Overview

Distribution

Belgian Exclusive Economic Zone, Bulgarian Exclusive Economic Zone, Delta area, European waters (ERMS scope), Georgian Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, Mediterranean Sea, North Sea, Oostende, Romanian Exclusive economic Zone, Russian part of the Black Sea, Turkish Exclusive Economic Zone, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wadden Sea, Westerschelde, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Temperate and sub-Arctic North Atlantic Ocean. Range extends south of the English channel to the Alboran Sea in the Mediterranean.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

As differences between species are very subtle, for general morphological description, see genus diagnosis.

Female:
Cephalothorax stocky in lateral view, cephalosome strongly tapered anteriorly, barely protruding anteriad of the rostrum. Posteroventral margins of the first 2 thoracic segments without or with very short spiniform processes. Posteroventral margin of the 3rd thoracic segment is convex and smoothly rounded. The mediodorsal surface of one or more abdominal segments 1-3 with a short sensillum and integumental pore. Seminal receptacle small. The ratio of the lengths of the 1st and 2nd basipodites of P4 is less than 1.5.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Female: 0,91-1,77 mm
Male: 0,91-1,37 mm

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphological differentiation between species of Pseudocalanus is very ambiguous, identification bordering impossible in juvenile stages. Adult P. elongatus can be distinguished from other species of the genus by the anteriorly tapered cephalosome.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3184 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1882 samples.

Environmental ranges
  Depth range (m): 0 - 620
  Temperature range (°C): -1.848 - 17.325
  Nitrate (umol/L): 0.016 - 17.777
  Salinity (PPS): 17.095 - 38.164
  Oxygen (ml/l): 0.130 - 9.192
  Phosphate (umol/l): 0.049 - 1.850
  Silicate (umol/l): 0.733 - 136.705

Graphical representation

Depth range (m): 0 - 620

Temperature range (°C): -1.848 - 17.325

Nitrate (umol/L): 0.016 - 17.777

Salinity (PPS): 17.095 - 38.164

Oxygen (ml/l): 0.130 - 9.192

Phosphate (umol/l): 0.049 - 1.850

Silicate (umol/l): 0.733 - 136.705
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Oceanic, epi-bathypelagic

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg diameter average 125 um.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocalanus elongatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAATAGCTGGGGCATGGGCAGGAATAATTGGTACAGGGTTGAGAATGATTATTCGAATAGAGCTAGGTCAGGCCGGGTCCTTAATCGGGGAT---GACCAGATTTATAATGTTGTTGTCACAGCACACGCTTTTATCATAATTTTTTTTATAGTTATACCAATTTTAATTGGAGGGTTTGGTAATTGGTTAGTCCCTCTTATATTAGGGGCAGCAGATATAGCTTTCCCACGTATAAATAACATGAGTTTTTGATTTTTAATACCTGCCCTAATTATACTTCTCTCAAGTTCTCTAGTTGAAAGAGGCGCAGGCACAGGGTGGACTGTTTACCCTCCGTTATCGAGGAATATCGCACACGCAGGAGGGTCTGTAGACTTTGCTATTTTCTCTCTTCATTTAGCGGGGGTAAGATCTATCTTAGGTGCGGTAAATTTTATTAGTACTTTAGGTAATTTACGAGTATTTGGCATACTTTTAGATCAGATACCATTATTTGCGTGGTCTGTATTAGTAACGGCTATTCTTTTACTACTGTCCTTACCCGTCTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTTTATGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocalanus elongatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!