Overview

Distribution

Pollicipes polymerus is found from the southern region of Alaska to Baja, California (Lane C.C., 2000).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Pollicipes polymerus can be distinguished by its long neck, or stalk. This part of its body is usually 1 inch long. It ranges in color from reddish-brown to brownish-black. The stalk has a leathery appearance with a texture of small bumps. The shell, or capitulum, of P. polymerus grows to be about 2 inches long. It is made up of small plates which enclose its soft body. Inside the shell, the barnacle primarily consists of long segmented legs, intestines, and stomach. The gonads are held within the stalk. The stalk also contains the gland which is used to produce the adhesive that allows barnacles to attach to rocks so well. Pollicipes polymerus can reach up to 8 inches in length (Chase, 1997; Abbott et al., 1980).

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Pollicipes polymerus is found on rocky cliffs in the splash zone. They inhabit very high-energy environments because they can withstand the wave pressure very well. They receive minimal exposure to water; at the most, once a day. They are most often found within cracks and crevices in rocks to minimize their exposure to sunlight, which helps prevent desiccation. Pollicipes polymerus is most commonly found in colonies of many other gooseneck barnacles. They often grow on each other. You can find many smaller goosenecks on the stalk of larger ones. Within the colony the larger goosenecks are found in the center surrounded by the smaller ones in the periphery. They are also very likely to be seen amongst California mussel (Mytilus califonianus) beds (Eckman and Duggins, 1993; Hilgard, 1960; Lane C.C., 2000).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 34 samples.

Environmental ranges
  Depth range (m): -1 - 5
  Temperature range (°C): 9.215 - 10.345
  Nitrate (umol/L): 5.774 - 7.622
  Salinity (PPS): 31.235 - 32.028
  Oxygen (ml/l): 6.534 - 6.794
  Phosphate (umol/l): 0.883 - 0.989
  Silicate (umol/l): 12.975 - 20.289

Graphical representation

Depth range (m): -1 - 5

Temperature range (°C): 9.215 - 10.345

Nitrate (umol/L): 5.774 - 7.622

Salinity (PPS): 31.235 - 32.028

Oxygen (ml/l): 6.534 - 6.794

Phosphate (umol/l): 0.883 - 0.989

Silicate (umol/l): 12.975 - 20.289
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pollicipes polymerus is a filter feeder. Since its head is attached to a usually rocky surface, P. polymerus feeds by extending its legs, or cirri, from its "shell". It separates the valves of its shell and extends the feathery cirri into the water when the tide is in, or when water runs down rocks. Pollicipes polymerus often orients itself to face the current. This explains why, when seen, most are facing the same direction. Pollicipes polymerus will eat a variety of food and is not not selective. Most of its diet consists of small organisms such as plankton, cypris larvae, small clams, hydroids, and amphipods. Food is caught in a lassoing action of the cirri. Six pairs of cirri contract and force the food down towards the mouth parts. Catching the food is aided by many small hairs that line the sides of the segmented cirri. These hairs also aid in the movement of food towards the mouth parts. Since food may be hard to come by at times of low tide, Pollicipes polymerus can use some of its cirri to pass food to the mouth while using others to catch and hold onto new prey when food is abundant.

Animal Foods: mollusks; zooplankton

Plant Foods: phytoplankton

Foraging Behavior: filter-feeding

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

P. polymerus is a main food source of Glaucous-winged gulls. The gulls eat them on exposed shores, eating the capitulum and leaving the stalk. They are also a food source for sea stars and whelks (snails)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Pollicipes polymerus is prey of:
Asteroidea
Buccinum
Larus glaucescens

