Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

A deep-slope upper continental rise species, common in deep waters of most oceans (Ref. 1371). Bathypelagic (Ref. 58426). Feeds on a variety of benthic invertebrates (especially crustaceans and holothuroids) when young, switching to primarily mesopelagic and bathypelagic fish, and sea urchins and cephalopods as adults (Ref. 1371). Sex ratio was 2.6:1 male to female (n = 449) in the Rockall Tough, N.E. Atlantic (Ref. 40742).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Color: Generally brownish to reddish brown, fin membranes brownish, mouth and gill cavity blackish.
  • COHEN D.M. (1990) in QUÉRO J.-C., HUREAU J.-C., KARRER C., POST A. & L. SALDANHA (Eds.) Check-list of the Fishes of the Eastern Tropical Atlantic 2: 541-563

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic. Carnivorous, feeding on benthic animals (amphipods, isopods, cumaceans), also pelagic animals (mysids, euphausids and other crustaceans, echinoderms, cephalopods and fishes). Two specimens were collected with bottom long lines at Lucky Strike and one at Snake Pit, the latter had Rimicaris exoculata in its stomach. Oviparous.
  • COHEN D.M. (1990) in QUÉRO J.-C., HUREAU J.-C., KARRER C., POST A. & L. SALDANHA (Eds.) Check-list of the Fishes of the Eastern Tropical Atlantic 2: 541-563

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, Gulf of Maine, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide: marginal to the Southern Ocean (Ref. 5171).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide; marginal to the Southern Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in tropical and temperate waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General: Worldwide. Marginal to the Southern Ocean. Mid-Atlantic Ridge: Lucky Strike, Snake Pit, Rainbow; Galapagos Spreading Center; East Pacific Rise: 9°N. Depth range: 282-4700 m.
  • COHEN D.M. (1990) in QUÉRO J.-C., HUREAU J.-C., KARRER C., POST A. & L. SALDANHA (Eds.) Check-list of the Fishes of the Eastern Tropical Atlantic 2: 541-563

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 123 - 124; Analspines: 0; Analsoft rays: 115
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ventral parts of head mostly naked, including snout, most ventral surfaces of suborbital space, ventral preopercular margin and anterior part of mandible. Premaxillary teeth in one or two rows, one row on mandible. Inner gill rakers on first arch 11 to 14. First dorsal fin with two spines and 8- 10 rays, pectoral fins rays I+17-21. Pelvic fins 10. Anus close to anal fin origin. No light organ.
  • COHEN D.M. (1990) in QUÉRO J.-C., HUREAU J.-C., KARRER C., POST A. & L. SALDANHA (Eds.) Check-list of the Fishes of the Eastern Tropical Atlantic 2: 541-563

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1020 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

102 cm TL (male/unsexed; (Ref. 1371))
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

To at least 800 mm total length.
  • COHEN D.M. (1990) in QUÉRO J.-C., HUREAU J.-C., KARRER C., POST A. & L. SALDANHA (Eds.) Check-list of the Fishes of the Eastern Tropical Atlantic 2: 541-563

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The head is large; the eyes also large. The snout is elongated, somewhat conical; the mouth is small and inferior. The body tapers from behind the first dorsal fin. The light organ extends past midway between the anal origin and the ventral insertion. Color is uniformly brownish, except for the abdomen which is bluish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Coryphaenoides armatus
Catalog Number: USNM 48773
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1895
Locality: Bering Sea; 1,771 Fms., Alaska, United States, Aleutian Islands, Bering Sea, Pacific
Depth (m): 3239 to 3239
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Coryphaenoides armatus
Catalog Number: USNM 48585
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1890
Locality: Off British Columbia, British Columbia, Canada, Pacific
Depth (m): 2904 to 2904
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Coryphaenoides armatus
Catalog Number: USNM 75827
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1904
Locality: Off Santa Catalina Islands, Coast of Southern California, Los Angeles County, California, United States, Pacific
Depth (m): 2469 to 3990
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 282 - 5180 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A deep-slope upper continental rise species, common in deep waters of most oceans.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 200 specimens in 1 taxon.
Water temperature and chemistry ranges based on 141 samples.

