Overview

Comprehensive Description

Description

Adult males are slightly smaller than the females, ranging from 58-91 mm in total length and averaging 73 mm. Adult females range from 64-90 mm and average 78 mm. The largest individual on record is 122 mm (Bishop 1943).

The red-backed phase of this species is characterized by a broad, dorsal band running down the midline from the head onto the tail. The color of the stripe varies from light gray or dull yellow to pink, brick-red, and bright red. There are often small flecks of black within the band. The sides are dark gray or black, becoming lighter and mottled toward the belly, which is strongly mottled with white and gray. In contrast, the lead-backed phase lacks the dorsal band and is uniformly dark gray to almost black, with the head and legs usually lighter (Bishop 1943). There is also an erythristic color phase that is mostly red, apparently to mimic juvenile Notophthalmus viridescens (Tilley et al. 1982). Juveniles of the red-backed phase have a well developed dorsal band and the upper sides are strongly pigmented (Bishop 1943)

The body is long and fairly slender, is slightly flattened dorsally, and is well rounded on the sides. The cross section of the tail is nearly circular throughout its length. Regenerating tails are flattened laterally and are usually uniform dark gray. Number of costal grooves ranges from 17 to 20, but there are usually 18 or 19. The gular fold is prominent. The legs are small with short, thick toes. There are four fingers, which in order from longest to shortest are 3-2-4-1. The five toes are slightly webbed, and are 3-4-2-5-1 in order from longest to shortest. The vomerine teeth form two backward-curving lines of 5-7 teeth separated from each other and from the parasphenoid teeth, which are in two imperfectly separated patches. The mouth is fairly large, with the angle of the jaw behind the eye. The small tongue does not fill the floor of the mouth. Males can be identified when in breeding condition by swollen snout, enlarged premaxillary teeth, and proportionally longer legs (Bishop 1943). Black testes can also be seen through the abdominal wall when transiluminated by a strong light (Jaeger et al. 2002a).

As is the case for all members of the genus Plethodon, eggs are laid in terrestrial cavities attended by the female. The larval stage is passed within the egg capsule. The broad, flat, leaf-like gills rise from a common base, are often fully developed at hatching, and then persist for only a few days (Bishop 1943). Embryos average about 19 mm upon hatching and individuals less than 32 mm in snout-vent length are considered to be juveniles (Bishop 1943; Jaeger et al. 2002a). Juveniles have proportionately broad heads, which allows them to forage on a wide range of prey (Maglia 1996). The fingers and toes of the juveniles are well indicated, the inner and outer short (Bishop 1943).
 
While populations from the formerly glaciated part of the range are very uniform, allozyme studies show that when its entire range is considered, P. cinereus consists of four genetically differentiated geographic groups with within-group D-values ranging from 0-0.15 and between-group D-values ranging from 0.02-0.24. This indicates that the groups living in the unglaciated localities have been isolated from each other for 1.5-2.7 million years, and that populations from formerly glaciated areas are all descended from the same group. Despite their long divergence, there is still extensive gene flow between the groups at the points where they contact one another (Highton and Webster 1976; Highton 2000).