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Pollicipes polymerus preys on:
phytoplankton
zooplankton
Mollusca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Pollicipes polymerus is a hermaphrodite, meaning it is equipped with both male and female reproductive organs. These organs mature at relatively the same rate in the gooseneck barnacles. Although it is hermaphroditic, it usually will not self-fertilize unless there are no other barnacles within about eight inches. It is better for them to cross-breed because it ensures the diversity of their population. Once a female lays eggs, a pheromone is released letting those surrounding males know that she is ready. One barnacle will reach its penis over to a nearby barnacle to release sperm into the shell. Amazingly, it can reach about seven times the animal's diameter. Once the eggs in a neighboring barnacle are fertilized, they are brooded in the mantle cavity. Pollicipes polymerus has a reproductive period of about eight months, and produces about three to four broods (five to seven are possible for a large barnacle.) Thousands of nauplius larvae are then released into the ocean to fend for themselves. These larvae are weak swimmers that spend their time feeding mostly on phytoplankton. Once they reach the cyprid stage they are strong-swimming, non-feeding larvae, with a sole purpose of finding a place to settle. Pollicipes polymerus follow many cues for settlement. Once the cypris larvae have undergone metamorphosis to juvenille barnacles, they will search for a suitable home. They do so by receiving chemical cues from other established barnacles; meaning that there are good conditions. However, this could be a problem when competing for space. They also have to take into consideration the correct temperature, surface texture, and current. All of these factors are crucial for its survival. Gooseneck barnacles are thought to reach maturity at the age of five, and are considered fully grown at the age of twenty (Britannica, 1999-2000; Fox et al., 1997; Hillgard, 1960).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pollicipes polymerus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCGCGACAATGACTATTTTCTACTAATCATAAAGATATTGGAACTTTATATCTAATTTTTGGGGCATGATCAGCGATAGTTGGAACAGCCTTAAGTATACTAATTCGAGCAGAACTAGGTCAACCTGGAAGTTTAATTGGAGACGACCAAATTTATAATGTGATTGTTACTGCCCACGCTTTTATTATAATTTTTTTTATGGTTATGCCTATTATAATTGGGGGATTCGGAAATTGACTTCTACCCTTAATACTGGGAGCTCCAGATATAGCTTTTCCACGTCTCAATAATATAAGATTTTGGTTATTACCCCCTGCCTTAATGTTATTAATTAGAGGATCACTAGTAGAAGCTGGGGCGGGAACTGGATGGACAGTATACCCACCTCTAGCCAGCAATATCGCACACTCAGGAGCCTCTGTAGACCTCTCTATTTTTTCATTACACTTAGCGGGAGCTTCCTCTATTTTAGGAGCTATCAACTTCATATCCACAGTAATTAATATACGAGCTGAAACTTTAACATTCGACCGTTTACCTTTATTTGTATGAAGAGTATTTGTGACGGTGATTCTTCTATTATTATCTTTACCTGTGTTAGCCGGAGCCATTACTATGCTTTTAACTGACCGGAATCTTAATACATCATTTTTCGACCCTACAGGGGGAGGAGACCCTATTTTATACCAACACTTATTCTGATTCTTTGGGCACCCAGAGGTTTACATTCTTATCCTGCCAGCCTTTGGTATAATTTCTCACATCATAGCGAGAGAAAGAGGTAAAAAAGAGTCTTTCGGAACTCTAGGTATAATTTATGCTATCATTGCTATTGGAATCTTAGGATTTGTAGTCTGAGCCCATCACATATTTACGGTAGGAATAGATGTAGATACCCGGGCTTACTTTACCTCCGCCACTATAATCATTGCAGTGCCTACAGGTATTAAAGTATTTAGATGACTAGGAACCTTACACGGTACCCAATTTTCATATAGCCCCCCTCTACTATGAGCACTAGGATTTTTATTTTTATTTACAATTGGAGGGATTACAGGAGTAGTCTTAGCCAATTCGTCCCTAGATATTGTCTTACATGATACTTACTATGTAGTAGCTCATTTCCATTACGTTTTATCAATAGGAGCAGTATTTGGAATTATAGCTGGAGCAGTTTACTGATTTCCTTTATTAACAGGGGTTACCATGAAACCTAAATGGCTTAAAATTCACTTTGGGGCTATGTTTGCAGGTGTTAATATTACATTTTTTCCCCAGCATTTCCTGGGATTAGCAGGTATACCCCGACGATACTCAGATTACCCTGATGCATACACAGCTTGAAATGTGGTGTCCTCGATTGGATCTACGCTATCGTTTATTAGCACACTTGGATTTATTTTTATTGTGTGAGAAGCTATAGTATCACAACGACCAACTGTATTTTCGCAAAATTTATCTTCTAATTTAGAATGGGCCCATACTACTCCTCCTCATTACCATAGCTATGACGAGCTCCCTCAATTTGTAACTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pollicipes polymerus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 63
Specimens with Barcodes: 67
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Pollicipes polymerus is not endangered, and is abundant along the Pacific coast. The only risk of lowering numbers is if the gooseneck barnacles are overused as a food source for humans (Britannica, 1999-2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pollicipes pollicipes is a barnacle that is found in the intertidal of Portugal and Spain. There they are considered a delicacy, and served in gourmet restaurants. Due to local harvesting, their populations become depleted at times. They then seek sources outside of their countries and will then import P. polymerus as a substitute for P. pollicipes, thus bringing in money for the United States (Britannica, 1999-2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pollicipes polymerus

