into its lung.[4] More frequent air breathing is correlated with periods of greater activity at night when it uses the lung as a supplementary organ of respiration.[13]

Unlike the South American and African lungfishes, the Australian species has gills on all the first four gill arches, while the fifth arch bears a hemibranch. It is also the only facultative air breather lungfish species, only breathing air when oxygen in the water is not sufficient to meet their needs. The lung is a single long sac situated above and extending the length of the body cavity, and is formed by a ventral outgrowth of the gut. Internally, the lung is divided into two distinct lobes that interconnect along its length, compartmentalized by the infolding of the walls.[14] Each compartment is further divided to form a spongy alveolar region. Blood capillaries run through this region close enough to the air space in the lung to enable gas exchange. Lungfish breathe in using a buccal force-pump similar to that of amphibians. The contraction of smooth muscles in the walls of the lung results in exhalation.[15]

The sound of the lungfish exhaling air at the surface prior to inhaling a fresh breath has been compared to that made by a small bellows.[2] Young lungfish come to the surface to breathe air when they are about 25 mm long.[6]

Reproduction and development[edit]

The Queensland lungfish spawns and completes its entire lifecycle in freshwater systems.[6] The age of first breeding is estimated to be 17 years for males and 22 years for females. Males typically become mature at 738–790 mm and females at 814–854 mm.[8] After an elaborate courtship, the lungfish spawn in pairs, depositing large adhesive eggs amongst aquatic plants.[2] They spawn from August until November, before the spring rains, in flowing streams that are at least a metre deep.[1]

Eggs are most abundant during September and October. The stimulus for spawning is believed to be day length. The lungfish is known to spawn both during the day and at night.[16] The lungfish is selective in its choice of spawning sites. Eggs have been recorded on aquatic plants rooted in gravel and sand, slow- and fast-moving waters, in shade and in full sun, but never on aquatic plants covered with slimy algae, in stagnant water, or where loose debris was on the water’s surface.[9]

Opposite of its South American and African relatives, the Australian lungfish does not make a nest or guard or care for its eggs.[16] When spawning does take place, the pair of fish will lie on their sides or become entwined. They usually deposit their eggs singly, occasionally in pairs, but very rarely in clusters. The male lungfish fertilizes each egg as it emerges, and the eggs are deposited in dense aquatic vegetation. The newly laid egg is hemispherical, delicate, heavily yolked, and enclosed in a single vitelline and triple jelly envelope.[9] The egg about 3 mm in diameter; with the jelly envelope, it has a total diameter of about 1 cm (0.39 in).[11] The egg is sticky for a short while until silt and small aquatic organisms have covered it, but long enough for it to become attached to submerged vegetation. It is negatively buoyant and if it falls to the lake or river bed, it is unlikely to survive to hatching.[9]

The female has a large ovary and the potential to lay many eggs, but in the wild only produces a few hundreds of eggs, at most, during her lifetime. In captivity, 200 to 600 eggs have been laid in a single event. The lungfish does not necessarily spawn every year. A good spawning season occurs usually once every five years, regardless of environmental conditions.[6]

The eggs and young are similar to those of frogs,[4] but the offspring differ from both frogs and other lungfishes by the absence of external gills during early development. Within the egg, head structures and pigmentation start to appear by day 17. They hatch after three to four weeks and resemble tadpoles.[2] The young fish are slow-growing, reportedly reaching 27 mm (1.1 in) after 110 days, and about 60 mm (2.4 in)after 8 months.[17] During the first week, it lies on its side, hiding in the weeds, and moving only when stimulated by touch. It will swim spontaneously, and often retreat back into the gelatinous envelope when disturbed. Newly hatched larvae develop a ciliary current over their skin and gill surfaces.[16] This is believed to either provide respiratory exchange across the skin and gills without necessitating any movements of the jaw or brachial apparatus, or to keep the skin of the unprotected larvae free of debris, parasites, and predatory protozoans.[18] Larvae are reported not to feed for two to three weeks while the yolk is still present. By the time the yolk is fully used, a spiral valve has developed in the intestine and the fish starts to feed. The young can grow about 2 inches per month under optimal conditions.