Environmental ranges
  Depth range (m): 855 - 4846
  Temperature range (°C): 0.415 - 8.464
  Nitrate (umol/L): 16.616 - 43.330
  Salinity (PPS): 34.464 - 35.422
  Oxygen (ml/l): 1.419 - 6.669
  Phosphate (umol/l): 1.098 - 3.094
  Silicate (umol/l): 10.071 - 178.507

Graphical representation

Depth range (m): 855 - 4846

Temperature range (°C): 0.415 - 8.464

Nitrate (umol/L): 16.616 - 43.330

Salinity (PPS): 34.464 - 35.422

Oxygen (ml/l): 1.419 - 6.669

Phosphate (umol/l): 1.098 - 3.094

Silicate (umol/l): 10.071 - 178.507
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1830 - 4700m.
From 1830 to 4700 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A deep-slope upper continental rise species, common in deep waters of most oceans (Ref. 1371). Bathypelagic (Ref. 58426). Feeds on a variety of benthic invertebrates (especially crustaceans and holothuroids) when young, switching to primarily mesopelagic and bathypelagic fish, and sea urchins and cephalopods as adults (Ref. 1371). Feeds on fish, squids, crustaceans and echinoderms (Ref. 1371). Smaller fish feeds entirely on benthic animals, as it grows, it feeds on pelagic fishes and cephalopods (Ref. 51907).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coryphaenoides armatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NCTGTACCTTGTGTTTGGTGCCTGAGCCGGAATAGTGGGGACTGCCTTAAGTCTTCTCATCCGAGCCGAACTCAGCCAACCTGGCGCTCTTCTAGGGGACGATCAAATTTACAATGTTATTGTCACAGCACACGCGTTTGTGATAATTTTTTTCATGGTCATACCTTTAATAATCGGAGGCTTCGGAAACTGACTTGTCCCCCTAATAATCGGGGCCCCTGATATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCCCCCTCATTCCTACTACTCCTAGCATCTTCTGGGGTCGAGGCGGGGGCCGGGACTGGGTGAACTGTCTATCCCCCTTTAGCGGGCAACCTTGCCCACGCAGGGGCATCCGTAGATTTAACAATCTTCTCCCTACATCTGGCTGGGATTTCCTCAATTTTAGGGGCAATTAATTTTATTACTACCATTATTAACATAAAGCCCCCAGCCATCACCCAGTACCAAACACCTTTGTTTGTATGAGCCGTGTTAATCACGGCAGTCCTCCTCCTACTGTCCCTTCCTGTATTGGCAGCTGGAATCACAATACTGTTAACAGACCGAAACCTTAATACCTCCTTCTTCGATCCCGCAGGGGGAGGAGACCCCATCCTGTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coryphaenoides armatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Abyssal grenadier

The abyssal grenadier, Coryphaenoides armatus, is an abyssal fish of the genus Coryphaenoides, found in all the world's oceans, at depths of between 800 and 4,000 m. Its length is between 20 to 40 cm, although Fishbase gives lengths of up to 1 m. The abyssal grenadier's body is unlike any other fish. It contains 2 dorsal spines and about 124 dorsal soft rays, which are the flexible jointed rays supporting a fin nearest to the back in the spinal column. It has no anal spines, but has 115 anal soft rays amongst its body. The head and eyes of this fish are very large, while the mouth is very small and substandard. The color of the abyssal grenadier is brown apart from the abdomen which is bluish.[1][2]

See also

Notes

  1. ^ Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba. 1990.
  2. ^ MICHAEL ALLABY. "spiny fin ray." A Dictionary of Zoology. 1999. Encyclopedia.com. 23 Jun. 2010 <http://www.encyclopedia.com>.

References

  • Froese, Rainer, and Daniel Pauly, eds. (2006). "Coryphaenoides armatus" in FishBase. January 2006 version.
  • Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!