Ecology

Habitat

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 13 - 77
  Temperature range (°C): 20.433 - 23.535
  Nitrate (umol/L): 1.078 - 4.098
  Salinity (PPS): 36.096 - 36.446
  Oxygen (ml/l): 4.163 - 4.766
  Phosphate (umol/l): 0.132 - 0.276
  Silicate (umol/l): 1.334 - 2.688

Graphical representation

Depth range (m): 13 - 77

Temperature range (°C): 20.433 - 23.535

Nitrate (umol/L): 1.078 - 4.098

Salinity (PPS): 36.096 - 36.446

Oxygen (ml/l): 4.163 - 4.766

Phosphate (umol/l): 0.132 - 0.276

Silicate (umol/l): 1.334 - 2.688
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tethya actinia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGTAGATGATTATTCTCAACTAATCATAAAGATATTGGGACTCTTTATTTATTATTTGGGGCATTTGCAGGAATGATAGGAACAGGATTTAGTATGTTAATTAGACTTGAATTATCTGCTCCTGGTTCAATGTTAGGAGAT---GACCATTTGTATAATGTGATTGTAACAGCTCATGCCTTTGTAATGATATTTTTTTTAGTAATGCCAGTAATGATTGGGGGGTTTGGAAATTGATTTGTGCCATTATATATTGGTGCACCAGATATGGCATTTCCTAGATTAAATAATATAAGTTTTTGGTTATTACCTCCTTCGTTAACTTTATTATTGGGTTCTGCTTTTGTGGAACAAGGAGCTGGAACAGGGTGGACAGTTTATCCTCCTTTAGCAAGTATACAGGCTCATTCAGGAGGATCAGTAGATATGGCAATATTTAGTTTACATTTAGCCGGTATTTCTTCAATTTTAAGTACAATAAATTTTATAACAACAATTTTAAATATGAGGGCACCGGGGATAACAATGGATCGAATGCCATTATTTGTTTGATCAATTTTAATTACGGCTATTTTATTATTATTATCTTTACCTGTTTTAGCGGGTGCGATTACAATGCTTCTTACAGACAGAAATTTTAATACAGCATTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGGCATCCAGAGGTTTATGTTTTAATTTTACCAGGGTTTGGAATAATTTCTCAAATTGTACCAACATTTGCTGCAAAAAAACAAATATTTGGTTATCTTGGTATGGTGTATGCTATGGTATCAATAGGAATATTAGGGTTTATAGTTTGAGCGCATCATATGTTTACTGTTGGTATGGACGTAGATACAAGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tethya actinia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tethya actinia

Tethya actinia is a sea sponge belonging to the family Tethyidae.[1]

While it is highly toxic to fish, it is known to be preyed upon by the hawksbill turtle, Eretmochelys imbricata.[2]

References

  1. ^ http://www.marinespecies.org/aphia.php?p=taxdetails&id=170932 accessed 14 November 2010
  2. ^ Meylan, Anne (1988-01-12). "Spongivory in Hawksbill Turtles: A Diet of Glass". Science (American Association for the Advancement of Science) 239 (4838): 393–395. doi:10.1126/science.239.4838.393. JSTOR 1700236. PMID 17836872. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!