Overview

Comprehensive Description

Description

 The body form is very variable, typically massively lobed but can be a cushion, massively globular, elongated or encrusting. Size varies between 10-40 cm in diameter and the surface looks smooth but is slightly rough to touch. The colour is usually orange or intermediate shades of yellow, brown and orange but has also been reported as white, grey or green. The pores through which water leaves the body cavity (oscules) are large and typically at the tops of the lobes but may be in other positions.Suberites ficus has been variously reported as being both synonymous with, and a separate species from Suberites domuncula. The name given to these species is still tentative because the specific distinctiveness of Suberites ficus and other named forms needs further study (van Soest et al., 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This sponge usually consists of smoothly rounded lobes with large irregular oscules. It is typically orange or red in colour, brighter red in well-lit shallow water and paler in darker or siltier sites. Forms encrusting scallop shells may belong to distinct species, they tend to form smooth crusts with evenly spaced small oscules.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range covers both subprovinces of Acadian and Virginian.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aegean Sea, Banc d'Arguin, Belgian Exclusive Economic Zone, Cape Verde, Celtic Seas, Cobscook Bay, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Irish Exclusive economic Zone, Mediterranean Sea, Namaqua, Namibia, New Zealand Exclusive Economic Zone, North Atlantic, North Coast of Spain, North East Atlantic, North Sea, North West Atlantic, South Africa (country), South European Atlantic Shelf, United Kingdom Exclusive Economic Zone, West Africa, West Mediterranean, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common and widespread around the British Isles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 140 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 0 - 152
  Temperature range (°C): 7.254 - 15.249
  Nitrate (umol/L): 0.633 - 11.666
  Salinity (PPS): 32.968 - 35.343
  Oxygen (ml/l): 4.518 - 6.548
  Phosphate (umol/l): 0.373 - 0.993
  Silicate (umol/l): 2.366 - 8.110

Graphical representation

Depth range (m): 0 - 152

Temperature range (°C): 7.254 - 15.249

Nitrate (umol/L): 0.633 - 11.666

Salinity (PPS): 32.968 - 35.343

Oxygen (ml/l): 4.518 - 6.548

Phosphate (umol/l): 0.373 - 0.993

Silicate (umol/l): 2.366 - 8.110
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Occurs on rock and other hard substrata such as wreckage and empty gastropod and scallop shells. Reported to prefer being exposed to tidal currents.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Attached to rock in exposed sites and loose-lying amongst algae in sheltered sites.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Suberites ficus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTTTATTTATTATTTGGGGCTTTTGCCGGGATGATCGGGACAGCTTTTAGCATGTTAATAAGATTAGAGCTATCTGCTCCTGGTTCAATGCTTGGCGAT---GACCATTTATATAACGTAATAGTAACTGCTCACGCCTTTGTAATGATTTTCTTTTTGGTTATGCCTGTGCTGATAGGGGGCTTCGGAAACTGATTTGTTCCTCTATATATTGGTGCACCCGATATGGCTTTTCCTAGATTGAATAATCTTAGTTTTTGATTGTTACCTCCTGCTTTAACTTTATTATTAGGTTCAGCATTTGTAGAACAAGGAGCTGGGACAGGTTGAACTGTTTATCCTCCTTTATCAAGTATACAAGCTCACTCAGGTGGGTCAGTAGATATGGCAATATTTAGTCTTCATTTAGCTGGGATATCTTCTATATTGGGGGCTATGAATTTTATTACAACAATTATAAATATGCGGGCTCCAGGTATTACAATGGACCGAATGCCTTTATTTGTGTGATCCGTTTTAGTAACTGCTGTTTTGTTATTATTATCTTTACCGGTATTGGCAGGGGCTATAACAATGCTTTTGACAGATCGGAATTTTAATACTGCGTTCTTTGACCCTGCGGGGGGAGGGGATCCTATTTTATATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Suberites ficus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Suberites ficus

Suberites ficus is a species of sponge in the family Suberitidae. It is sometimes known as the sea orange sponge.

Sponges are primitive animals with little apparent internal organisation. They are composed of a jellylike mesohyl sandwiched between two layers of cells and have a fragile skeleton composed of stiff spicules. They are filter feeders, maintaining a flow of water through their structure which passes out through large openings called oscula.