  • Highton, R. (2000). ''Detecting cryptic species using allozyme data.'' The Biology of Plethodontid Salamanders. R.C. Bruce, R.G. Jaeger, and L.D. Houck, eds., Kluwer Academic/Plenum Publishers, New York, New York, 215-241.
  • Conant, R. and Collins, J.T. (1998). A Field Guide to Reptiles and Amphibians of Eastern and Central North America. 3rd Edition. Houghton Mifflin Company, Boston, Massachusetts.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
  • Alford, R.A., and Richards, S.J. (1999). ''Global amphibian declines: A problem in applied ecology.'' Annual Review of Ecology and Systematics, 30, 133-65.
  • Anthony, C. D., Venesky, M. D., and Hickerson, C. A. M. (2008). ''Ecological separation in a polymorphic terrestrial salamander.'' Journal of Animal Ecology, 77, 646-653.
  • Bazar, M. A., Quinn, M. J., Jr., Mozzachio, K., Bleiler, J. A., Archer, C. R., Phillips, C. T., and Johnson, M. S. (2008). ''Toxicological responses of red-backed salamanders (Plethodon cinereus) to soil exposures of copper.'' Archives of Environmental Contamination and Toxicology, 57, 116-122.
  • Becker, M. H., and Harris, R. N. (2010). ''Cutaneous bacteria of the redback salamander prevent mortality associated with a lethal disease.'' PLoS One, 5(6), e10957.
  • Bergeron, C. M., Bodinof, C. M., Unrine, J. M., and Hopkins, W. A. (2010). ''Mercury accumulation along a contamination gradient and nondestructive indices of bioaccumulation in amphibians.'' Environmental Toxicology and Chemistry, 29, 980-988.
  • Brodie, E. D., Jr., and Brodie, E. D. III (1980). ''Differential avoidance of mimetic salamanders by free-ranging birds.'' Science, 208, 181-182.
  • Bruce, R. C. (2008). ''Intraguild interactions and population regulation in plethodontid salamanders.'' Herpetological Monographs, 2008, 31-53.
  • Brucker, R. M., Baylor, C. M., Walters, R. L., Lauer, A., Harris, R. N., and Minbiole, K. P. C. (2008). ''The identification of 2,4-diacetylphloroglucinol as an antifungal metabolite produced by cutaneous bacteria of the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 43, 39-43.
  • Brucker, R. M., Harris, R. N., Schwantes, C. R., Gallaher, T. N., Flaherty, D. C., Lam, B. A., and Minbiole, K. B. C. (2008). ''Amphibian chemical defense: Antifungal metabolites of the microsymbiont Janthinobacterium lividum on the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 34, 1422-1429.
  • Burton, T.M. (1975). ''Salamander populations and biomass in the Hubbard Brook Experimental Forest, New Hampshire.'' Copeia, 1975(3), 541-546.
  • Cabe, P. R., Page, R. B., Hanlon, T. J., Aldrich, M. E., Connors, L., and Marsh, D. M. (2007). ''Fine-scale population differentiation and gene flow in a terrestrial salamander (Plethodon cinereus) living in a continuous habitat.'' Heredity, 98, 53-60.
  • Cassell, R. W., and Jones, M. P. (2005). ''Syntopic occurrence of the erythristic morph of Plethodon cinereus and Notophthalmus viridescens in Pennsylvania.'' Northeastern Naturalist, 12, 169-172.
  • Davis, A. K. (2010). ''Lead-phase and red-stripe color morphs of red-backed salamanders Plethodon cinereus differ in hematological stress indices: A consequence of differential predation pressure?'' Current Zoology, 56, 238-243.
  • Deitloff, J., Adams, D. C., Olechnowski, B. F. M., and Jaeger, R. G. (2008). ''Interspecific aggression in Ohio Plethodon: implications for competition.'' Herpetologica, 64, 180-188.
  • Ducey, P.K., Schramm, K., and Cambry, N. (1994). ''Interspecific aggression between the sympatric salamanders, Ambystoma maculatum and Plethodon cinereus.'' American Midland Naturalist, 131, 320-329.
  • Fitzpatrick, B. M., Shook, K., and Izally, R. (2009). ''Frequency-dependent selection by wild birds promotes polymorphism in model salamanders.'' BMC Ecology, 9, 12.
  • Gabor, C.R., and Jaeger, R.G. (1995). ''Resource quality affects the agonistic bevariour of territorial salamanders.'' Animal Behavior, 49, 71-79.
  • Gabor, C.R., and Jaeger, R.G. (1999). ''When salamanders misrepresent threat signals.'' Copeia, 1999(4), 1123-1126.
  • Gillette, J. R., Jaeger, R.G., and Peterson, M.G. (2000). ''Social monogamy in a territorial salamander.'' Animal Behavior, 59, 1241-1250.
