Overview

Brief Summary

Biology

Probably the least known of all pangolin species, the black-bellied pangolin spends almost its entire life in the trees (1), but will occasionally descend into pools and rivers, where it is a competent swimmer (6). While most pangolins are nocturnal (5), the black-bellied pangolin is also frequently active during the day, enabling it to forage without facing competition from the larger, tree-dwelling three-cusped pangolin (Phataginus tricuspis) (4). The black-bellied pangolin uses scent to locate ant nests in the trees, which it pulls apart using its large foreclaws, while its long, sticky tongue flicks in out of the nest's passageways, snaring the ants and drawing them into its mouth. Because it lacks teeth, the black-bellied pangolin swallows prey whole, and the muscular, horny coated walls of its stomach grind the food (5). Little is currently known about the black-bellied pangolin's breeding behaviour. The young are generally born between November and March after a gestation period of about 140 days (1). Only a single offspring is produced, which is carried on the mother's tail for around three months before weaning (4). When threatened, pangolins curl up into a tight ball, concealing their unprotected, scaleless parts, and becoming almost impossible to unroll. They may also squirt a foul-smelling substance from their anal glands (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The remarkable black-bellied pangolin is the smallest and most arboreal pangolin species (1) (2). Like other pangolins, most of this species' head, body and tail are covered with horny, overlapping scales (4). The only regions that do not possess this extensive armouring are the sides of the face and snout, the inner surfaces of the limbs, and the throat and belly (5). Superbly adapted for climbing, the black-bellied pangolin possesses an extremely long, prehensile tail with a bare patch at the tip, which has a sensory role as well as aiding grip (4) (6). Incredibly, the tail contains between 46 and 47 vertebrae, a record among mammals, and is strong enough to take the black-bellied pangolin's entire body weight while dangling from tree branches (4) (7). The black-bellied pangolin's head is small and pointed, with the eyes protected by thick eyelids, and although lacking teeth, pangolins possess an extremely long, thin tongue, which can extend to about 25 centimetres and is used to capture food (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in the forested regions of West and Central Africa, from Sierra Leone eastwards through south-eastern Guinea, Liberia, Côte d’Ivoire and south-west Ghana, there being an apparent gap in distribution until west Nigeria. They then occur eastwards through southern Cameroon, and much of the Congo Basin forest block to the Semliki valley (and thus, just possibly, into Uganda) (Kingdon and Hoffmann in press). Their presence in Cabinda (Angola) is possible (J. Crawford-Cabral pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Long-tailed pangolins are native to parts of western and central Africa in the Ethiopian biogeographical zone. They range from Senegal to Uganda and Angola, encompassing Angola, the Democratic Republic of the Congo, the Republic of the Congo, the Central African Republic, Gabon, Equatorial Guinea, Cameroon, Nigeria, Benin, Togo, Ghana, Ivory Coast, Liberia, Sierra Leone, Guinea, Guinea Bissau, Gambia, and Senegal.

Biogeographic Regions: ethiopian (Native )

  • The Johns Hopkins University Press. 1999. Walker's Mammals of the World, 6th ed.. Baltimore, MD: The Johns Hopkins University Press.
  • Hoffmann, R., A. Gardner, R. Brownell, K. Koopman, G. Musser, D. Schlitter. 1982. Mammal Species of the World: A Taxonomic and Geographic Reference. Lawrence, KS: Allen Press Inc. and The Association of Systematics Collections.
  • Hutchins, M., D. Kleiman, V. Geist, M. McDade. 2003. Grzimek's Animal Life Encyclopedia, v. 16: Mammals V. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The black-bellied pangolin has a large range extending from Sierra Leone in West Africa, eastwards through most of the countries bordering the Gulf of Guinea to Cameroon, and possibly also the Central African Republic. The core of its range lies in the Democratic Republic of Congo, Gabon and Congo, and may extend as far south as north-west Angola (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Long-tailed pangolins have long prehensile tails that make up almost two-thirds of their total length. They have the longest tails (60 to 70 cm) and the shortest bodies (35 to 45 cm) of the eight pangolin species. Males are slightly larger than females. The tail contains 46 to 47 caudal vertebrae, a record number among mammals. Their bodies are covered with large overlapping scales, which are dark brown with yellowish edges and are shaped like artichoke leaves. Unlike Asian pangolins, they do not have hairs at the base of their scales. In addition to the 9 to 13 rows of scales covering its back, long-tailed pangolins have scales everywhere except the face, throat, belly, inner arms and legs, and a small bare patch on the underside of the tail. This bare patch contains a sensory pad used to seek out holds while climbing. Like other ant-eating mammals, long-tailed pangolins have strong, curved claws, specialized for breaking into ant nests. They have no teeth and long tongues that extend into the abdomen. Adults range in mass from 2 to 2.5 kg, and head-body length ranges from 95 to 115 centimeters. Long-tailed pangolins are sometimes mistaken for their closest relative, tree pangolins, another arboreal, African species. The two species are similar in size and coloration.

