Overview

Comprehensive Description

Biology

Occurs primarily in brackish mangrove estuaries, but also penetrates rivers and small streams (Ref. 4833, 44894). Reported to occur near overhanging vegetation on reefs (Ref. 9710, 48636). Usually in small aggregations (Ref. 48635). Feeds at the surface during daytime on floating debris which includes insects and vegetable matter. It is renowned for its ability to 'shoot down' insect prey by expelling beads of water from its mouth with considerable force and for its remarkable ability to compensate for visual refraction when aiming its shoots; shooting range is about 150 cm (Ref. 2847, 55339). Sold fresh in markets.
  • Allen, G.R. 1991 Field guide to the freshwater fishes of New Guinea. Publication, no. 9. 268 p. Christensen Research Institute, Madang, Papua New Guinea. (Ref. 2847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found from India to northern Australia, New Guinea, Solomon Islands and Vanuatu.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia and Oceania: India eastward to the Philippines, and south to Indonesia, Vanuatu, Solomon Islands, Papua New Guinea, and northern Australia.
  • Allen, G.R. 1991 Field guide to the freshwater fishes of New Guinea. Publication, no. 9. 268 p. Christensen Research Institute, Madang, Papua New Guinea. (Ref. 2847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Toxotes jaculatrix can be found in India, New Guinea, Australia, the Phillipines, Southeast Asia, and Oceania. (ISIS, 2000; Virtual Science Centre Project, 1996)

Biogeographic Regions: oriental (Native ); australian (Native ); indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 4; Dorsal soft rays (total): 11 - 13; Analspines: 3; Analsoft rays: 15 - 17
  • Allen, G.R. 1991 Field guide to the freshwater fishes of New Guinea. Publication, no. 9. 268 p. Christensen Research Institute, Madang, Papua New Guinea. (Ref. 2847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

T. jaculatrix is approximately 25 cm in length on average and has variable coloring, but is almost always silver-bodied with black vertical stripes or has a yellow hue with black stripes. (Tropical Tank 2000; Nelson 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 4833))
  • Talwar, P.K. and A.G. Jhingran 1991 Inland fishes of India and adjacent countries. Volume 2. A.A. Balkema, Rotterdam. (Ref. 4833)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Body silver or white, dorsal vertical stripes broad black four, or patches; head band black or grey at preopercle level. Body depth 2.1-2.4 in SL. Dorsal 3rd spine 1.7-1.9 in HL, longest. Scale horizontal rows 3-4 above LL, 8-9 below LL.
  • Allen, G.R. 1991 Field guide to the freshwater fishes of New Guinea. Publication, no. 9. 268 p. Christensen Research Institute, Madang, Papua New Guinea. (Ref. 2847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs primarily in murky, brackish water in the vicinity of mangroves, but also penetrates rivers and small streams (Allen et al. 2002). In Palau it can be seen in relatively clear water. It is also associated with reefs and usually occurs in small aggregations.

Both juveniles and adults feed on a variety of insects, spiders and vegetable matter, which are 'shot' down or taken as they float on the surface: the individual expels beads of water from its mouth with considerable force in order to shoot down its food (Allen 1991). The stomach of a 20 cm TL specimen collected at Madang, New Guinea was packed full of flower buds and contained several small insects (Allen 1978).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; amphidromous (Ref. 51243); freshwater; brackish
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

T. jaculatrix is found almost exclusively in mangrove swamps, but can also be found to varying degrees in prawn ponds and river mouths (Tropical Tank, 2000; FreshAquariam, 2000). T. jaculatrix can survive in a wide range of water habitats, from fresh water to salt water, and in temperatures ranging from 25 to 30 degrees C (Tropical Tank, 2000). In almost all instances T. jaculatrix is found at or near the top depths of its aquatic environment, thus facilitating its predatory habits. (Neale, no date)

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.61 - 2.135
  Temperature range (°C): 28.954 - 28.954
  Nitrate (umol/L): 0.099 - 0.099
  Salinity (PPS): 34.131 - 34.131
  Oxygen (ml/l): 4.525 - 4.525
  Phosphate (umol/l): 0.113 - 0.113
  Silicate (umol/l): 1.579 - 1.579

