Overview

Comprehensive Description

Description

A small brown treefrog, M SVL 24-27 mm. Tibiotarsal articulation reaches the nostril or between nostril and snout tip. Hand with some webbing, foot webbing 1(0), 2i(1), 2e(0), 3i(1), 3e(0.5), 4i/e(1.25), 5(0.25). Dorsal skin smooth. Colouration very variable. Can be uniformly light brown, or brown with a large dark hourglass marking, or brown with lichen-like yellow or pink spots. Ventrally white. No red colour on limbs or on iris.

The tibia is clearly longer than the foot. Vomerine teeth are present. A nuptial pad is recognizable on the irst finger. Males with a single subgular vocal sac. Bones are distinctly green.

In life some rather indistinct dark crossbands are present on the legs. The tips of fingers and toes are greenish. The belly is centrally silvery white and laterally transparent. The throat is transparent with a green shade. In preservative the colouration of the back has not changed substantially. The ventral side is yellowish white. Iris is light brown to grey, with some reddish-brown colour. Iris periphery greenish yellow.

Similar species: Morphologically very similar to B. marojezensis, but the calls of both species are very different.

Variation: The population observed in the Manarikoba forest at the Tsaratanana Massif is similar to that from the type locality Montagne d’Ambre, but is genetically strongly differentiated, indicating possible taxonomic distinctness.

Variation: The population observed in the Manarikoba forest at the Tsaratanana Massif is similar to that from the type locality Montagne d’Ambre, but is genetically strongly differentiated, indicating possible taxonomic distinctness.

Derivatio nominis: Dedicated to Rose Blommers-Schlösser, Rhenen, in recognition of her invaluable contributions to the knowledge of Malagasy frogs.

Taken with permission from Glaw and Vences (2007).

  • Nussbaum, R., Raxworthy, C., and Glaw, F. (2008). Boophis blommersae. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs at Montagne d'Ambre in northern Madagascar, and further south in the general vicinity of Tsaratanana. Other rainforest areas of northern Madagascar might also harbour this species. Its recorded altitudinal range is 500-900m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Montagne d’Ambre, Tsaratanana (Andampy campsite). Elevation range (800-1200m asl). This species inhabits humid rainforest, living only in slightly modified habitats. Breeding occurs in streams (Nussbaum et al. 2008).

  • Nussbaum, R., Raxworthy, C., and Glaw, F. (2008). Boophis blommersae. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a species of humid rainforest, surviving only in slightly modified habitats. It breeds in streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boophis blommersae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGACTGCCTTAAGCCTGCTGATCCGCGCTGAGTTGGGTCAGCCTGGTGCCCTCCTGGGTGAT---GACCAGATCTATAATGTTGTTGTAACAGCCCACGCTTTTGTGATGATCTTTTTCATGGTCATACCTATCCTCATCGGGGGCTTTGGCAATTGGCTTGTGCCCTTAATAGTGGGGGCCCCCGACATAGCTTTTCCCCGAATAAATAACATAAGCTTTTGGCTGCTACCCCCCTCATTCTTCCTTCTTCTAGCTTCTTCTATAGTGGAGGCCGGAGCAGGGACTGGGTGGACTGTTTACCCCCCCCTGGCGGGAAATCTCGCCCATGCGGGCCCCTCGGTTGACTTAACCATCTTCTCCCTCCACCTAGCAGGTGTATCTTCTATTCTAGGAGCTATCAACTTTATTACAACAATTCTTAATATAAAGCCCCCCTCAACGGCTCAATACCAAACCCCCCTTTTCGTTTGGTCAGTGTTAATCACAGCCGTGCTGTTGTTACTCTCATTGCCCGTTCTGGCCGCCGGTATTACCATACTCCTCACGGAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Boophis blommersae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2008

Assessor/s
Nussbaum, R., Raxworthy, C.J. & Glaw, F.

Reviewer/s
Stuart, S.N., Chanson, J.S. & Cox, N.A.

Contributor/s

Justification
Listed as Vulnerable because its Extent of Occurrence is less than 20,000 km2, it is known from fewer than ten locations, and there is continuing decline in the extent and quality of its habitat in northern Madagascar.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a very common species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Males call at night along streams in rainforest, from perches 0.5-2 m high in the vegetation. Males were found calling in March in primary forest. They were heard after sunset mainly along noisy brooks from vegetation about 0.5-1.5 m above the ground.

Call (from the terra typica): A very irregular series of high-pitched chirps and trills, reminding calls of small birds. Consists of two different note types. Note type 1 is an unharmonious pulsed sound (5-6 pulses recognizable) with a duration of 210-280 ms. Note type 2 is a short click of 55-85 ms. These notes are arranged in series, typically 3 notes of type 1 followed by 2-4 notes of type 2. Intervals between the notes are 300-650 ms and tend to increase towards the end of the call. Frequency of both note types is between 3.8 and 5.9 kHz.

Eggs and tadpoles: Unknown.

  • Nussbaum, R., Raxworthy, C., and Glaw, F. (2008). Boophis blommersae. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Its forest habitat is receding due to subsistence agriculture (including livestock grazing), timber extraction, charcoal manufacture, the spread of invasive eucalyptus, and expanding human settlements.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Vulnerable: extent of occurrence is less than 20,000 km2, it is known from fewer than ten locations, and there is continuing decline in the extent and quality of its habitat in northern Madagascar. It occurs in Parc National de Montagne d'Ambre and Réserve Naturelle Intégrale du Tsaratanana (Nussbaum et al. 2008).

  • Nussbaum, R., Raxworthy, C., and Glaw, F. (2008). Boophis blommersae. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in Parc National de Montagne d'Ambre and Réserve Naturelle Intégrale du Tsaratanana.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Boophis blommersae

Boophis blommersae is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist lowland forests and rivers. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!