Range mass: 2 to 2.5 kg.

Range length: 95 to 115 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Gaudin, T., J. Wible. 1999. The Entotympanic of Pangolins and the Phylogeny of the Pholidota (Mammalia). Journal of Mammalian Evolution, 6: 39-65.
  • Macdonald, D. 1985. The Encyclopedia of Mammals. New York, NY: Facts on File, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is the most arboreal of the African pangolin species, found in tropical moist riverine and swamp forest, never far from water (Kingdon and Hoffmann in press). In Nigeria, it has been recorded both in secondary rainforests, in altered forests (bush), and in farmlands (agricultural areas of former lowland rainforests) (Angelici et al. 1999). It feeds on ants, termites and other invertebrates. The gestation period is about 140 days, after which the females give birth to a single young. Breeding is almost continuous.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Long-tailed pangolins are strictly arboreal, residing in hollow trees or epiphytes. They live in tropical riverine and swamp forests, and rainforests, including agricultural areas within rainforests. They are good swimmers and are always found close to water; they may drop into the water from overhanging branches. Long-tailed pangolins prefer to live away from the outer edges of forests. They are generally restricted to the forest canopy.

Habitat Regions: tropical

Terrestrial Biomes: forest ; rainforest

Wetlands: swamp

Other Habitat Features: agricultural

  • International Union for Conservation of Nature and Natural Resources. 2008. "Uromanis tetradactyla" (On-line). The IUCN Red List of Threatened Species. Version 2010.4. Accessed March 15, 2011 at http://www.iucnredlist.org/apps/redlist/details/12766/0.
  • Angelici, F., B. Egbide, G. Akani. 2001. Some New Mammal Records from the Rainforests of South-eastern Nigeria. Hystrix - Italian Journal of Mammalogy, 12: 37-43.
  • Grzimek, B. 1990. Grzimek's Encyclopedia of Mammals, v. 2. Hastings-on-Hudson, NJ: McGraw-Hill Publishing Company.
  • Happold, D. 1987. The Mammals of Nigeria. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The black-bellied pangolin chiefly occupies moist tropical forest around rivers and swamps, although in Nigeria it has been found in secondary forest and in areas of lowland rainforest converted to farmland (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Long-tailed pangolins are myrmecophagous, with a primary diet consisting mostly of ants. Unlike other species of pangolin, they do not depend on termites as a large part of their diet. Long-tailed pangolins use their sense of smell to locate arboreal ant nests and rip them open with their powerful claws. They also attack columns of foraging ants that move along the tree. Like other ant-eating mammals, long-tailed pangolins have long, sticky tongues that they use to catch ants. Prey are then broken down in its muscular, gizzard-like stomach.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Long-tailed pangolins are important ants predators and likely have a significant influence on ant demographics throughout their geographic range. There is no information regarding parasites specific to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Major predators of long-tailed pangolins include leopards, pythons, and humans. Their scales are useful for protection against predators. When long-tailed pangolins are in the trees, these scales act as camouflage, and when an individual is threatened, it curls itself into a ball, so that only the scaled parts of its body are exposed. The sharp posterior edge of each scale sticks up slightly acting as armor and a potential weapon if the predator gets too close.

Known Predators:

Anti-predator Adaptations: cryptic

  • Anadu, P., P. Elamah, J. Oates. 1988. The Bushmeat Trade in Southwestern Nigeria: A Case Study. Human Ecology, 16: 199-208.
  • Henschel, P., K. Abernethy, L. White. 2005. Leopard food habits in the Lopé National Park, Gabon, Central Africa. African Journal of Ecology, 43: 21-28.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Long-tailed pangolins have a great sense of smell, which they use to locate prey. In addition, they have a touch-sensitive pad on the tip of the tail, which is used to help them navigate trees. They possess a pair of anal scent glands, which produces a strong exudate that is deposited with feces and urine. The pheromone in anal gland exudate is likely used to attract mates and may also be used to demarcate territorial boundaries.

