Overview

Distribution

Geographic Range

Daphnia pulex is the most common species of the water flea, an organism which can be found in almost every permanent, eutrophic (nutrient-rich) water body. A few species are marine, but generally Daphnia, including Daphnia pulex, are freshwater organisms.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Oostende, Schelde estuary, Ukrainian Exclusive Economic Zone, Westerschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Daphnia pulex is the most common species of the group of organisms known as water fleas. Their common name was given because of their general appearance and jerky swimming motions which resembles that of the land flea. They are, in reality, a type of small crustacean and are generally 0.2-3.0 mm long. Their bodies are not distinctly segmented, but an important feature of their anatomy is the carapace, a folded shell-like structure which covers the animal and opens both ventrally and posteriorly. Studying the anatomy of this organism is made easier by the fact that most of its outer covering is clear, showing most of the internal organs at work, including the heart. The head of the organism contains both a darkly colored compound eye and numerous antennae used for feeling and swimming. Many Daphnia, including D. pulex and D. magna have a specialized light-sensing organ similiar to a tiny eye called an ocellus. Located posteriorly at the junction of the head are small, hard to see mouthparts. They mainly consist of the mandibles which are in constant motion and used by the organism to crush and grind its food. In a live specimen food particles can be seen passing through the intestine which terminates at the anus located on the postabdomen. The postabdomen is the most posterior part of the body and terminates itself in two hooklike cuticular claws used by the organism to clear debris out of the carapace. The fine teeth located on these claws are often used for species identification. The central portion of the body is the thorax and contains four to six pairs of flattened legs covered in setae. Daphnia males are generally smaller than females but have longer antennules and a modified postabdomen. Daphnia females posses a brood chamber located between the body wall and dorsal surface of the carapace used to carry their eggs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Daphnia can be found in almost any permanent body of water, even in rain-filled tire ruts or several meters from the ground, growing in tree moss in a rainforest. They are mainly freshwater and the highest concentrations of Daphnia populations are found in the vegetation in most lakes and ponds. They are often the most abundant organism in a body of water. They live as plankton in the open water of lakes, or live either attached to vegetation or near the bottom of the body of water.

While very prolific in most freshwater bodies, Daphnia are too small and weak to live in a strong current, which they are unable to swim against. They live in a water column and are light enough to stay suspended by using their legs and antennae for movement. They live mainly in the upper portion of this water column near the algae-rich surface of the water, but they will often move up or down the column depending on seasons or predators in a process called diel vertical migration. They are often forced to expend a large amount of energy moving towards a lower depth during the day in order to avoid predators and coming towards the surface to eat at night. Their location is also controlled by seasonal variation in their phytoplankton food supply.

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Daphnia are oftened used to clear fish tanks of algae "bloom" because of their diet of bacteria, fine detritus, and very small algae particles. They are filter feeders meaning they do not usually actively seek food; they merely create a constant movement of water using their thoraic legs through their carapace where they are able to filter out any food particles with the setae and direct these towards the mouth. If a mass of food becomes entangled in the mandibles it is cleared by the spines located on the first legs and then kicked out of the carapace by the postabdomen. Not all algae is eaten by Daphnia, such as blue-green algae which has too tough of an outer cell wall and filamentous green algae which can be detrimental to the organism's health. While most species of Daphnia, including D. pulex, are herbivorous or detritivorous (feeding on phytoplankton), a few are carnivorous and prey on other water fleas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Daphnia pulex (Trophic species 12) is prey of:
Acilius
Chaoborus
Hydracarina
Odonata
Belostoma
Ranatra
Ambystoma maculatum
Ambystoma laterale
Ambystoma tremblayi
Notophthalmus viridescens
Umbra limi
Phoxinus eos
Phoxinus neogaeus
Chaoborus punctipennis
Micropterus salmoides

