Typhlonectes natans — Details

Rubber Eel learn more about names for this taxon

Overview

Distribution

Range Description

Learn more about this article

This species ranges from the drainage systems of the Cauca and Magdalena rivers in western and northern Colombia to the general vicinity of Lake Maracaibo Basin in Venezuela. It occurs up to 1,000m asl. Suggestions of its occurrence in the Orinoco River, and from Trinidad require confirmation, and are not included here.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology
It is an aquatic species, living in rivers, marshes and lakes, usually in open areas, and is only rarely found on land. It is thrives in polluted water, and is resilient to major degradation of water quality. It is oviviparous, giving birth to young in water.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Learn more about this article

Observations: The record longevity in captivity of these animals is 4.1 years (http://www.pondturtle.com/). This value is most likely underestimated to a large degree and there are anecdotal reports that these animals can live up to 20 years in captivity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Typhlonectes natans

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0398-06|NC_002471|Typhlonectes natans| ACTCGTTGATTATTTTCAACAAATCACAAAGACATCGGCACCCTTTACCTAGTATTTGGTGCCTGAGCAGGAATAGTCGGCACCGCCCTA---AGCCTTCTTATTCGGGCCGAGCTGAGTCAGCCGGGCACCTTGCTTGGAGAT---GACCAGATTTACAACGTTGTTGTAACCGCCCACGCCTTTATTATAATCTTTTTTATGGTCATACCGATTATGCTAGGCGGGTTTGGGAACTGGCTAGTCCCACTAATA---CTTGGGGCCCCCGATATGGCCTTCCCCCGTATGAATAATATAAGCTTCTGACTGCTGCCCCCCTCACTCCTGCTCTTACTAGCATCCTCTGGAGTAGAGGCAGGAGCTGGTACTGGTTGAACTGTTTATCCCCCCCTTGCCGGAAATCTTGCCCATGCCGGAGCCTCAGTCGACCTG---ACCATCTTCTCCTTGCACCTGGCCGGAGTCTCATCAATTCTCGGCGCAATTAACTTCATTACAACAATTATTAACATAAAGCCCCCCGTGCTATCCCAATACCAAACTCCCCTGTTCGTATGGTCCATTATAATTACCGCCGTGCTACTTCTACTGTCTCTCCCAGTACTCGCCGCG---GGTATCACCATACTCCTCACAGATCGTAATTTAAACACCACCTTCTTCGACCCCGCGGGGGGAGGGGACCCGATCCTTTACCAACACCTATTTTGATTCTTCGGACACCCCGAGGTCTATATCCTTATCTTGCCTGGATTTGGTATAATCTCCCACATTGTTACCTACTACGCAGGTAAAAAA---GAACCATTTGGCTATATAGGAATGGTCTGGGCAATGATGTCAATTGGGCTGCTTGGTTTTATCGTATGAGCCCACCATATATTTACCGTCGGCCTAA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Typhlonectes natans

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Abraham Mijares, Fernando Castro, John Measey, Mark Wilkinson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of significant habitat degradation, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Population

Learn more about this article

Population
It is a very common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Threats

Threats

Learn more about this article

Major Threats
It is extremely resilient to habitat and degradation and pollution, both of which are extensive within its range. It is popular in the international pet trade, but not at a level to constitute a threat to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
It occurs in some protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Typhlonectes natans

Learn more about this article

Typhlonectes natans, also called the Rubber Eel, is a species of caecilian in the family Caeciliidae. It is found in Colombia, Venezuela, and possibly Trinidad and Tobago. Its natural habitats are dry savanna, subtropical or tropical dry shrubland, subtropical or tropical moist shrubland, subtropical or tropical seasonally wet or flooded lowland grassland, and rivers. The rubber eel is commonly kept as an aquarium pet, and is sometimes sold as a "fish" in aquarium stores.

They grow to 45 to 55 cm in length. They are dark grey- black in color. While T. natans can and occasionally does breath air at the surface, most of the respiration takes place through its skin.

The species is oviviparous, giving birth to young in water. The gestation period lasts app. 220 days. 3-7 live, fully developed young are born, which after only one year reach almost half the size of an adult (25 cm).

References


Stub iconThis Caeciliidae article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!