Overview

Comprehensive Description

Biology

One of most abundance shelf copepods of Arctic shelves
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body almost completely transparent, red color may be prominent on posterior quarter of prosome, mouth parts, and/or parts of the urosome (the tail); Lipid sac can be prominent; Urosome (tail) somewhat long (~40% of prosome); Antennae longer then prosome, but less than total length; Anterior of body somewhat peaked with prominent spines on posteriot ventral margins of thorathic segments I & II
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Belgian Exclusive Economic Zone, Canada Basin, Canadian Exclusive Economic Zone [Pacific part], Chukchi Sea, European waters (ERMS scope), FAO fishing area 18, FAO fishing area 67, Gulf of Maine, Gulf of St. Lawrence, North East Pacific, North Pacific, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Saguenay Fjord, northern Gaspe waters, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), downstream part of middle St. Lawrence estuary, Magdalen Islands (from Eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), lower St. Lawrence estuary, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), Upper Laurentian Channel (bathyal zone off Sept- Iles), middle North Shore (from Sept- Iles to Cape Whittle, including the Mingan Islands), Laurentian Channel (bathyal zone)(=Honguedo Strait), lower North Shore, Laurentian Channel (bathyal zone)(=Esquiman Channel), lower Laurentian Channel (bathyal zone as far as Cabot Strait: Cape North, N.S., St. Paul Island to Cape Ray, NL.), North slope of Anticosti Island; western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

upper mesopelagic, and upper epipelagic of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8644 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1349 samples.

Environmental ranges
  Depth range (m): 0 - 2909
  Temperature range (°C): -1.713 - 12.778
  Nitrate (umol/L): 0.225 - 44.900
  Salinity (PPS): 5.708 - 35.751
  Oxygen (ml/l): 0.651 - 9.185
  Phosphate (umol/l): 0.048 - 3.254
  Silicate (umol/l): 0.965 - 173.635

Graphical representation

Depth range (m): 0 - 2909

Temperature range (°C): -1.713 - 12.778

Nitrate (umol/L): 0.225 - 44.900

Salinity (PPS): 5.708 - 35.751

Oxygen (ml/l): 0.651 - 9.185

Phosphate (umol/l): 0.048 - 3.254

Silicate (umol/l): 0.965 - 173.635
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boreal to arctic waters; Abundant on shelves, limited occurrence over deep basins; Outside of the Arctic, it moves into deeper, colder waters seasonally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Suspension "filter" feeder on phytoplankton and protists; Lipid deposits accumulated for over-wintering; Thought to be one of the arctic's key grazers in shelf waters
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females beginning spawn in spring at least partly based on lipid reserves from previous year, with continued reproduction throughout the summer; Female carries eggs in a single large clutch until hatching; Clutch size dependent on size of female with maximums of ~60 and typically ~30 eggs; Generation length estimated at 1 year; Life expectancy unknown
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocalanus minutus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTAATAGCCGGGGCGTGGGCAGGAATAATTGGGACAGGACTGAGAATAATCATTCGAATAGAGCTAGGCCAAGCAGGGTCACTAATTGGAGAT---GACCAAATTTATAATGTAGTTGTGACAGCTCATGCATTTATCATAATTTTTTTTATAGTTATACCCATCTTAATTGGGGGCTTTGGTAATTGACTAGTACCCTTAATATTAGGTGCGGCAGATATAGCTTTTCCACGTATAAATAATATGAGATTCTGATTTTTAATACCGGCTTTAATCATACTTCTTTCAAGATCCTTAGTTGAAAGGGGGGCAGGTACAGGATGAACTGTTTACCCCCCATTATCCAGAAATATTGCTCATGCAGGAGGGTCAGTAGATTTTGCTATTTTTTCTTTACATTTAGCAGGTGTTAGATCTATTTTAGGTGCTGTAAATTTTATTAGCACATTAGGTAATTTACGAGTATTTGGTATACTCCTAGACCAAATACCTTTGTTTGCGTGGTCTGTATTAGTCACAGCCATCCTTTTATTACTATCCTTACCAGTATTAGCTGGGGCTATTACTATATTGTTGACAGATCGTAACTTAAACACATCATTTTATGATGTAGGGGGTGGTGGGGATCCTATCTTATAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocalanus minutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!