Overview

Brief Summary

Introduction

A very diverse Palearctic blue genus. The taxonomy of the group is controversial, and many new species, particularly from central Asia, have been described in the past 30 years. Closely-related taxa are differentiated in some instances by chromosomal characters (Lukhtanov et al. 2005). The list here indicates species groups as delineated by Savela, and should be regarded as tentative.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Higgins’s Anomalous Blue occurs locally in mountains in northern Greece and rarely in bordering mountainous area of southern Bulgaria. It occurs mostly between 1,500-2,000 m, sometimes at lower altitudes. This is a European endemic species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species only occurs in the Valle d'Aosta in the Italian Alps, where there are at most five populations. It occurs at 800-1,000 m elevation, sometimes as high as 1,600 m. The area of occupancy (AOO) is less than 10 km² and the extent of occurrence (EOO) is less than 5,000 km². This is a European endemic species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Only occurs in northern Spain (from the Cantabrian Mountains to Catalonia). Found at altitudes from 600-1,800 m. This is a European endemic species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Only occurs in central Spain in the vicinity of Teruel, Cuenca and Guadalajara, particularly in the Montes Universales. Found at altitudes from 900-1,800 m. This is a European endemic species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Occurs in the mountains of the north, west and south of Greece. It is also found in the south of Bulgaria (where it is rare). Found at altitudes from 400-2,000 m, mostly below 1,500 m. This is a European endemic species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Higgins’s Anomalous Blue is a mountain butterfly, found above the tree-line on flower-rich, calcareous grasslands. The males tend to roam outside their usual habitat. Onobrychis montana ssp. scardica, a sainfoin that only grows in the Balkans, is used as foodplant. The caterpillars hibernate when they are still small, the following spring feeding on the young leaves of the sainfoin (an Eurasian perennial herb). They are often found with ants. Higgins’s Anomalous Blue has one generation a year. Habitats: mesophile grasslands (33%), screes (33%), dry calcareous grasslands and steppes (33%).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Piedmont Anomalous Blue occurs on warm, dry, rocky slopes with groups of bushes and patches of grassy, species-rich vegetation, where nectar is abundant. The female lays its eggs on Mountain Sainfoin (Onobrychis montana) and Sainfoin (O. viciifolia). The caterpillars feed on the flowers and when still small, hibernate. In spring, they are attended by ants. Detailed habitat descriptions are not available.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This butterfly used to be considered a sub-species of the Furry Blue (P. dolus), but there is a clear difference in the number of chromosomes of each species. However, the life cycles and choice of biotope are the same. Eggs are laid on Sainfoin (Onobrychis viciifolia). The caterpillars are frequently attended by ants. This butterfly hibernates when the caterpillar is still small. It has one generation a year. Habitats: dry calcareous grasslands and steppes (100%).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This Chalkhill Blue is always found on calcareous soil and occurs on short vegetation in sheltered hollows in clearings in coniferous forests. The female lays its eggs on the leaves of Horseshoe Vetch (Hippocrepis comosa). This butterfly species is single-brooded. It hibernates as an egg or as a very young caterpillar of the first larval instar. Feeding starts only in spring after hibernation. Detailed habitat descriptions are not available.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Grecian Anomalous Blue occurs on dry grassland, in dry scrub, on rocky slopes and also sometimes on woodland rides or in clearings in the woods. The female lays its eggs on the flowers of the sainfoin Onobrychis arenaria. The caterpillars feed on the flower heads and are attended by various ant species, amongst others Camponotus gestroi and Crematogaster sordidula. The Grecian Anomalous Blue has one generation a year and hibernates in the larval stage. Habitats: sclerophyllous scrub (33%), dry calcareous grasslands and steppes (33%), screes (33%).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Discussion of Phylogenetic Relationships

View Polyommatus Tree

The resolved part of the subgenus Agrodiaetus is based on a parsimony analysis of mtDNA COI-COII data by Kandul et al. (2004, their Fig. 1). Traditional species groups, as well as a number of "species," were found to be paraphyletic in that analysis. The remaining species in Agrodiaetus were not included in their study and should be viewed as incertae sedis. Composition of the other subgenera is likewise based on traditional classifications and may not reflect natural groups.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 893
Specimens with Sequences: 798
Specimens with Barcodes: 772
Species: 79
Species With Barcodes: 75
Public Records: 321
Public Species: 60
Public BINs: 29
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus damon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus bellargus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Polyommatus humedasae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus humedasae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus AS01BY