  • Griffis, M. R., and Jaeger, R. G. (1998). ''Competition leads to an extinction-prone species of salamander: interspecific territoriality in a metapopulation.'' Ecology, 79, 2494-2502.
  • Grover, M. C. (2000). ''Determinants of salamander distributions along moisture gradients.'' Copeia, 2000, 156-168.
  • Grover, M. C., and Wilbur, H. M. (2002). ''Ecology of ecotones: interactions between salamanders on a complex environmental gradient.'' Ecology , 83, 2112-2123.
  • Grover, M.C. (1998). ''Influence of cover and moisture on abundances of the terrestrial salamanders Plethodon cinereus and Plethodon glutinosis.'' Journal of Herpetology, 32, 489-497.
  • Grover, M.C. and Wilbur, H.M. (2002). ''Ecology of ectones: interactions between salamanders on a complex environmental gradient.'' Ecology, 83, 2112-2123.
  • Hairston, N.G. (1996). Long-term studies of vertebrate communities. Academic Press, New York, NY.
  • Harris, R. N., Brucker, R. M., Walke, J. B., Becker, M. H., Schwantes, C. R., Flaherty, D. C., Lam, B. A., Woodhams, D. C., Briggs, C. J., Vredenburg, V. T., and Minbiole, K. P. C. (2009). ''Skin microbes on frogs prevent morbidity and mortality caused by a lethal skin fungus.'' The ISME Journal, 3, 818-824.
  • Harris, R. N., Lauer, A., and Simon, M. A. (2009). '' Addition of antifungal skin bacteria to salamanders ameliorates the effects of chytridiomycosis.'' Diseases of Aquatic Organisms, 83, 11-16.
  • Highton, R. (1959). ''The inheritance of the color phases of Plethodon cinereus.'' Copeia, 1959(1), 33-37.
  • Highton, R. (1975). ''Geographic variation in genetic dominance of the color morphs of the red-backed salamander, Plethodon cinereus.'' Genetics, 80, 363-374.
  • Highton, R. (1995). ''Speciation in eastern North American salamanders of the genus Plethodon.'' Annual Review of Ecology and Systematics, 26, 579-600.
  • Highton, R. (1999). ''Geographic protein variation and speciation in the salamanders of the Plethodon cinereus group with the description of two new species.'' Herpetologica, 55, 43-90.
  • Highton, R., and Webster, T.P. (1976). ''Geographic protein variation and divergence in populations of the salamander Plethodon cinereus.'' Evolution, 30, 33-45.
  • Jaeger, R.G. (1978). ''Plant climbing by salamanders periodic availability of plant dwelling prey.'' Copeia, 1978(4), 686-691.
  • Jaeger, R.G. (1979). ''Season spatial distribution of the terrestrial salamander Plethodon cinereus.'' Herpetologica, 35, 90-93.
  • Jaeger, R.G. (1980). ''Density-dependent and density-independent causes of extinction of a salamander population.'' Evolution, 34, 617-621.
  • Jaeger, R.G. (1980). ''Fluctuations in prey availability and food limitation for a terrestrial salamander Plethodon cinereus.'' Oecologia, 44, 335-341.
  • Jaeger, R.G. (1981). ''Dear enemy recognition and the costs of aggression between salamanders.'' Animal Behavior, 29, 1100-1105.
  • Jaeger, R.G. (1981). ''Foraging tactics of a terrestrial salamander Plethodon cinereus choice of diet in structurally simple environments.'' American Naturalist, 117, 639-664.
  • Jaeger, R.G. (1984). ''Agonistic behavior of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1984(2), 309-314.
  • Jaeger, R.G. and M.G. Peterson (2002). ''Familiarity affects agonistic interactions between female Red-Backed Salamanders.'' Copeia, 2002(3), 865-869.
  • Jaeger, R.G., Gabor, R.C., and Wilbur, H.M. (1998). ''An assemblage of salamanders in the southern Appalachian mountains: competitive and predatory behavior.'' Behavior, 135, 795-821.
  • Jaeger, R.G., Gillette, J.R., and Cooper, R.C. (2002). ''Sexual coercion in a territorial salamander: males punish socially polyandrous female partners.'' Animal Behavior, 63, 871-877.
  • Jaeger, R.G., Goy, J., Tarver, M., and Marqez, C. (1986). ''Salamander Plethodon cinereus territoriality pheromonal markers as advertisement by males.'' Animal Behavior, 34, 860-864.
  • Jaeger, R.G., Kalvarsky, D., and Shimizu, N. (1982). ''Territorial behavior of the Red-Backed Salamander Plethodon cinereus expulsion of intruders.'' Animal Behavior, 30, 490-496.
