Physical Description

Type Information

Holotype for Oxeostilon burtoni de Laubenfels, 1934
Catalog Number: USNM 22347
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol); Slide
Collector(s): P. Bartsch
Year Collected: 1933
Locality: Samana Bay, Dominican Republic, Caribbean Sea, North Atlantic Ocean
Depth (m): 31 to 31
Vessel: Caroline R/V
  • Holotype: de Laubenfels. 1934. Smithson. Misc. Collns. 91(17): 15.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 70 specimens in 1 taxon.
Water temperature and chemistry ranges based on 35 samples.

Environmental ranges
  Depth range (m): 7 - 116
  Temperature range (°C): 20.433 - 24.954
  Nitrate (umol/L): 0.501 - 4.098
  Salinity (PPS): 35.982 - 36.446
  Oxygen (ml/l): 4.065 - 4.895
  Phosphate (umol/l): 0.094 - 0.398
  Silicate (umol/l): 0.805 - 2.688

Graphical representation

Depth range (m): 7 - 116

Temperature range (°C): 20.433 - 24.954

Nitrate (umol/L): 0.501 - 4.098

Salinity (PPS): 35.982 - 36.446

Oxygen (ml/l): 4.065 - 4.895

Phosphate (umol/l): 0.094 - 0.398

Silicate (umol/l): 0.805 - 2.688
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Axinella corrugata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGTCGTTGATTATTTTCAACTAACCATAAAGACATTGGAACTCTTTATCTATTATTGGGAGCATTTAGTGGGATGATAGGAACAGCCTTTAGTGTGCTTATTAGATTAGAATTATCGGCTCCAGGTTCAATGTTAGGTGAT---GATCAGTTGTATAATGTTATAGTAACTGCCCATGCCTTTGTAATGATATTCTTTCTGGTTATGCCGGTGTTAATCGGAGGGTTTGGAAACTGATTCGTACCCTTATACATAGGGGCTCCAGATATGGCGTTTCCAAGGCTAAATAATATCAGTTTTTGACTATTACCCCCATCATTAACTTTATTACTAGGTTCTGCTTTTGTAGAGCAGGGGGCCGGTACAGGGTGGACAGTCTACCCGCCGTTAGCAAGTATACAAGCACATTCAGGGGGGTCAGTAGACATGGTTATTTTTAGTCTTCATTTAGCAGGTATTTCTTCAATATTAGGGGCGATGAATTTTATCACAACTATCTTTAATATGAGGGCGCCAGGGATAACAATGGATAGAATGCCATTATTTGTGTGATCTATTTTAGTAACAGTATTTTTATTGTTATTGTCTCTGCCAGTTTTAGCCGGGGCTATAACTATGCTTCTTACAGATAGAAACTTTAACACTACCTTTTTTGACCCAGCAGGGGGGGGTGACCCCATATTATACCAACACTTATTTTGGTTCTTTGGGCACCCCGAAGTTTACATTTTAATATTGCCGGGGTTTGGAATTATTTCTCAAATAATTCCTACATTTGCTGCAAAAAAACAAATATTTGGGTACCTTGGCATGGTTTATGCCATAGTTTCTATTGGTATATTGGGGTTTATAGTTTGAGCTCATCACATGTTTACGGTTGGGATGGATGTGGACACTAGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Axinella corrugata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!