The Queensland lungfish has very complex courtship behavior made up of three distinct phases. The first is the searching phase, when the fish will range over a large area, possibly searching for potential spawning sites.[19] A pair of fish will perform circling movements at the surface of the water close to beds of aquatic plants. They breathe air more frequently and more noisily than normal, possibly reflecting a greater physiological requirement for oxygen. Individual fish have been observed to breathe air at regular intervals of about 20 minutes, with air breathing accompanied by a distinct loud burp made in the air. The noisy breathing may be a form of a mating call. The lungfish seem to do their noisy breathing in concert, even responding to each other, but never in close vicinity of where the eggs are laid.[16]

The next phase involves behavior, similar to “follow-the-leader”, during which one fish, the male, shows interest in the female and nudges her with his snout. Up to eight individuals may be involved in follow-the-leader behavior. The male lungfish may occasionally take a piece of aquatic plant into its mouth and wave it around.[6] In the third phase, the fish dive together through aquatic vegetation, the male following the female and presumably shedding milt over the eggs.[19]

Adults have a high survival rate and are long-lived (at least 20–25 years). A Queensland lungfish at the Shedd Aquarium in Chicago, named "Granddad", has been there since 1933 and is at least 80 years old.

The Queensland lungfish has an unusually large karyotype, very large chromosomes and cells, and a high nuclear DNA content relative to other vertebrates, but less than what is reported for other lungfishes. In spite of this, it displays low genetic diversity between populations from the Mary, Burnett, and Brisbane catchments.[6] This low level of genetic variation could be attributed to population “bottlenecks” associated with periods of range contraction, probably during the Pleistocene, and in recent times during the periods of episodic or prolonged drought that are known to reduce some reaches of these river systems.[3]

Diet and feeding habits[edit]

The Queensland lungfish is primarily nocturnal, and is essentially carnivorous. In captivity, it will feed on frogs, earthworms, pieces of meat, and pelleted food.[1] In the wild, its prey includes frogs, tadpoles, fishes, a variety of invertebrates, and plant material.[2] No quantitative dietary data are available, but anecdotal observations clearly indicate the diet of the lungfish changes with development. This is proven to be correlated with a change in dentition.

Lungfish larvae are bottom feeders. They eat microcrustaceans and small Tubifex worms, occasionally supplementing their diets with filamentous algae. Soft foods such as worms and plants are partially crushed with a few quick bites and then swallowed. In the adult lungfish, movement of the prey in and out of the mouth is accompanied by strong adduction of the jaws. This crushing mechanism is coupled with hydraulic transport of the food, achieved by movements of the hyoid apparatus, to position the prey within the oral cavity.[20] The Queensland lungfish exhibits the most primitive version of these biomechanical feeding adaptations and behaviors.

Conservation status[edit]

Although the status of the Queensland lungfish is secure, it is a protected species under the Queensland Fish and Oyster Act of 1914 and capture in the wild is strictly prohibited.[2] It was placed on the CITES list in 1977. The lungfish is currently protected from fishing, and collection for education or research purposes requires a permit in Queensland, under the Fisheries Act of 1994, and from the Commonwealth Government. It is included on the list of “vulnerable” species, as studies have failed to show it meets the criteria needed to be considered a threatened or endangered species.[6]

Human activities currently threaten the Queensland lungfish, particularly water development. It is potentially at risk in much of its core distribution in the Burnett and Mary Rivers, as 26% of these river systems are presently impounded by weirs and dams. Barriers to movement and altered flow regimens downstream of dams for irrigation purposes could lead to the disruption of existing population structure and cause even more loss of genetic variation.[3]

Queensland lungfish can be very fast-growing, yet with a delayed first breeding age. For a long-lived species with naturally low mortality rates, successful spawning and juvenile recruitment is not essential every year and may only occur irregularly in medium to long cycles, even in natural environments.[21] The length of these cycles could easily mask the potentially deleterious impacts on recruitment for many years. Additionally, large adults could remain common for decades and give no indication of a declining population in the longer term.[6]

The Mozambique mouth brooder, or tilapia, has been declared a noxious and threatening alien species to the lungfish in Queensland.