Pollicipes polymerus, commonly known as the gooseneck barnacle or leaf barnacle, is a species of stalked barnacle. It is found, often in great numbers, on rocky shores on the Pacific coasts of North America.

Classification[edit]

Barnacles are classified with shrimps, crabs, isopods and amphipods in the subphylum Crustacea. They are included in the class Maxillopoda, though this class does not appear to be a monophyletic grouping.[3] They are included in the infraclass Cirripedia, the barnacles, members of which are sessile suspension feeders with two active swimming larval stages, the nauplius and the cyprid. The order Pedunculata includes barnacles attached to the substrate by stalks, the goose barnacles. The attachment is made by the cementing of the antennules of the cyprid larvae to the substrate and the elongation of that region into a stalk. Pedunculata is not itself a single monophyletic group but forms a transitional series of lineages moving towards the sessile acorn barnacles.[4] Pollicipes polymerus is included in the family Pollicipedidae.

Description[edit]

Pollicipes polymerus is attached to rocks or other objects by a strong, rubbery stalk, the peduncle, which is up to 10 centimetres (4 in) long. It has a muscular interior and the leathery surface is covered in bands of minute spiny scales on short stalks. The capitulum, at the end of the peduncle, is up to 5 centimetres (2 in) long and contains the rest of the body including all the limbs and other appendages except the first pair of antennae.[5] The outside of the capitulum bears five strengthening calcareous plates corresponding with the plates that protect an acorn barnacle. The largest of these is the carina, on the morphologically dorsal side of the capitulum, with a pair of smaller scuta and terga on either side below. Further calcification occurs from other centres on the capitulum with the formation of many small scales. The thoracic crustacean appendages are modified into feather-like cirri. They project through the aperture at the end of the capitulum and are used for feeding.[4]

Distribution and habitat[edit]

Pollicipes polymerus is found in the north eastern Pacific Ocean, its range extending from southern Alaska to Baja California. It occurs on rocky coasts in the intertidal zone and favours exposed areas where there is much wave action. It tends to occur in closely associated groups and is often abundant.[6]

Biology[edit]

Pollicipes polymerus is an omnivore. It feeds by extending its cirri through the aperture at the end of the capitulum and unfurling them. The posterior three pairs are biramous and form a net to trap particles. They are held at a suitable angle to intercept moving water and are periodically withdrawn into the capitulum with any food items that have been trapped. Here particles are scraped off by the other three, shorter pairs of cirri which have overlapping setae (bristles). The particles are then transported to the mouth where they are manipulated and sorted into edible and inedible items by the maxillae, mandibles and palps. This may be done with the help of chemoreceptors found on the appendages and near the mouth. Examination of the animal's gut contents show that it feeds on copepods, amphipods, barnacle larvae, small clams, polychaete worms and hydrozoans as well as detritus and algae.[7]

Pollicipes polymerus is a hermaphrodite. Reproduction takes place during the summer and there may be several broods per year. The ovaries are in the upper part of the peduncle and liberate from 104,000 to 240,000 eggs at a time into the mantle cavity. Here they stick together to form egg masses. The numerous small testes lie alongside the gut. Sperm from these is passed along the extensible penis into the mantle cavity of an adjoining individual where fertilisation takes place. Self-fertilisation does not seem to occur and any individual that is more than 20 cm (8 in) from its nearest neighbour is effectively sterile.[8] The eggs are brooded for 3 to 4 weeks until they hatch into nauplius larvae and are liberated into the sea.[7] There they become planktonic and feed on phytoplankton. They grow and undergo 6 moults in about 40 days before becoming non-feeding cyprid larvae. These search out suitable places to settle where they undergo metamorphosis and attach themselves permanently to the substrate. They do this by secreting a strong adhesive substance from glands on the antennules. Settlement is stimulated by the presence of peduncles of other gooseneck barnacles, and may take place on the peduncles themselves.[8]

