Overview
Comprehensive Description
Biology
One of most abundance shelf copepods of Arctic shelves
Trusted
Body almost completely transparent, red color may be prominent on posterior quarter of prosome, mouth parts, and/or parts of the urosome (the tail); Lipid sac can be prominent; Urosome (tail) somewhat long (~40% of prosome); Antennae longer then prosome, but less than total length; Anterior of body somewhat peaked with prominent spines on posteriot ventral margins of thorathic segments I & II
Trusted
Distribution
Arctic Ocean, Belgian Exclusive Economic Zone, Canada Basin, Canadian Exclusive Economic Zone [Pacific part], Chukchi Sea, European waters (ERMS scope), FAO fishing area 18, FAO fishing area 67, Gulf of Maine, Gulf of St. Lawrence, North East Pacific, North Pacific, North West Atlantic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
VLIZ Belgian Marine Species Consortium
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138645
-
Boxshall, G. (2001). Copepoda (excl. Harpacticoida), in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 252-268
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=1330
-
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One.
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
-
Institute of Ocean Science Zooplankton Database
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=150286
-
Auel, H. & W. Hagen. 2002. Mesozooplankton community structure, abundance and biomass in the central Arctic Ocean. Marine Biology Berlin 140(5): 1013-1021.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=74373
-
Hopcroft, R.R., C. Clarke, R. J. Nelson & K. A. Raskoff. 2005. Zooplankton communities of the Arctic's Canada Basin: the contribution by smaller taxa. Polar Biology 28(3):198-206.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=93055
-
Matsuno, K., A. Yamaguchi, T. Hirawake & I. Imai (2011). Year-to-year changes of the mesozooplankton community in the Chukchi Sea during summers of 1991, 1992 and 2007, 2008. Polar Biology 34(9):1349-1360.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=154958
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
-
Shih, C.T., A.J.G. Figueira & E.H. Grainger, 1971. A synopsis of Canadian marine zooplankton. Bull. Fish. Res. Bd Can. 176 : 1-264.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=31636
Trusted
Saguenay Fjord, northern Gaspe waters, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), downstream part of middle St. Lawrence estuary, Magdalen Islands (from Eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), lower St. Lawrence estuary, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), Upper Laurentian Channel (bathyal zone off Sept- Iles), middle North Shore (from Sept- Iles to Cape Whittle, including the Mingan Islands), Laurentian Channel (bathyal zone)(=Honguedo Strait), lower North Shore, Laurentian Channel (bathyal zone)(=Esquiman Channel), lower Laurentian Channel (bathyal zone as far as Cabot Strait: Cape North, N.S., St. Paul Island to Cape Ray, NL.), North slope of Anticosti Island; western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Ecology
Habitat
upper mesopelagic, and upper epipelagic of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 8644 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1349 samples.
Environmental ranges
Depth range (m): 0 - 2909
Temperature range (°C): -1.713 - 12.778
Nitrate (umol/L): 0.225 - 44.900
Salinity (PPS): 5.708 - 35.751
Oxygen (ml/l): 0.651 - 9.185
Phosphate (umol/l): 0.048 - 3.254
Silicate (umol/l): 0.965 - 173.635
Graphical representation
Depth range (m): 0 - 2909
Temperature range (°C): -1.713 - 12.778
Nitrate (umol/L): 0.225 - 44.900
Salinity (PPS): 5.708 - 35.751
Oxygen (ml/l): 0.651 - 9.185
Phosphate (umol/l): 0.048 - 3.254
Silicate (umol/l): 0.965 - 173.635
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1349 samples.
Environmental ranges
Depth range (m): 0 - 2909
Temperature range (°C): -1.713 - 12.778
Nitrate (umol/L): 0.225 - 44.900
Salinity (PPS): 5.708 - 35.751
Oxygen (ml/l): 0.651 - 9.185
Phosphate (umol/l): 0.048 - 3.254
Silicate (umol/l): 0.965 - 173.635
Graphical representation
Depth range (m): 0 - 2909
Temperature range (°C): -1.713 - 12.778
Nitrate (umol/L): 0.225 - 44.900
Salinity (PPS): 5.708 - 35.751
Oxygen (ml/l): 0.651 - 9.185
Phosphate (umol/l): 0.048 - 3.254
Silicate (umol/l): 0.965 - 173.635
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Boreal to arctic waters; Abundant on shelves, limited occurrence over deep basins; Outside of the Arctic, it moves into deeper, colder waters seasonally
Trusted
Trophic Strategy
Suspension "filter" feeder on phytoplankton and protists; Lipid deposits accumulated for over-wintering; Thought to be one of the arctic's key grazers in shelf waters
Trusted
Life History and Behavior
Life Cycle
Females beginning spawn in spring at least partly based on lipid reserves from previous year, with continued reproduction throughout the summer; Female carries eggs in a single large clutch until hatching; Clutch size dependent on size of female with maximums of ~60 and typically ~30 eggs; Generation length estimated at 1 year; Life expectancy unknown
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pseudocalanus minutus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTAATAGCCGGGGCGTGGGCAGGAATAATTGGGACAGGACTGAGAATAATCATTCGAATAGAGCTAGGCCAAGCAGGGTCACTAATTGGAGAT---GACCAAATTTATAATGTAGTTGTGACAGCTCATGCATTTATCATAATTTTTTTTATAGTTATACCCATCTTAATTGGGGGCTTTGGTAATTGACTAGTACCCTTAATATTAGGTGCGGCAGATATAGCTTTTCCACGTATAAATAATATGAGATTCTGATTTTTAATACCGGCTTTAATCATACTTCTTTCAAGATCCTTAGTTGAAAGGGGGGCAGGTACAGGATGAACTGTTTACCCCCCATTATCCAGAAATATTGCTCATGCAGGAGGGTCAGTAGATTTTGCTATTTTTTCTTTACATTTAGCAGGTGTTAGATCTATTTTAGGTGCTGTAAATTTTATTAGCACATTAGGTAATTTACGAGTATTTGGTATACTCCTAGACCAAATACCTTTGTTTGCGTGGTCTGTATTAGTCACAGCCATCCTTTTATTACTATCCTTACCAGTATTAGCTGGGGCTATTACTATATTGTTGACAGATCGTAACTTAAACACATCATTTTATGATGTAGGGGGTGGTGGGGATCCTATCTTATAC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pseudocalanus minutus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

