Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: pilchard (English), sardine (English), sardina (Espanol)
 
Sardinops sagax sagax (Jenyns, 1842)


Californian & Peruvian pilchard


Elongate, cylindrical, slender, its depth 4.5- 5.0 in SL; mouth opens at front, reaches almost under center of eye; gill rakers at angle of 1st  gill arch very short, overlapped by longer upper rakers; lower part of gill cover with bony ridges radiating obliquely down; dorsal fin 14, at about midbody; pelvics under rear of dorsal; anal fin with short base, 17, origin well behind dorsal; ridge of keeled scales along belly.


Blue on back, silvery on sides, and white on belly;  widely scattered blackish spots on side.



Size: grows to about 41 cm.

Depth: 0-200 m.

Habitat: pelagic in coastal waters.

In the north from Alaska to Gulf of California, and the Revillagigedos; in the south from southern Ecuador to Chile, and the Galapagos.

A recent genetic analysis (Grant et al. 1998) of the status of Sardinops populations indicates that there are three subspecies: S. s. ocellatus from south Africa, Australia and New Zealand, S. s. sagax from the southern and northern eastern Pacific, and S. s. melanostictus from the northwest Pacific.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Neritic (Ref. 11230). A coastal species that forms large schools (Ref. 188). Occur at temperatures ranging from 16° to 23°C in summer and from 10° to 18°C in winter. Feed mainly on planktonic crustaceans. Young fish feed on zooplankton such as copepod and adults on phytoplankton (Ref. 39882). Oviparous, with pelagic eggs, and pelagic larvae (Ref. 265). Possibly can live up to 25 years (Ref. 265). In the California region, pilchards make northward migrations early in summer and travel back south again in autumn. With each year of life, the migration becomes farther (Ref. 6885). Marketed fresh, frozen or canned. Utilized mainly for fish meal; but also eaten fried and broiled (Ref. 9988). Main source of landing: NE Pacific: Mexico (Ref. 4931).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: southern Africa to the eastern Pacific (Ref. 27267). Three lineages were confirmed through cluster and parsimony analyses of haplotypic divergences: southern Africa (ocellatus) and Australia (neopilchardus); Chile (sagax) and California (caeruleus); and, Japan (melanostictus) (Ref. 36641).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 200 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 21; Analspines: 0; Analsoft rays: 12 - 23; Vertebrae: 48 - 54
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 41.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

39.5 cm SL (male/unsexed; (Ref. 9291)); max. published weight: 486 g (Ref. 6885); max. reported age: 25 years (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body cylindrical and elongate; ventral part of operculum with clear cut bony striae radiating downwards; belly rounded with ventral scutes; back blue green; flanks white, with 1 to 3 series of dark spots along the middle (Ref. 55763). The radiating bony striae on the operculum distinguish this species from all other clupeids in the area. The radiating bony striae on the operculum distinguish this fish from all other clupeids in the area. In New Zealand the species appears to grow larger (21.3 cm standard length; cf. 19.7 cm), has slightly larger eggs and a higher mean number of vertebrae (50.52; cf. 49 to 50.08 in various samples) (Ref. 859).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Sardinops sagax
Catalog Number: USNM 4484
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: San Francisco, San Francisco County, California, United States, Pacific
  • Syntype: Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14: 281.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Sardinops sagax
Catalog Number: USNM 75831
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1838
Locality: Valparaiso, Chile, Valparaiso Province, Chile, South America, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; oceanodromous (Ref. 51243); marine; depth range 0 - 200 m (Ref. 188)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 792 specimens in 2 taxa.
Water temperature and chemistry ranges based on 312 samples.

Environmental ranges
  Depth range (m): 0.5 - 291.5
  Temperature range (°C): 7.328 - 22.344
  Nitrate (umol/L): 0.072 - 27.924
  Salinity (PPS): 32.561 - 36.064
  Oxygen (ml/l): 2.801 - 5.990
  Phosphate (umol/l): 0.117 - 2.300
  Silicate (umol/l): 1.128 - 43.395

Graphical representation

Depth range (m): 0.5 - 291.5

Temperature range (°C): 7.328 - 22.344

Nitrate (umol/L): 0.072 - 27.924

Salinity (PPS): 32.561 - 36.064

Oxygen (ml/l): 2.801 - 5.990

Phosphate (umol/l): 0.117 - 2.300

Silicate (umol/l): 1.128 - 43.395
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Near Surface, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