Ecology[edit]

Predators on gooseneck barnacles include the glaucous-winged gull (Larus glaucescens), the black oystercatcher (Haematopus bachmani), the ochre sea star (Pisaster ochraceus) and the six-rayed star, Leptasterias hexactis.[6][7]

A research study undertaken by Robert T. Paine in Makah Bay, Washington State in 1966[9] showed the importance of predators in maintaining a biodiverse community. Paine excluded the ochre sea star from an area of seabed where gooseneck barnacles and sea mussels (Mytilus californianus) predominated and found that the number of invertebrate species associated with them fell from fifteen to eight. Paine proposed the hypothesis that "Local species diversity is directly related to the efficiency with which predators prevent the monopolization of the major environmental requisites by one species".[10]

The distribution of both gooseneck barnacles and sea mussels is quite patchy. In an effort to understand this better, another study, undertaken by Wooten in 1994, excluded birds from an area where these two species were found on Tatoosh Island, Washington. In a carefully designed series of experiments they recorded the direct and indirect results on the numbers of goose barnacles, sea mussels, acorn barnacles, starfish and predatory whelks (Nucella spp.) present in the area. Their results demonstrated the important part that predation by birds can play in the dynamics of invertebrate populations.[7]

Gooseneck barnacles compete with a number of other organisms in a complex struggle for survival in the limited available space in their rocky intertidal habitat. The first colonisers of bare rock are usually annual algae, soon to be followed by perennial species including coralline algae. Gooseneck barnacles, sea mussels and several species of acorn barnacles soon follow. Further competition is provided by sea palms, the large holdfasts of which may smother or squeeze out the molluscs and barnacles. Sea palms may settle on the mussels and may be carried away in storms, taking the mussels with them. Gooseneck barnacles may limit the colonisation of mussel recruits by feeding on their larvae. In areas where gooseneck barnacles predominate they may dominate until some are swept away in storms and allow in other species. In the long term, the mussels usually come to dominate as their byssal threads are able to overgrow all the other sessile organisms.[11]

References[edit]

  1. ^ Benny K. K. Chan (2010). "Pollicipes polymerus (Sowerby, 1883)". World Register of Marine Species. Retrieved February 1, 2012. 
  2. ^ Pollicipes polymerus (Goose Neck Barnacle) ZipcodeZoo. Retrieved February 2, 2012.
  3. ^ Joel W. Martin & George E. Davis (2001). An Updated Classification of the Recent Crustacea (PDF). Natural History Museum of Los Angeles County. pp. 1–132. 
  4. ^ a b Frederick R. Schram. "Cirripedia". Access Science. Retrieved February 2, 2012. 
  5. ^ Pollicipes polymerus Race Rocks. Retrieved February 1, 2012.
  6. ^ a b Melissa McFadden, Hans Helmstetler & Dave Cowles (2007). "Mitella polymerus (Sowerby, 1833); Goose Neck Barnacle, Leaf Barnacle". Invertebrates of the Salish Sea. Walla Walla University. Retrieved February 2, 2012. 
  7. ^ a b c d "About goose barnacles". A Snail's Odyssey. Retrieved February 1, 2012. 
  8. ^ a b Galen H. Hilgard (1960). "A study of reproduction in the intertidal barnacle, Mitella polymerus, in Monterey Bay, California" (PDF). The Biological Bulletin 119 (2): 169–188. 
  9. ^ Robert T. Paine (1966). "Food web complexity and species diversity" (PDF). The American Naturalist 100 (910): 65–75. doi:10.1086/282400. JSTOR 2459379. 
  10. ^ Michael Begon, Martin Mortimer & David J. Thompson (1996). "Beyond population ecology". Population Ecology: a Unified Study of Animals and Plants (3rd ed.). John Wiley & Sons. p. 217. ISBN 978-0-632-03478-9. 
  11. ^ Paul K. Dayton (1971). "Competition, disturbance, and community organization: the provision and subsequent utilization of space in a rocky intertidal community". Ecological Monographs 41 (4): 351–389. doi:10.2307/1948498. JSTOR 1948498. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!