Based on studies in:
USA: Michigan (Lake or pond)
USA: Michigan, Tuesday Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • Jonsson et al. 2005. Food webs, body size, and species abundance in ecological community description. Advances in Ecological Research 36:1-78.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • Jonsson et al. 2005. Food webs, body size, and species abundance in ecological community description. Advances in Ecological Research 36:1-78.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Daphnia pulex reproduces both sexually and asexually in a process called parthenogenesis, where male gametes are unnecessary. Parthenogenesis occurs mainly in the summer, so that during summer an entire population of Daphnia pulex will consist almost completely of females. This process begins in the female, which then molt the carapace to increase their size and develope anywhere from two to twenty eggs in their brood chamber. Even without fertilization from a male, these eggs will develope into immature females which are released after the next molting stage. The young that are produced in this way are more precocial or well-developed than in the process of producing altricial fertilized eggs. This stage of reproduction is most used for a rapid increase in Daphnia growth but requires more favorable conditions.

The sexual stage of Daphnia reproduction occurs mainly in the winter during less favorable conditions caused by overcrowding, accumulation of wastes, lower food availability, and lower temperatures. First, some of the eggs that were produced by parthenogenesis hatch into males instead of females. These males then copulate with the females to form fertilized eggs which are then kept in the female's brood chamber. After the female's next molt she releases these eggs which have the ability to overwinter. They can resist freezing and drying while encased in a purselike ephippium that protects the egg as it rests in the sediment at the bottom of the water body until spring. These eggs remain in this stage of arrested developement, lasting up to twenty years, until the conditions become more favorable for hatching.

Daphnia usually live about ten to thirty days and can live up to one hundred days if their environment is free of predators. An individual will generally have ten to twenty instars, or periods of growth, during their lifetime.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; asexual ; fertilization (Internal ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Daphnia pulex sp. 2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Daphnia pulex

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBFCE0263-06|DQ340834|Daphnia pulex| CGACGTTGACTCTTCTCAACTAATCATAAGGACATTGGCACTCTCTATTTTATCTTTGGTATTTGATCAGGGATAGTAGGCACTGCTCTT---AGACTCTTAATTCGCGCCGAACTGGGGCAATCAGGAAGTTTAATCGGAGAC---GATCAGATTTATAATGTAATTGTTACCGCCCACGCGTTCGTAATAATTTTTTTTATAGTTATGCCCATCATAATTGGGGGGTTCGGGAACTGATTAGTCCCCCTTATA---CTAGGGGCCCCGGATATGGCCTTCCCTCGACTTAATAATTTAAGATTCTGATTTCTTCCTCCGGCACTTACACTACTTTTAGTTGGAGGGGCAGTAGAAAGAGGGGCTGGGACAGGGTGAACCGTGTACCCCCCACTCTCGGCTGGGATTGCTCATGCGGGGGCCTCTGTAGATCTAAGA---ATCTTCTCCCTCCATTTGGCGGGTATTTCTTCTATTCTTGGGGCTGTCAACTTTATTACTACTATTATCAATATACGATCGGCTGGGATATCATTAGACCGAATTCCTTTATTTGTGTGAGCAGTAGGCATTACTGCGCTACTTCTACTATTGAGCCTACCAGTCCTAGCAGGG---GCAATTACTATGCTTCTTACTGATCGTAACCTTAATACCTCCTTTTTTGACCCTGCAGGAGGGGGAGATCCGATCTTATACCAGCATTTGTTTTGGTTCTTTGGTCATCCTGAAGTATACATTTTAATTTTACCCGGGTTTGGTATAATTTCTCATATTATTAGCCACGAAAGAGGTAAAAAG---GAAGCATTCGGCACGCTTGGGATAATTTACGCTATACTAGCTATCGGGGTGTTAGGCTTCGTAGTATGGGCCCACCATATATTTACTGTGGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Daphnia pulex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Species: 53
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Daphnia are extremely widespread and common throughout the world. However, they are often used as a food source for aquarium fish and although some of these are raised specifically for this purpose, many are harvested from lakes or ponds. While this practice is unlikely to erradicate all Daphnia species, it could damage some rare populations with a limited range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In general, Daphnia are beneficial to an aquatic environment, but they will occasionally limit the population size of other organisms as they compete for food and oxygen. Although they are often used in fish tanks to clear the water of algal bloom, fish are not able to be kept in the same tank with a high number of Daphnia because of a limit on the oxygen availability.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Although Daphnia are not used by humans as a food source directly, they are involved in many of the foodchains necessary to sustain fish that we consume or use commercially such as sticklebacks, minnows and young Sockeye salmon. They also are a primary food supply for those animals that trout and many other popular fish depend on. Also, almost any freshwater ecosystem is dependent on Daphnia's ability to convert phytoplankton and decaying matter into a more usable form.