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus fabressei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus fulgens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Polyommatus ripartii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Polyommatus damon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATAGGAACATCTTTAAGAATTTTAATTCGTATAGAATTGAGAACTCCTGGATCCTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGTAACTGATTAGTTCCTTTAATATTAGGGGCACCTGATATAGCCTTTCCACGATTAAATAATATAAGATTCTGATTATTACCCCCATCATTAATACTTCTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATAGAGGATCATCTGTAGATTTAACAATTTTCTCACTTCATTTGGCGGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAACATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTTTTATCCTTACCTGTATTAGCTGGTGCAATTACCATATTATTAACTGATCGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
van Swaay, C., Wynhoff, I., Verovnik, R., Wiemers, M., López Munguira, M., Maes, D., Sasic, M., Verstrael, T., Warren, M. & Settele, J.

Reviewer/s
Lewis, O. (Butterfly RLA) & Cuttelod, A. (IUCN Red List Unit)

Contributor/s

Justification
A European endemic, only occurring in the border area of Bulgaria and Greece. The extent of occurrence (EOO) is less than 5000 km² and the area of occupancy (AOO) is less than100 km². There are probably fewer than 10 locations. No information on trends or fluctuations is available, and the species is therefore classified as Near Threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B1ab(iii,v)+2ab(iii,v)

Version
3.1

Year Assessed
2010

Assessor/s
van Swaay, C., Wynhoff, I., Verovnik, R., Wiemers, M., López Munguira, M., Maes, D., Sasic, M., Verstrael, T., Warren, M. & Settele, J.

Reviewer/s
Lewis, O. (Butterfly RLA) & Cuttelod, A. (IUCN Red List Unit)

Contributor/s

Justification
This is an endemic species from the northwest of Italy (Aosta), where it is only found at three locations. The area of occupancy (AOO) is less than 10 km² and the species is reported to be declining. Therefore this species is classified as Endangered at the European and EU27 level.

History
  • 1996
    Critically Endangered
    (Baillie and Groombridge 1996)
  • 1996
    Critically Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
van Swaay, C., Wynhoff, I., Verovnik, R., Wiemers, M., López Munguira, M., Maes, D., Sasic, M., Verstrael, T., Warren, M. & Settele, J.

Reviewer/s
Lewis, O. (Butterfly RLA) & Cuttelod, A. (IUCN Red List Unit)

Contributor/s

Justification
This species is listed as Least Concern, since it has not been declining by more than 25% in the last ten years and its population size is probably larger than 10,000 adult individuals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
van Swaay, C., Wynhoff, I., Verovnik, R., Wiemers, M., López Munguira, M., Maes, D., Sasic, M., Verstrael, T., Warren, M. & Settele, J.

Reviewer/s
Lewis, O. (Butterfly RLA) & Cuttelod, A. (IUCN Red List Unit)

Contributor/s

Justification
This species is listed as Least Concern, since it has not been declining by more than 25% in the last ten years and its population size is probably larger than 10,000 adult individuals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
van Swaay, C., Wynhoff, I., Verovnik, R., Wiemers, M., López Munguira, M., Maes, D., Sasic, M., Verstrael, T., Warren, M. & Settele, J.

Reviewer/s
Lewis, O. (Butterfly RLA) & Cuttelod, A. (IUCN Red List Unit)