Graphical representation

Depth range (m): 0.61 - 2.135
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds at the surface during daytime on floating debris which includes insects and vegetable matter. It is renowned for its ability to 'shoot down' insect prey by expelling beads of water from its mouth with considerable force and for its remarkable ability to compensate for visual refraction when aiming its shoots; shooting range is about 150 cm.
  • Allen, G.R. 1991 Field guide to the freshwater fishes of New Guinea. Publication, no. 9. 268 p. Christensen Research Institute, Madang, Papua New Guinea. (Ref. 2847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

T. jaculatrix feeds mainly on terrestrial insects by spitting water at them, thus knocking them out of the air and into the water. For this reason, T. jaculatrix is called the "Archerfish". T. jaculatrix can shoot its prey from as far as 125cm away. The Archerfish is also known to eat worms, shrimp, and other small animals. (Virtual Science Centre, 2000; Tropical Tank, 2000; About, 2000; Nelson, 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Skin Fungi (Saprolegnia sp.). Fungal diseases
  • Bassleer, G. 2003 The new ilustrated guide to fish diseases in ornamental tropical and pond fish. Bassleer Biofish, Stationstraat 130, 2235 Westmeerbeek, Belgium, 1st Edition, 232p. (Ref. 48502)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproductive habits of T. jaculatrix have not been formally studied at this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Capturing prey above the water's surface: archer fish
 

The mouth of the archer fish assists the capture of prey by squirting directed jets of water to shoot down insects above the water's surface.

     
  "Further animal artefacts that resemble tools include the woodpecker's anvil, a tree stump with a suitable wedgelike cavity to hold cones, the use of a water jet to shoot down prey by the archer fish (Trichogaster jaculatrix), and the Australian bolas spider (Mastophora) swings at its prey." (Pallasmaa 1995:24)

Watch video
  Learn more about this functional adaptation.
  • Pallasmaa, J. 1995. Animal architecture. Helsinki: Museum of Finnish Architecture. 126 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Toxotes jaculatrix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCTTTATCTAGTATTCGGTGCTTGAGCTGGGATAGTAGGCACGGCATTAAGCCTCCTTATTCGAGCAGAACTTAGCCAACCTGGTGCTCTTCTGGGAGACGACCAGATTTACAATGTAATTGTTACGGCCCACGCCTTTGTAATAATTTTCTTCATAGTCATGCCCATTATAATTGGAGGCTTTGGGAACTGACTCATCCCCCTAATGATTGGTGCCCCTGATATGGCATTCCCCCGAATGAACAACATAAGCTTCTGGCTCCTACCACCCTCCTTCCTGCTGCTTCTTGCCTCATCTGGTGTCGAAGCAGGCGCCGGTACTGGCTGAACAGTCTATCCTCCTCTAGCCGGTAATCTGGCCCATGCAGGAGCATCTGTCGATCTAACCATCTTCTCACTTCACCTGGCCGGGGTCTCCTCAATTCTCGGTGCAATCAACTTCATTACAACCATCATCAACATAAAACCAACGGTTGTCACTATATACCAAATTCCCCTATTTGTTTGAGCCGTCCTCATTACAGCCGTCCTTCTCCTCCTTTCACTACCCGTCCTAGCTGCTGGCATCACTATGCTCCTTACAGATCGAAACTTAAACACTGCCTTCTTCGACCCAGCAGGAGGAGGAGACCCCATTCTTTACCAACACCTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Toxotes jaculatrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Hoese, D.

Reviewer/s
Larson, H. & Pippard, H.

Contributor/s

Justification
This is a widespread and reasonably common species, with no known major threats. It is listed as Least Concern. However, further research is recommended into its population size and trends, and potential threats from any harvesting efforts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on this species is sparse but because it is a very popular aquarium fish one could assume it is not endangered. The Virtual Science Centre Project says that the Archerfish "is fairly common" but that the destruction of mangrove swamps could cause a great decline in its numbers. (Virtual Science Project, 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no available population information for this species. It is often found in small aggregations (Kuiter and Tonozuka 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species. It is sometimes found in trade as a food fish, but the impacts of collection are not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in some protected areas throughout its range. Further research is required on population size and trends, ecology, potential threats and any effects of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial
  • Mills, D. and G. Vevers 1989 The Tetra encyclopedia of freshwater tropical aquarium fishes. Tetra Press, New Jersey. 208 p. (Ref. 7020)
  • Talwar, P.K. and A.G. Jhingran 1991 Inland fishes of India and adjacent countries. Volume 2. A.A. Balkema, Rotterdam. (Ref. 4833)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

