Overview

Comprehensive Description

Description

A small, variable coloured, mainly arboreal frog; males 21-29 mm, females 27-28 mm. Dorsal surface reddish, greyish or greenish often with a dark bar between the eyes and sometimes with a light vertebral median band. White or yellow spots on the inguinal region, temporal region dark and white spots on the upper lip. In life, ventral surface of the female is pale green, whereas the throat of the male is shining white. Belly and ventral surface of the legs are dark, sometimes (in specimens from Ranomafana) completely black. Dorsal skin more or less smooth. Nostrils clearly nearer to tip of snout than to eye. Tympanum distinct, about 2/5 of eye diameter. Tibiotarsal articulation reaches the eye. Lateral metatarsalia connected. Inner and outer metatarsal tubercles present. Virtually no webbing between fingers; webbing of the foot 1(1), 2i/e(1), 3i(2), 3e(1), 4i/e(2), 5(1). Fingers with terminal disks. Hand (foot) length/SVL is 0.32-0.34 (0.46-0.50). Males have femoral glands which can be diffuse and not recognizable, especially in living specimens, but sometimes are large, oblong, 8x2.5 mm and very distinctive. A largely distensible, single subgular vocal sac, coloured bright white, is present in males.

Similar species: Colouration of M. liber is very variable; M. pulcher can be identified by its different colouration of green with violet markings. From all species of the subgenus Pandanusicola, M. liber differs by having larger hands and feet: hand length/body length ratio is 0.23-0.28, foot length/body length ratio is 0.38-0.43 for species of Pandanusicola. The connected lateral metatarsalia distinguish M. liber from the other species of Guibemantis. Confusion with members of Blommersia and with small species of Boophis, especially those of the B. rappiodes-group, might also be possible.

Taken with permission from Glaw and Vences (2007).

  • Nussbaum, R., Raxworthy, C., and Andreone, F. (2008). Guibemantis liber. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 01 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is very widely distributed in northern and eastern Madagascar from Montagne d'Ambre south to Andohahela. It also occurs on Nosy Boraha (Ile St Marie). It has been recorded from near sea level up to 2,050m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Ambohitantely, An’Ala, Andapa, Andasibe, Andrangoloaka, Andranomay forest, Anjozorobe, Anosibe, Antratrabe, Besariaka near Moramanga, Betatao, Ifanadiana, Itremo, Manakara, Mananara-Nord, Mandraka, Marojejy, Montagne d’ Ambre, Moramanga, Ranomafana, Sainte Luce, Vevembe, Vohiparara. It occurs between sea level and 2,050m asl (Nussbaum et al. 2008).

  • Nussbaum, R., Raxworthy, C., and Andreone, F. (2008). Guibemantis liber. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 01 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives in both pristine and disturbed rainforest. It is arboreal, often found in leaf axils or screw pines (Pandanus spp.) and other plants. It is associated with swamps, and can be found outside forest in swamps and pools in some places, but it avoids very open areas without cover. It breeds in swamps.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Guibemantis liber

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTGCCCTCAGTCTTTTAATCCGAGCTGAACTTGGTCAACCGGGAACACTTCTTGGAGAC---GACCAAATTTATAATGTTATTGTAACCGCACATGCATTCGTAATAATTTTTTTTATAGTTATGCCAATCCTAATCGGGGGTTTTGGAAACTGACTTGTACCGCTAATAATTGGAGCCCCAGATATGGCCTTCCCTCGAATAAATAATATAAGCTTTTGACTTCTACCCCCATCTTTTTTTCTCCTTCTGGCTTCTTCAATAGTAGAAGCAGGGGCAGGAACTGGTTGAACTGTTTACCCACCACTTGCAGGCAACTTGGCCCATGCAGGCCCTTCTGTAGACCTTACTATTTTTTCTCTACATCTAGCAGGTGTATCTTCAATTCTGGGGGCTATTAACTTTATTACGACTATTCTTAACATAAAACCACCCTCAATTACCCAATATCAGACCCCACTCTTTGTTTGATCTGTGTTAATTACTGCAGTTCTCCTCCTTTTATCCCTCCCTGTTTTAGCCGCTGGTATTACCATGCTCCTCACAGATCGAAACTTAAATACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Guibemantis liber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Ronald Nussbaum, Christopher Raxworthy, Franco Andreone

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a very common species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habits: During the day, the species can sometimes be found around phytotelmes, often in plants, such as axils of Pandanus, Typhonodorum lindleyanum, Ravenala madagascariensis and banana, as well as on Crinum firmifolium, Rapphia palms and arboreal ferns, inside or outside of primary forest. M. liber becomes active at dusk. During wet nights in the rainy season, males call from vegetation around swamps, temporary pools or very slow-moving water.
Breeding behaviour was described as follows: The female moved in the direction of the male and, on reaching him, tried to push her head from behind underneath his belly. The male did not seem to notice her at first, but after some minutes he stopped calling and placed his hind legs in such a way that the ventral side of his thighs touched the dorsal side of her head and shoulders. In this posture, the male showed heavy lateral pulsing movements in the flanks, while the female started depositing her eggs without delay. The laying of about 60 eggs was finished within ten minutes. The male left the female some minutes before she was ready and started calling at a distance. The breeding season is from November to May, as indicated by calling males, gravid females and egg clutches found in that period.

Call (from Andasibe): The call is a series of 7-10 unharmonious notes, similar to the call of Boophis difficilis. However, it is less "metallic", and reminds the sound of two pebbles beaten against each other. Note duration is about 50-100 ms, intervals between notes last about 200 ms. Frequency ranges from 2.2-3.8 kHz. Calls from Montagne d'Ambre ranged from 2.5-3.3 kHz and consist of 3-15 notes.

Eggs and tadpoles: Clutches consist of 30-90 pale green coloured eggs with a brownish pole (fig. 159). Clutch diameter is 2-3 cm, later 4.5-6 cm; egg diameter 1.3-1.5 mm. The transparent and colourless egg masses can be found hanging from leaves, usually about 1.5 m above water bodies. The embryos hang tail downward in the liquefied jelly mass. After embryonic development of 5-7 days, the hatchling larvae drop into the water, measuring about 9 mm. The tail is more than twice as long as the body; horny beak and papillae are already present. Tadpole colouration is grey or rarely brown. Complete tooth formula from stage 27 on is mostly 1/3+3//3, but sometimes 1/2+2//3 or 1/4+4//3. Tadpoles reach a maximum total length of 35 mm in stage 37. They can be found throughout the year. They are not very agile and spend most of the time lying on the bottom, often together with tadpoles of Mantidactylus betsileanus. Metamorphosis in the hot season takes two months.

  • Nussbaum, R., Raxworthy, C., and Andreone, F. (2008). Guibemantis liber. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 01 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Its forest habitat is receding due to subsistence agriculture, timber extraction, charcoal manufacture, and livestock grazing and expanding human settlements. It is probably also affected by the collection of screw pines, which are used for the roofs of huts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

It occurs in many protected areas (Nussbaum et al. 2008).

  • Nussbaum, R., Raxworthy, C., and Andreone, F. (2008). Guibemantis liber. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 01 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Glaw, F. and Vences, M. (1994). Amphibians and Reptiles of Madagascar. M. Vences and F. Glaw Verlags GbR., Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mantidactylus liber

Mantidactylus liber is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, swamps, and heavily degraded former forest. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!