In South America it is caught down to depths of about 40 m, in summer at 16 to 23 C, in winter at 10 to 18 C. Forms large schools in the Peru current. Likewise in North America, it forms large schools, up to 10 million individuals; it is migratory with a definite northward movement between California and British Columbia waters in summer and return in autumn, winter. Zooplankton and phytoplankton feeder. Food items of larvae and early juveniles consist of copepods and larvaceans (Ref. 32837). Young fish feeds on zooplankton such as copepods and adults on phytoplankton (Ref. 39882). Employs both filter- and particulate-feeding modes on phytoplankton and zooplankton (Ref. 42392).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: Pelagic crustacea, zooplankton, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Pilchard Herpes Virus. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 265). In the Gulf of California, some individuals spawn in their first year, but most in their second (Ref. 188).In Australia (as S. neopilchardus), this species breeds in spring and summer in southern part of range, and in summer and autumn in northern part, apparently related to seasonal movement of the limiting 14°C and 21°C isotherms, then autumn to early spring (Ref. 6390). It was believed that individual Australian pilchards only spawn once or twice in a season (Ref. 26422, 26424), but research on related species suggests that they may spawn a number of times (Ref. 6882). Batch fecundities range from about 10,000 eggs in 13 cm long females to about 45,000 eggs in females of about 18 cm (Ref. 26420).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sardinops melanostictus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACACGTTGATTTTTCTCAACTAATCATAAAGATATTGGTACCCTTTACCTGGTATTTGGTGCCTGAGCAGGGATGGTAGGCACTGCCTTAAGTCTCTTGATCCGAGCGGAGTTAAGCCAACCCGGGGCACTTCTTGGCGACGATCAGATCTATAACGTTATCGTTACTGCACATGCCTTTGTTATAATCTTTTTCATGGTGATGCCGATTCTGATCGGTGGCTTTGGAAATTGACTAGTACCCCTTATGATCGGGGCTCCCGATATGGCATTCCCACGGATAAATAATATGAGCTTCTGACTACTCCCACCTTCGTTCCTTCTCCTTCTTGCCTCCTCGGGAGTCGAAGCTGGGGCAGGGACCGGATGAACTGTCTACCCCCCTCTAGCGGGCAATCTTGCCCACGCCGGGGCATCAGTTGATCTCACTATCTTCTCTCTTCACCTTGCAGGTATTTCTTCTATTCTTGGGGCAATTAATTTTATCACCACGATTATTAACATGAAACCCCCCGCAATTTCACAGTACCAGACGCCTTTATTCGTATGGTCAGTCCTTGTAACAGCTGTTCTCCTCCTGCTTTCGCTTCCCGTATTAGCTGCGGGGATCACAATGCTTCTAACGGATCGAAATCTTAACACAACCTTCTTCGACCCAGCTGGAGGGGGAGACCCAATCCTGTACCAACACCTCTTCTGATTCTTTGGTCACCCAGAGGTCTACATCCTCATCCTCCCCGGGTTTGGAATGATCTCCCACATTGTAGCCTACCACGCCGGTAAAAAGGAACCTTTTGGATACATAGGAATGGTATGAGCTATGATGGCCATTGGACTTCTAGGCTTTATTGTATGAGCCCATCACATGTTCACAGTGGGGATAGACGTTGATACACGGGCTTATTTCACATCAGCAACAATGATCATTGCCATCCCAACTGGTGTAAAAGTCTTTAGCTGACTTGCAACTCTGCACGGCGGCTCAATTAAGTGAGATACCCCCCTCCTCTGAGCGCTAGGTTTCATTTTCCTCTTCACGGTGGGTGGCCTTACAGGAATTGTACTAGCTAATTCCTCGTTAGACATTGTCCTACACGACACATACTATGTAGTAGCCCACTTCCACTATGTGCTATCGATGGGTGCTGTGTTTGCCATTATGGCCGCATTCGTCCATTGATTCCCCTTATTTACAGGATACACCCTACATAGCACTTGAACAAAAATCCACTTTGGAGTAATGTTCGTTGGGGTAAATCTAACCTTCTTCCCACAGCATTTCCTAGGGTTAGCCGGAATGCCACGACGGTACTCGGATTACCCGGATGCCTACACCCTTTGAAACACGGTGTCCTCAATCGGGTCACTAATCTCTTTAGTAGCAGTAATTATGTTCCTATTTATTCTTTGGGAAGCATTTGCTGCCAAACGAGAAGTTTCATCAGTGGAACTAACCATGACGAACGTAGAATGACTGCACGGATGCCCTCCTCCCTACCACACGTTTGAGGAGCCAGCCTTCGTACAAGTACAAGCGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sardinops melanostictus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Sardinops sagax

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGGTATTTGGTGCCTGAGCAGGGATGGTAGGCACTGCCTTAAGTCTCTTGATCCGAGCGGAGTTAAGCCAACCCGGGGCACTTCTTGGCGACGATCAGATCTATAACGTTATCGTTACTGCACACGCCTTTGTTATAATCTTTTTCATGGTAATGCCGATTCTGATCGGGGGCTTTGGAAATTGACTAGTACCCCTTATGATTGGGGCTCCCGATATGGCATTCCCACGGATAAATAATATGAGCTTCTGACTACTTCCACCTTCGTTCCTTCTCCTTCTTGCCTCCTCGGGAGTCGAAGCTGGGGCAGGGACCGGATGAACTGTCTACCCCCCTCTAGCGGGCAATCTTGCCCACGCCGGAGCATCAGTTGACCTCACTATCTTCTCTCTTCATCTTGCAGGTATTTCTTCTATTCTTGGGGCAATTAATTTTATTACCACAATTATTAACATGAAACCCCCCGCAATTTCACAGTACCAGACGCCTTTATTCGTGTGGTCAGTCCTTGTAACAGCTGTTCTCCTCCTGCTTTCGCTTCCCGTATTAGCTGCGGGGATCACGATGCTTCTAACGGATCGAAATCTTAACACAACCTTCTTCGACCCAGCTGGAGGGGGAGATCCAATCCTGTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sardinops sagax

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; bait: usually; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

South American pilchard

The South American pilchard, Sardinops sagax, is a sardine of the Family Clupeidae, the only member of the genus Sardinops. It is found in the Indo-Pacific oceans. Its length is up to 40 cm. It has a number of other common names, some of which more appropriately refer to subspecies, including blue pilchard, Australian pilchard, blue-bait, Californian pilchard, Chilean sardine, Japanese pilchard, Pacific sardine, and Southern African pilchard.

See also [edit]

References [edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Sardinops sagax" in FishBase. May 2006 version.
  • Ayling, T. & G. Cox. Collins Guide to the Sea Fishes of New Zealand. William Collins Publishers Ltd., Auckland, New Zealand. 1982. ISBN 0-00-216987-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!