Daphnia are also very frequently used by scientists for experimentation. They are small, cheap, and very easy to keep alive in a laboratory environment. Their almost transparent shell makes their internal functions easier to study and they are very susceptible to changes in temperature, food supplies, or dissolved oxygen content in their environment. Aquarium owners often use Daphnia both as a food source for their fish and to clear the water of debris.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Daphnia pulex

Daphnia pulex is the most common species of water flea.[3] It has a cosmopolitan distribution: the species is found throughout the Americas, Europe and Australia.[4] It is a model species, and was the first crustacean to have its genome sequenced.

Contents

Description

Daphnia pulex is an arthropod whose body segments are difficult to distinguish. They can only be recognised by the appendages they bear (only ever one pair per segment), and by studying the internal anatomy.[5] The head is distinct and is made up of six segments which are fused together even as an embryo. It bears the mouthparts, and two pairs of antennae, the second of which are enlarged into powerful organs used for swimming.[5] There is no clear division between thorax and abdomen, which collectively bear five pairs of appendages.[5] The shell surrounding the animal extends posteriorly into a long or short spine.[6]

Ecology

Daphnia pulex occurs in a wide range of aquatic habitats, although it is most closely associated with small, shaded pools.[7] In oligotrophic lakes, D. pulex has little pigmentation, while it may become bright red in eutrophic waters, due to the production of haemoglobin.[7]

Predation

Daphnia are prey for a variety of both vertebrate and invertebrate predators. The role of predation on D. pulex population ecology extensively studied, and has been shown to be a major axis of variation in shaping population dynamics[8] and landscape-level distribution.[9] In addition to the direct population ecological effects of predation, the process contributes to phenotypic evolution in contrasting ways: larger D. pulex are more visible to vertebrate predators, but invertebrate predators are unable to handle larger D. pulex. As a result, larger D. pulex tend to be found with invertebrate predators while smaller size is associated with vertebrate predators.

Similar to some other Daphnia species, the morphology of D. pulex exhibits a plastic response to the presence of predators. Phantom midge larvae (Chaoborus) release kairomones – chemical cues – that induce the development of small jagged protrusions on the head, known as "neck-teeth".[10] Neck-teeth increase survivorship in the presence of the invertebrate predator, but there are costs – longer development time, for example – when those predators are not present.[11]

Ecological stoichiometry

Daphnia pulex ecology is shaped by nutrient availability and balance, which affects traits that mediate intra- and interspecific interactions. Because nutrients are required for an array of biological processes – for example, amino acid synthesis – the environmental availability of these nutrients regulates downstream organismal characteristics.[12] Low nutrient availability reduces both body size and growth rate, which, as noted above, regulates Daphnia relationships to predators. Daphnia pulex in particular has been an important model species for investigating ecological stoichiometry, demonstrating that pond shading by trees increases nutrient concentrations relative to carbon in algae, which increases D. pulex body size, and therefore competitive ability and susceptibility to predation by vertebrates.[13]

Genomics

Daphnia pulex was the first crustacean to have its genome sequenced.[14][15] Its genome contains 31,000 genes – 8,000 more than are present in the human genome – as a result of extensive gene duplication.[16]

Notes

  1. ^ Some sources quote an authority of "Leydig, 1860",[2] or "(De Geer, 1776)".