Contributor/s

Justification
This species is listed as Least Concern, since it has not been declining by more than 25% in the last ten years, its European extent of occurrence (EOO) is larger than 20,000km² and its population size is probably larger than 10,000 adult individuals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A local species, restricted to (semi-) natural areas.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a local species, restricted to (semi-) natural areas. Declines in distribution or population size of 6-30% have been reported (data provided by the national partners of Butterfly Conservation Europe).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A local species, restricted to (semi-) natural areas.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A local species, restricted to (semi-) natural areas in Central Spain.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A local species, restricted to (semi-) natural areas.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Probably threatened by intensified grazing, abandonment and wildfires, but much is still unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The species has a restricted range and very limited dispersal possibilities. The main direct threats come from grassland abandonment, causing shrubs and trees to invade the habitat. It is uncertain whether trade in collected specimens is an additional threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Although this is a European endemic with a restricted range, this species is not believed to face major threats at the European level.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Although a rare endemic, this species is not believed to face major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
This species is not believed to face major threats at the European level.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
More research is needed on the distribution and ecology of the species. Suitable habitats should be protected and appropriately managed. The effects of conservation actions should be monitored by a Butterfly Monitoring Scheme. In Bulgaria, the species only occurs in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Using a butterfly-net is strictly forbidden in the Pondel-site, which supports the main population. Controls appear to be very efficient. The remaining sites should be well managed and the species should be monitored by a Butterfly Monitoring Scheme. The species is listed on the Bern Convention Annex 2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
This species occurs in a number of protected areas across its range. No specific conservation actions are needed at a European level. But since it has a restricted global range, its distribution and trend should be monitored closely, for example by Butterfly Monitoring Schemes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Since this species has a restricted global range, its distribution and trend should be monitored closely monitored closely, for example by a Butterfly Monitoring Scheme. Research is needed on its ecology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
It is important to keep open dry clearings at montane-subalpine levels (Lafranchis et al., 2007). In Bulgaria, the species only occurs in protected areas. Since it has a restricted global range, its distribution and trend should be monitored closely, for example by Butterfly Monitoring Schemes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Polyommatus

Polyommatus is a diverse genus of butterflies.The members (species) are found in the Palearctic ecozone. Recent molecular studies have demonstrate that Cyaniris and Lysandra are different genera to the genus Polyommatus, genus where were included so far.

List of species[edit]

Synonyms[edit]

  • Nomiades Hübner, [1819]
  • Hirsutina Tutt, 1909
  • Bryna Evans, 1912
  • Uranops Hemming, 1929
  • Paragrodiaetus Rose & Schurian, 1977
  • Glaucolinea Wang & Rehn
  • ...

Subgenera[edit]

  • Polyommatus
  • Agrodiaetus Hübner, 1822
  • Meleageria Sagarra, 1925
  • Plebicula Higgins, 1969
  • Neolysandra Koçak, 1977
  • ...

References[edit]

  • Talavera, G, Lukhtanov, V.A.,Pierce, N.E. & Vila, R. (2012): Establishing criteria for higher-level classification using molecular data: the systematics of Polyommatus blue butterflies (Lepidoptera, Lycaenidae). Cladistics. 10.1111/j.1096-0031.2012.00421.x
  • Talavera, G., Lukhtanov, V.A., Rieppel, L., Pierce, N.E. & Vila, R. (2013): In the shadow of phylogenetic uncertainty: The recent diversification of Lysandra butterflies through chromosomal change. Molecular Phylogenetics and Evolution 69: 469–478.
  • Vila, R., Lukhtanov, V.A., Talavera, G., Gil-T., F. & Pierce, N.E. (2010): "How common are dot-like distributions? Taxonomical oversplitting in western European Agrodiaetus (Lepidoptera: Lycaenidae) revealed by chromosomal and molecular markers.Biol. J. Linn. Soc. Lond 101:130-154 (2010) [1]
  1. ^ Polyommatus, funet.fi
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Polyommatus albicans

The Spanish Chalk-hill Blue (Polyommatus albicans) is a butterfly of the Lycaenidae family. It is found in Spain and Western North Africa.[1]

The length of the forewings is 18–21 mm. The butterfly flies from June to August.

The larvae feed on Horseshoe Vetch.

References[edit source | edit]

  1. ^ Mensi, Paola; Lattes, Aldo; Salvidio, Sebastiano; Balletto, Emilio (1988). "Taxonomy, evolutionary biology and biogeography of South West European Polyommatus coridon (Lepidoptera: Lycaenidae)". Zoological Journal of the Linnean Society 93 (3): 259–271. doi:10.1111/j.1096-3642.1988.tb01363.x. ISSN 00244082. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!