Communication Channels: chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

  • Feldhamer, G., L. Drickamer, S. Vessey, J. Merritt, C. Krajewski. 2007. Mammalogy: adaptation, diversity, ecology. Baltimore, MD: The Johns Hopkins University Press. Accessed April 07, 2011 at http://books.google.com/books?id=udCnKce9hfoC&pg=PA310&lpg=PA310&dq=pangolin+smell&source=bl&ots=vL2kqXUPVh&sig=PzV8wxcSUy9_huRY5Ha-CmNfwH4&hl=en&ei=WuOdTZQF7YLRAfCetcEE&sa=X&oi=book_result&ct=result&resnum=10&ved=0CF0Q6AEwCQ#v=onepage&q&f=false.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is no information available regarding the lifespan of long-tailed pangolins. In general, pangolins do not do well in captivity, typically surviving less than six months.

  • Yang, C., S. Chen, C. Chang, M. Lin, E. Block, R. Lorentsen, J. Chin, E. Dierenfeld. 2007. History and Dietary Husbandry of Pangolins in Captivity. Zoo Biology, 26: 223-230.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Little is known about the mating system of long-tailed pangolins or pangolins in general. They are solitary, only coming together to mate. During copulation, the male and female face each other and intertwine tails.

It is likely that long-tailed pangolins breed throughout the year. The gestation period is about 4.5 months. Females give birth to a single offspring at a time. At birth, young weigh 100 to 150g. They are born with soft scales, which harden in a matter of days. Young ride on their mother for up to 3 months by clinging to her tail. Although weaning and lifespan are unknown, long-tailed pangolins are thought to reach sexual maturity at around 2 years old. More is known about the reproductive life-hostory of tree pangolins, which are closely related to long-tailed pangolins. Tree pangolins give birth to a single young after a 6 month gestation period. Young are born with eyes open and scales still soft, which harden after 2 days. Young tree pangolins stay in the nest until they are 2 to 3 weeks old, at which point they ride on their mothers' backs and tails. Weaning occurs after 3 to 4 months, and adult size is reached after 15 months.

Breeding interval: Long-tailed pangolins breed throughout the year.

Average number of offspring: 1.

Average gestation period: 140 days.

Range birth mass: 100 to 150 g.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Limited is known of parental care in long-tailed pangolins. Females nurse and care for their young for extended periods, and young are dependent on their mothers for up to 3 months. Males are not involved in parental care.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • The Johns Hopkins University Press. 1999. Walker's Mammals of the World, 6th ed.. Baltimore, MD: The Johns Hopkins University Press.
  • International Union for Conservation of Nature and Natural Resources. 2008. "Uromanis tetradactyla" (On-line). The IUCN Red List of Threatened Species. Version 2010.4. Accessed March 15, 2011 at http://www.iucnredlist.org/apps/redlist/details/12766/0.
  • Gaudin, T., J. Wible. 1999. The Entotympanic of Pangolins and the Phylogeny of the Pholidota (Mammalia). Journal of Mammalian Evolution, 6: 39-65.
  • Grzimek, B. 1990. Grzimek's Encyclopedia of Mammals, v. 2. Hastings-on-Hudson, NJ: McGraw-Hill Publishing Company.
  • Happold, D. 1987. The Mammals of Nigeria. New York: Oxford University Press.
  • Hutchins, M., D. Kleiman, V. Geist, M. McDade. 2003. Grzimek's Animal Life Encyclopedia, v. 16: Mammals V. Farmington Hills, MI: Gale Group.
  • Macdonald, D. 1985. The Encyclopedia of Mammals. New York, NY: Facts on File, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Manis tetradactyla