References

  1. ^ Gregorio Fernandez-Leborans & Maria Luisa Tato-Porto (2000). "A review of the species of protozoan epibionts on crustaceans. II. Suctorian ciliates". Crustaceana 73 (10): 1205–1237. doi:10.1163/156854000505209. JSTOR 20106394. 
  2. ^ "Daphnia pulex Leydig, 1860". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=83874. Retrieved August 27, 2010. 
  3. ^ Carrie Miller. "Daphnia pulex". Animal Diversity Web. University of Michigan. http://animaldiversity.ummz.umich.edu/site/accounts/information/Daphnia_pulex.html. 
  4. ^ "Daphnia pulex". An Image-Based Key To The Zooplankton Of The Northeast (USA). University of New Hampshire. http://cfb.unh.edu/CFBkey/html/Organisms/CCladocera/FDaphnidae/GDaphnia/Daphnia_pulex/daphniapulex.html. 
  5. ^ a b c Alexander Ivanovitch Petrunkevitch (1916). "Daphnia pulex". Morphology of Invertebrate Types. pp. 113–121. ISBN 978-0-554-71763-0. http://books.google.co.uk/books?id=w2hFvQik9VEC&pg=PA113. 
  6. ^ Clarence Luther Herrick (2009). "Section 6". A Final Report on the Crustacea of Minnesota. General Books LLC. pp. 21–66. ISBN 978-1-150-02333-0. http://books.google.co.uk/books?id=6lMD45YD94cC&pg=PA49. 
  7. ^ a b "Daphnia pulex". An Image-Based Key To The Zooplankton Of The Northeast (USA). Version 4.0. University of New Hampshire. http://cfb.unh.edu/cfbkey/html/organisms/ccladocera/fdaphnidae/gdaphnia/daphnia_pulex/daphniapulex.html. Retrieved May 12, 2011. 
  8. ^ Barbara Leoni & Letizia Garibaldi (2009). "Population dynamics of Chaoborus flavicans and Daphnia spp.: effects on a zooplankton community in a volcanic eutrophic lake with naturally high metal concentrations (L. Monticchio Grande, Southern Italy)" (PDF). Journal of Limnology 68 (1): 37–45. http://www.jlimnol.it/JL_68_1/04_leoni.pdf. 
  9. ^ J. H Pantel, T. E Juenger & M. A. Leibold (2011). "Environmental gradients structure Daphnia pulex × pulicaria clonal distribution". Journal of Evolutionary Biology 24 (4): 723–732. doi:10.1111/j.1420-9101.2010.02196.x. 
  10. ^ Winfried Lampert & Ulrich Sommer (2007). "Predation". Limnoecology: The Ecology of Lakes and Streams (2nd ed.). Oxford University Press. pp. 162–179. ISBN 978-0-19-921393-1. http://books.google.co.uk/books?id=zEcCX5k3hJAC&pg=PA176. 
  11. ^ R. Tollrian (1993). "Neckteeth formation in Daphnia pulex as an example of continuous phenotypic plasticity: morphological effects of Chaoborus kairomone concentration and their quantification". Journal of Plankton Research 15 (11): 1309–1318. doi:10.1093/plankt/15.11.1309. 
  12. ^ Robert Warner Sterner & James J. Elser (2002). Ecological Stoichiometry: the Biology of Elements from Molecules to the Biosphere. Princeton University Press. ISBN 978-0-691-07491-7. 
  13. ^ Spencer R. Hall, Mathew A. Leibold, David A. Lytle & Val H. Smith (2004). "Stoichiometry and planktonic grazer composition over gradients of light, nutrients, and predation risk". Ecology 85 (8): 2291–2301. doi:10.1890/03-0471. 
  14. ^ "Daphnia pulex v1.0". DOE Joint Genome Institute. http://genome.jgi-psf.org/Dappu1/Dappu1.home.html. Retrieved 2009-11-29. 
  15. ^ Florian Odronitz, Sebastian Becker & Martin Kollmar (2009). "Reconstructing the phylogeny of 21 completely sequenced arthropod species based on their motor proteins". BMC Genomics 10: 173. doi:10.1186/1471-2164-10-173. PMC 2674883. PMID 19383156. http://www.biomedcentral.com/1471-2164/10/173. 
  16. ^ John K. Colbourne, Michael E. Pfrender, Donald Gilbert et al. (2011). "The ecoresponsive genome of Daphnia pulex". Science 331 (6017): 555–561. Bibcode 2011Sci...331..555C. doi:10.1126/science.1197761. PMID 21292972. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!