Recent events[edit]

Proposed 2006 damming projects on both the Mary and Burnett rivers[22] threaten the habitat of the remaining lungfish. The dams would change the flow of the rivers, eliminating the slow, shallow areas the fish need for spawning. Scientists worldwide have become involved in saving the habitat for these lungfish, citing their evolutionary importance.[23]

References[edit]

  1. ^ a b c d e Lake, John S. Australian Freshwater Fishes. Nelson Field Guides. Melbourne: Thomas Nelson Australia Pty. Ltd., 1978. p. 12. 
  2. ^ a b c d e f g h i j k l m n o p Allen, G.R., S.H. Midgley, M. Allen. Field Guide to the Freshwater Fishes of Australia. Eds. Jan Knight/Wendy Bulgin. Perth, W.A.: Western Australia Museum, 2002. pp. 54–55. 
  3. ^ a b c Frentiu, F.D., J.R. Ovenden, and R. Street. "Australian lungfish (Neoceratodus forsteri: Dipnoi) have low genetic variation at allozyme and mitochondrial DNA loci: a conservation alert?". Conservation Genetics. 2. (2001): 63–67. 
  4. ^ a b c d e f g Whitley, G.P. Ed. Jack Pollard, ed. G.P. Whitley’s Handbook of Australian Fishes. Victoria: Wilke and Company Ltd., 1960. p. 334. 
  5. ^ Kemp, A. "Threatened Fishes of the World: Neoceratodus forsteri (Krefft, 1870) (Neoceratodontidae)". Environmental Biology of Fishes. 43. (1995): 310. 
  6. ^ a b c d e f g h i j k l m Pusey, Brad, Mark Kennard, and Angela Arthington. Freshwater Fishes of North-eastern Australia. Nathan, QLD: CSIRO Publishing, 2004. pp. 49–59. 
  7. ^ Joss, J. "Australian Lungfish, Neoceratodus forsteri". Fishes of Sahul. 16. (2002): 836–844. 
  8. ^ a b Brooks, S.G. and P.K. Kind. "Ecology and demography of the Queensland lungfish (Neoceratodus forsteri) in the Burnett River, Queensland with reference to the impacts of Walla Weir and future water infrastructure development". Queensland Department of Primary Industries, Brisbane, Report No. QO02004 (2002). 
  9. ^ a b c d e Kemp, A. "The biology of the Australian lungfish, Neoceratodus forsteri (Krefft 1870)". Journal of Morphology. 1. (1986): 181–198. 
  10. ^ a b Krefft, G. "Description of a gigantic amphibian allied to the genus Lepidosiren from the Wide-Bay district, Queensland". Proceedings of the Zoological Society. 16. (1870): 221–224. 
  11. ^ a b Kemp, A. "The embryological development of the Queensland lungfish, Neoceratodus forsteri (Krefft)". Memoirs of the Queensland Museum. 20. (1982): 553–597. 
  12. ^ Kemp, A. "A relic from the past – The Australian lungfish". Wildlife Australia. (Autumn) (1990): 10–11. 
  13. ^ Grigg, G.C. "Studies on the Queensland lungfish, Neoceratodus forsteri (Krefft) III. Aerial respiration in relation to habits". Australian Journal of Zoology. 13. (1965): 413–421. 
  14. ^ Freshwater Fish Distribution
  15. ^ Grigg, G.C. "Studies on the Queensland lungfish, Neoceratodus forsteri (Krefft)". Australian Journal of Zoology. 13. (1965): 243–253. 
  16. ^ a b c d Kemp, A. "Spawning of the Australian lungfish, Neoceratodus forsteri (Krefft) in the Brisbane River and in Enoggera Reservoir, Queensland". Memoirs of the Queensland Museum. 21. (1984): 391–399. 
  17. ^ Merrick, J.R.; Schmida, G.E. (1984). Australian Freshwater Fishes Biology and Management. Sydney: Griffin Press. pp. 46–51. ISBN 0-9591908-0-5. 
  18. ^ Whiting, H.P. and Q. Bone. "Ciliary cells in the epidermis of the larval Australian dipnoan, Neoceratodus". Zoological Journal of the Linnean Society. 68. (1980): 125–137. 
  19. ^ a b Grigg, G.C. "Spawning behaviour in the Queensland lungfish, Neoceratodus forsteri". Australian Natural History. 15. (1965): 75. 
  20. ^ Bemis, W.E. and G.V. Lauder (1986). "Morphology and function of the feeding apparatus of the Lungfish, Lepidosiren paradoxa (Dipnoi)". Journal of Morphology. 187. (1986) (1): 81–108. doi:10.1002/jmor.1051870108. PMID 3950967. 
  21. ^ Johnson, J.W. "Review of draft lungfish scientific report 4 July 2001". Unpublished report. 2001. 
  22. ^ Ministerial Media Statements
  23. ^ http://www.theaustralian.news.com.au/story/0,20867,19859367-30417,00.html.  Missing or empty |title= (help)[dead link]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!