Contents

Taxonomy

The name "ficus" was first used by Pallas in 1766 for Alcyonium ficus but it is unclear exactly which animal he was describing and it is now thought that it may have been an ascidian. Linnaeus in 1767, Esper in 1794 and Lamarck in 1814 also used the name but it was not until Johnston described the spicules as well as the sponge which he named Halichondria ficus in 1842 that it became clear what sponge was being described. Further research needs to be undertaken to clarify the position.[2] Suberites suberia was at one time thought to be a synonym but molecular analysis has shown that it is a distinct species. Suberites farinaria is a similar but encrusting sponge but it is thought to be a juvenile form of S. ficus. Another species, Suberites virgultosa, used to be considered a synonym but is now considered a valid species in its own right.[2] Suberites domuncula may also be synonymous and further study is required.[3]

Description

S. ficus is a large sponge growing up to thirty or forty centimetres across. It is usually some shade of orange or red, especially in brightly lit places, but sometimes is greyish or brownish in dimmer locations. The shape is irregular and varies, sometimes being lobose, sometimes cushion-like and sometimes encrusting. It has a smooth-looking surface but this feels rough to the touch. There are a small number of large oscules, mostly towards the top of the sponge.[4][5]

On microscopic examination it can be seen that the megascleres are in two sizes, one twice as large as the other. There are very few microscleres, and these are one tenth of the size of the megascleres. The skeleton is composed of spicules arranged radially near the surface, but chaotically in the interior. There may be gemmules near the base of the sponge.[2]

Distribution

S. ficus has a global distribution but it is more abundant in the north east and north west Atlantic Ocean than elsewhere.[6] It is widely distributed around the shores of the British Isles especially the western coasts.[5]

Habitat

S. ficus is found growing on rocks from the lower shore down to a depth of two hundred metres and prefers locations with strong tidal flows. It often grows among seaweed and is also found on harbour structures and wreckage. When it grows on a stone or an empty gastropod or bivalve shell it may completely engulf it. It sometimes grows on a shell housing a living hermit crab.[4][5]

Biology

Members of this genus are generally hermaphrodites. The male and female gametes may not be released simultaneously and sperm may be drawn in to the vascular system of another individual. Fertilisation is internal and the ciliated larvae are liberated into the water column and become part of the zooplankton. Asexual reproduction also takes place, either by budding or through the development of gemmules.[1] These are "survival pods" and remain dormant under normal conditions. They can become active when a period of adverse conditions such as an excessive exposure to low temperatures comes to an end.[7]

Ecology

S. ficus does not have many predators. This may be because it has an unpleasant odour or because the spicules make it unpalatable. It is eaten however by some marine gastropods and some nudibranchs.[1] It forms part of the diet of the Atlantic bluefin tuna (Thunnus thynnus).[6]

When the sponge grows on a shell occupied by a hermit crab there may be mutual advantages to both. The sponge benefits from the crab's ability to move away from predators such as nudibranchs, while the crab may benefit from the sponge's unpalatability and the camouflage it provides.[8]

S. ficus ssp rubrus is being investigated as a possible source of antibiotics, anti-fouling and other biologically active compounds because it was noticed that when the shells of cultivated scallops, family Pectinidae, were host to this sponge, no other invertebrates fouled the shells.[9]

References

  1. ^ a b c World Register of Marine Species
  2. ^ a b c Marine Species Identification Portal
  3. ^ van Soest, R.W.M., Picton, B. & Morrow, C., (2000). Sponges of the North East Atlantic. [CD-ROM] Amsterdam: Biodiversity Center of ETI, Multimedia Interactive Software.
  4. ^ a b European Marine Life
  5. ^ a b c Marine Life Information Network
  6. ^ a b Global Species
  7. ^ Ruppert, E. E., Fox, R. S., and Barnes, R. D. (2004). Invertebrate Zoology. Brooks/Cole.
  8. ^ The motile escape response of a sessile prey: A sponge-scallop mutualism
  9. ^ Aquaculture of sponges on scallops for natural products research and antifouling.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!