T. jaculatrix is widely sought after as an aquarium fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Banded archerfish

The banded archerfish (Toxotes jaculatrix) is a brackish water perciform fish of the archerfish genus Toxotes. It is silvery in colour and has a dorsal fin towards the posterior end. It has distinctive, semi-triangular markings along its sides.[3] It is best known for its ability to spit a jet of water to "shoot down" prey.[4][5] Larger specimens may be able to hit prey 2 to 3 metres (6 ft 7 in to 9 ft 10 in) away.[5] The banded archerfish may reach the displaced prey within 50 milliseconds of its hitting the water.[6]

The name (binomial as well as common) refers to Sagittarius the archer, because of the unusual method banded archerfish use to capture prey. Banded archerfish are found in Indo-Pacific and Oceanian waters, generally in river mouths and mangrove estuaries. They move between fresh, salt, and brackish water over the course of their lifetime, though not to breed. Because of their markings and silvery colour, banded archerfish are sometimes kept as aquarium fish, though they are difficult to care for and not recommended for most home aquaria.[4]

Taxonomy and etymology[edit]

Toxotes jaculatrix were originally described by Peter Simon Pallas in 1767. Since then, several synonyms (such as Labrus jaculatrix and Sciaena jaculatrix) and misspellings (Toxotes jaculator) have come into use.[2][4]

Toxotes is Greek for "bowman" or "archer", and specifically refers to Sagittarius.[7] The species name jaculatrix is related to the English jaculate and means "thrower" or "caster" (of a dart or arrow). Both the common name and binomial name refer to the banded archerfish's habit of catching prey by shooting "arrows" of water through its mouth.[8]

Description[edit]

Banded archerfish have four dorsal spines, 11 to 13 dorsal soft rays, three anal spines (of which the third is longest)[3] and 15 to 17 anal soft rays.[4] The first spine is always the shortest; the rays become shorter toward the posterior end.[3] There are about 23 scales between the first dorsal spine and the posterior nostrils.[3] Certain areas of the body are tinged green. The back of the fish is olive-green or brown.[3] The dorsal fin is yellowish-green and located towards the posterior end, and its base is shorter than that of the anal fin.[3] The caudal fin is "dirty green" and about the same height until the point of attachment, where it becomes shallower.[3] The anal fin is silver.[9]

The body of the banded archerfish is oblong in shape and raised on the posterior side. The body is generally silver-white in colour, though varying colourations, such as yellow, have been observed.[3] Four to six broad black bars may be present on the dorsal side.[5][9] The first bar is found anterior to the operculum, the bony plate covering the gills, and the second is found behind the operculum. The third bar is found below the origin of the dorsal fin, the fourth bar below the soft dorsal, and the fifth (if any) on the area between the anal fin and caudal fin (caudal peduncle).[3] These bars become shorter as the fish ages. The lateral line curves upwards at the area between the fourth and ninth lateral scales.[3] Banded archerfish can reach a maximum length of 30 centimetres (12 in); however, average length is about 20 centimetres (7.9 in).[4]

Banded archerfish have large eyes, which, unlike many other fishes, are positioned for binocular vision.[9] The head is slightly shorter than the body, with a distinctively pointed snout. Juveniles may be yellow-green to brown on the dorsal side and silvery on the ventral side. The juveniles' flanks are grey-green.[9] Some banded archerfish have irregular yellow patches between their bands.[10]

The possibility of sexual dimorphism in banded archerfish has not been investigated.[11]

Comparison to other archerfish[edit]

The banded archerfish and its relative the largescale archerfish (Toxotes chatareus) are sometimes grouped and sold together under the label "archerfish".[12] However, the banded archerfish has four dorsal spines whereas largescale archerfish has five. The banded archerfish usually has four to five wedge-shaped bands, but largescale archerfish has six or seven spots and shorter bands in a regular, alternating pattern.[12] Unlike the silvery banded archerfish, the largescale is sooty in colour. The banded archerfish may also be confused with the smallscale archerfish, Toxotes microlepis. These are more difficult to distinguish, but the most striking difference is in the last two bands. While both species have four or five wedge-shaped bands, those of the banded archerfish extend to the dorsal fin, whereas those of the smallscale archerfish do not; there are two spots on the dorsal fin separate from the main bar.[12]

Behaviour[edit]

Diet and feeding[edit]

Banded archerfish are omnivorous. In the daytime, they come to the surface to feed on floating matter. Their diet comprises plant matter and insects, which they are able to "shoot down".[4] Banded archerfish are also able to capture prey by jumping out of the water and seizing it from low overhanging branches. Young archerfish form small schools while learning aim, increasing the chance that at least one shot will hit the target. Their diet also comprises underwater prey, including crustaceans and small fishes.[13]

Shooting[edit]

The toxotes throwing water at insects.