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0103-06|AJ421454|Manis tetradactyla| AATCGTTGATTATTCTCAACTAATCACAAAGATATCGGCACATTATATCTTATCTTTGGTGCTTGAGCCGGAATAGTAGGAACGGCTCTA---AGTCTTTTAATTCGTGCTGAATTAGGCCAGCCTGGAACCCTATTAGGTGAT---GATCAAATTTATAATGTCATCGTAACCGCTCATGCATTTGTAATAATTTTCTTCATAGTTATGCCTATTATAATTGGAGGCTTTGGGAACTGGTTGGTACCCCTAATA---ATTGGTGCCCCCGATATAGCATTTCCCCGTATAAACAACATAAGTTTTTGGCTTCTCCCTCCTTCCTTTCTTCTTCTTCTAGCATCTTCTATAGTCGAAGCAGGAGCTGGGACTGGTTGAACAGTCTACCCGCCTTTAGCAGGAAACCTAGCACATGCAGGAGCTTCTGTCGATTTA---ACTATTTTCTCTCTTCATCTGGCAGGCATTTCATCAATTTTAGGGGCTATTAACTTTATTACAACTATTATTAATATAAAACCCCCTGCCATGAGTCAATATCAAACCCCCTTATTTGTGTGATCCGTATTAATTACAGCCGTATTACTTCTGCTATCTCTCCCTGTCCTAGCTGCA---GGTATTACAATACTCCTCACAGACCGAAATTTAAATACAACCTTTTTTGACCCTGCTGGAGGAGGAGATCCAATCCTGTATCAGCACCTATTCTGATTCTTCGGTCACCCAGAAGTATACATTTTAATTCTTCCAGGCTTTGGTATAATTTCCCACATTGTAACCTACTACTCAGGGAAAAAA---GAGCCCTTTGGATACATGGGAATAGTTTGGGCTATAATATCAATTGGATTTTTAGGCTTCATCGTATGGGCCCACCACATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manis tetradactyla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hoffmann, M.

Reviewer/s
Hoffmann, M. & Stuart, S.N. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, presence in a number of protected areas, shy and arboreal nature, and tolerance of a degree of habitat modification, which suggest that is unlikely to be declining fast enough to qualify for listing in a higher category of threat. Nonetheless, the species requires close monitoring given the growing threat of bushmeat hunting.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although populations of Manis tetradactyla are declining, this species is still classified as "least concern" by the IUCN Red List of Threatened Species. It is relatively widespread, resides primarily in protected areas, and is tolerant of moderate habitat modification. Manis tetradactyla is the least often observed of the African pangolin species, and populations may be larger than predicted. The bushmeat trade presents the greatest threat to the long-term survival of this species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no quantitative data available on densities or abundance. This is the least frequently recorded of all African pangolins, though it may be less rare than available records suggest. The species is extremely shy, almost strictly arboreal, and mainly restricted to little-known and little-penetrated habitats (Kingdon and Hoffmann in press).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
It is threatened by selective hunting for meat, medicinal and cultural use, although to a far lesser degree than Phataginus tricuspis or Smutsia gigantea. According to CITES trade reports for the period 1996-2005, trade in live animals, specimens or skins is reported in nearly every year, with 40 specimens exported from the Central African Republic in 2000 (Kingdon and Hoffmann in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The main threat to the black-bellied pangolin, and indeed all pangolins, is hunting, both for meat and for use in traditional medicine (5). Although the black-bellied pangolin is less frequently hunted than some other species, the growing demand for bushmeat may cause this species to become increasingly targeted. Due to its large range, it has previously been assumed that the black-bellied pangolin has a relatively large population. Nevertheless, with limited data collected from the field, it is possible that the black-bellied pangolin is actually rarer than reports suggest, and the effects of increased hunting pressure could have serious implications for its survival (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in a number of protected areas (e.g. Ituri Forest Reserve). While it is listed on Appendix II of CITES, there is a need to develop and enforce protective legislation in many range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The black-bellied pangolin is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), which means that international trade in this species is strictly regulated (1) (3). In addition, this species occurs in a number of protected areas, such as Ituri Forest Reserve in the Democratic Republic of Congo (1). While these areas are vital for protecting threatened wildlife, many are faced with the continual problems of illegal logging, mining and encroachment of agriculture, and are continually in need of funding to develop and enforce the protective measures that they employ (1) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of long-tailed pangolins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Long-tailed pangolins are hunted and sold by native people as part of the bushmeat trade. A survey taken in Nigeria (Anadu et al., 1988) found that long-tailed pangolins were worth about 12 US dollars per kilogram. They are also killed for their scales, which are used in traditional medicines, as jewelry, and as good luck charms.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-tailed Pangolin

The long-tailed pangolin (Manis tetradactyla), also called the black-bellied pangolin or ipi,[3] is an arboreal pangolin native to the sub-Saharan forests of Africa. Its common name is derived from its especially long tail (average 60 cm, or 24 inches). Even with the long tail, this species is the smallest pangolin.

This pangolin is a nocturnal insectivore.

As with other pangolins, the long-tailed pangolin is covered with overlapping scales, in this case a dark brown color. The tip of the tail is bare and is used to grip branches. The abdomen is covered in dark fur instead of scales.

References

  1. ^ Schlitter, Duane A. (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 531. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ Pangolin Specialist Group (1996). Manis tetradactyla. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 2007-05-29.
  3. ^ http://dictionary.die.net/ipi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!