Banded archerfish have mouths adapted to spit jets of water over distance, usually to knock prey into the water. The banded archerfish shoots the jet of water by raising its tongue against the roof of its mouth, forming a tube. The opercula then close quickly, pressurizing water along the tube.[5] Most archerfish are able to spit at a range of 150 centimetres (59 in),[4] though some larger specimens may be capable of ranges of up to 2 to 3 metres (6 ft 7 in to 9 ft 10 in).[5] When a prey is shot down, the banded archerfish begins to move towards the place where it will land within 100 milliseconds and can reach it within 50 ms of its hitting the water.[6]

A study found that banded archerfish could be trained to hit moving targets at an accuracy rate of greater than 50%.[14] According to this study, the ability to hit moving targets is a complex learned behaviour, and can be learnt from other members of the school. The study concluded that fish could shoot more accurately after observing other members of the school shooting.[14]

The banded archerfish is able to hit targets with a high degree of accuracy, despite refraction of light in the water. It is believed that they are able to achieve this level of accuracy by positioning their bodies to shoot from directly under the intended target.[9] However, other studies have found that banded archerfish are able to achieve great accuracy even at angles, suggesting that they are somehow able to compensate for refraction.[14][15] This may also suggest that banded archerfish are capable of three-dimensional tasks.[15]

Breeding[edit]

The breeding habits of the banded archerfish are not well known. Banded archerfish first begin to breed when they are about 10 centimetres (3.9 in) long.[9] The banded archerfish reproduces by spawning. There are reports that banded archerfish go to saltwater reefs to spawn, but these have not been confirmed.[16] Archerfish lay 20,000 to 150,000 eggs at a time.[13] Banded archerfish rarely breed in captivity.[10]

Distribution and habitat[edit]

The banded archerfish inhabits the Indo-Pacific and waters off northern Australia, and less frequently those on the southern coast of Australia.[11] It can be found from India eastwards to the Philippine Islands, southwards to Australia, as well as in waters off the Solomon Islands and the Indonesian Archipelago.[4] It has been observed as far east as the New Hebrides (now known as Vanuatu).[17] The banded archerfish occurs mainly in areas of brackish water. Mangrove estuaries are its primary habitat, though it occasionally moves upstream into freshwater rivers. It is associated with reefs and has been reported to occur near overhanging vegetation.[4] While they may move between fresh and salt water during their life cycle, they do not do so to breed.[18]

Relationship with humans[edit]

Banded archerfish are fairly common in the Indo-Pacific and are not currently endangered.[1] They have a minor commercial role in fisheries and may be sold fresh in markets or collected for the aquarium trade.[4] Banded archerfish are threatened by the destruction of their mangrove swamp habitat[19] and by pollution.[13]

In aquaria[edit]

Species in the genus Toxotes, including the banded archerfish, are kept as aquarium fish.[4] In aquaria, the banded archerfish can grow up to 25 centimetres (9.8 in) long.[10] They swim at the top level of the aquarium. Banded archerfish can be kept in small groups of three to five;[16] fish of the same size get along but fish that are larger may be aggressive towards those that are smaller,[11] and even try to eat them.[16] They may live from five to eight years in captivity, and occasionally nine or ten. Banded archerfish need warm water, usually between 25 and 30 °C (77 and 86 °F).[11] The aquarium should be large with middling amounts of plant growth and plenty of space for swimming. It should be 20 to 30 centimetres (7.9 to 11.8 in) deep.[11]

Banded archerfish are generally not recommended for average home aquaria despite their attractive appearance because they are difficult to care for and require special conditions.[16] Banded archerfish prefer to shoot and capture live food rather than be fed flake food, making it problematic to feed them.[11] They need brackish water as well as a tall canopy. In the wild they are able to jump out of the water to capture prey on overhanging branches; a tall canopy is required to prevent their jumping out of the aquarium.[16] Banded archerfish should be kept in an aquarium with a volume of at least 45 to 55 US gallons (170 to 210 l; 37 to 46 imp gal), though a greater volume is preferred.[10] Because of such difficulties in caring for banded archerfish, the species has not yet been successful in captivity.[11]

See also[edit]

References[edit]

  1. ^ a b Hoese, D. (2012). "Toxotes jaculatrix". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 25 October 2012. 
  2. ^ a b "Toxotes jaculatrix". Integrated Taxonomic Information System. Retrieved 18 February 2010. 
  3. ^ a b c d e f g h i j Weber, Max Carl Wilhelm; Lieven Ferdinand de Beaufort (1936). The Fishes of the Indo-australian Archipelago VII. The Fishes of the Indo-australian Archipelago. Volume 7. Leiden: E. J. Brill Ltd. pp. 200–201. 
  4. ^ a b c d e f g h i j k Froese, Rainer and Pauly, Daniel, eds. (2010). "Toxotes jaculatrix" in FishBase. January 2010 version.
  5. ^ a b c d e McGrouther, Mark (15 May 2009). "Banded Archerfish, Toxotes jaculatrix (Pallas, 1767)". Australian Museum. Retrieved 11 February 2011. 
  6. ^ a b Walker, Matt (2007). Fish That Fake Orgasms: And Other Zoological Curiosities (illustrated ed.). Macmillan. p. 105. ISBN 0-312-37116-0. 
  7. ^ Trzaskoma, Stephen; R. Scott Smith; Stephen Brunet (2004). Anthology of classical myth: primary sources in translation. Hackett Publishing. p. 106. ISBN 978-0-87220-721-9. 
  8. ^ Jordan, David Starr (1905). A guide to the study of fishes 2. H. Holt and Company. p. 400. 
  9. ^ a b c d e f Burton, Maurice (1994). "Archerfish". International Wildlife Encyclopedia. Marshall Cavendish. 
  10. ^ a b c d Butler, Rhett A. (1995). "Archerfish". Mongabay.com. Retrieved 28 February 2010. 
  11. ^ a b c d e f g Baensch, Hans A.; Rudiger Riehl; Hans A. Smith; Eberhard Schulze; Bob Behme (1997). Aquarium Atlas 1 (6 ed.). Steven Simpson Books. p. 812. ISBN 1-890087-12-2. 
  12. ^ a b c Monks, Neale; Bruce Hansen. "Archerfish, family Toxotidae". Brackish Water Aquarium FAQ. Retrieved 1 March 2010. 
  13. ^ a b c "Archerfish". Monterey Bay Aquarium. Retrieved 1 March 2010. 
  14. ^ a b c Schuster, Stefan; Saskia Wo; Markus Griebsch; Ina Klostermeier (21 February 2006). "Animal Cognition: How Archer Fish Learn to Down Rapidly Moving Targets" (pdf). Current Biology (Elsevier Ltd) 16 (16): 378–383. doi:10.1016/j.cub.2005.12.037. ISSN 0960-9822. OCLC 45113007. PMID 16488871. Retrieved 19 February 2010. 
  15. ^ a b Rossel, Samuel; Julia Corlija and Stefan Schuster (2002). "Predicting three-dimensional target motion: how archer fish determine where to catch their dislodged prey". The Journal of Experimental Biology (Cambridge: The Company of Biologists Limited) 205 (Pt 21): 3321–3326. ISSN 1477-9145. OCLC 1754580. PMID 12324541. Retrieved 19 February 2010. 
  16. ^ a b c d e "Banded Archerfish". Microcosm Aquarium Explorer. Retrieved 19 February 2010. 
  17. ^ Scott, Thomas (1996). Concise encyclopedia biology. Walter de Gruyter. ISBN 3-11-010661-2. 
  18. ^ Nagelkerken, Ivan (2009). Ecological Connectivity Among Tropical Coastal Ecosystems. Springer Science+Business Media. p. 333. ISBN 90-481-2405-0. 
  19. ^ Ghaffar, Mazlan; Simon Kumar Das and Zaidi Che Cob (2008). "Comparison of Scale and Otolith Age Estimates for two Archer Fishes (Toxotes jaculatrix, Pallas, 1767 and Toxotes chatareus, Hamilton, 1822) from Malaysian Estuaries" (PDF). International Journal of Natural and Engineering Sciences 2 (3): 129–134. ISSN 1307-1149. Retrieved 1 March 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!