  • Jaeger, R.G., Prosen, E.D., and Adams, D.C. (2002). ''Character displacement and aggression in two species of terrestrial salamanders.'' Copeia, 2002(2), 391-401.
  • Jaeger, R.G., Schwarz, J., and Wise, S.E. (1995). ''Territorial male salamanders have foraging tactics attractive to gravid females.'' Animal Behavior, 49, 633-639.
  • Jaeger, R.G., Wicknick, J.A., Griffis, M.R., and Anthony, C.D. (1995). ''Socioecology of a terrestrial salamander: juveniles enter adult territories during stressful foraging periods.'' Ecology, 76, 533-543.
  • Jaeger, R.G., and Rubin, A.M. (1982). ''Foraging tactics of a terrestrial salamander judging prey profitability.'' Journal of Animal Ecology, 51, 167-176.
  • Kleeberger, S.R. and Werner, J.K. (1982). ''Home range and homing behavior of Plethodon cinereus in northern Michigan.'' Copeia, 1982(2), 409-415.
  • Lang, C. and R.G. Jaeger (2000). ''Defense of territories by male-female pairs in the Red-Backed Salamander (Plethodon cinereus).'' Copeia, 2000(1), 169-177.
  • Lauer, A., Simon, M. A., Banning, J. L., André, E., Duncan, K., and Harris, R. N. (2007). ''Common cutaneous bacteria from the eastern red-backed salamander can inhibit pathogenic fungi.'' Copeia, 2007, 630-640.
  • Maerz, J. C., Nuzzo, V. A., and Blossey, B. (2009). ''Declines in woodland salamander abundance associated with non-native earthworm and plant invasions.'' Conservation Biology, 23, 975-981.
  • Maglia, A.M. (1996). ''Ontogeny and feeding ecology of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1996(3), 576-586.
  • Mathis, A. (1990). ''Territoriality in a terrestrial salamander the influence of resource quality and body size.'' Behavior, 112, 162-175.
  • Mitchell, J.C. and Woolcott, W.S. (1985). ''Observations of the microdistribution diet and predator-prey size relationships in the salamander Plethodon cinereus from the Virginia Piedmont.'' Virginia Journal of Science, 36, 281-288.
  • Moore, J.-D., and Wyman, R. L. (2010). ''Eastern red-backed salamanders (Plethodon cinereus) in a highly acid forest soil.'' The American Midland Naturalist, 163, 95-105.
  • Moreno, G. (1989). ''Behavioral and physiological differentiation between the color morphs of the salamander Plethodon cinereus.'' Journal of Herpetology, 23, 335-341.
  • Ng, M.V. and Wilbur, H.M. (1995). ''The cost of brooding in Plethodon cinereus.'' Herpetologica, 51, 1-8.
  • Ousterhout, B. H., and Liebgold, E. B. (2010). ''Dispersal versus site tenacity of adult and juvenile red-backed salamanders (Plethodon cinereus).'' Herpetologica, 66, 269-275.
  • Petruzzi, E. E., Niewiarowski, P. H., and Moore, F. B.-G. (2006). ''The role of thermal niche selection in maintenance of a colour polymorphism in redback salamanders (Plethodon cinereus).'' Frontiers in Zoology, 3, 10, doi:10.1186/1742-9994-3-10.
  • Rankin, J. S. (1937). ''An ecological study of parasites of some North Carolina salamanders.'' Ecological Monographs, 7, 169-269.
  • Ransom, T. S. (2010). ''Earthworms, as ecosystem engineers, influence multiple aspects of a salamander’s ecology.'' Oecologia, published online 17 September 2010, DOI: 10.1007/s00442-010-1775-1.
  • Ransom, T. S., and Jaeger, R. G. (2006). ''An assemblage of salamanders in the southern Appalachian Mountains revisited: competitive and predatory behavior.'' Behaviour, 143, 1357-1382.
  • Robertson, J. (2010). ''Mimicry: experimental design and scientific logic.'' An Introduction to Methods and Models in Ecology, Evolution, and Conservation Biology. S. Braude and B. S. Low, eds., Princeton University Press, Princeton, NJ.
  • Simons, R.R., Gelgenhauer, B.E., and Jaeger, R.G. (1994). ''Salamander scent marks: site of production and their role in territorial defence.'' Animal Behavior, 48(11), 97-103.
  • Simons, R.R., Jaeger, R.G., and Gelgenhauer, B.E. (1997). ''Competitor assessment and area defense by territorial salamanders.'' Copeia, 1997(1), 70-76.
  • Takahashi, M. K. and Pauley, T. K. (2010). ''Resource allocation and life history traits of Plethodon cinereus at different elevations.'' The American Midland Naturalist, 163, 87-94.
  • Tilley, S.G., Lundrigan, B.G., and Brower, L.P. (1982). ''Erythrism and mimicry in the salamander Plethodon cinereus.'' Herpetologica, 38, 409-417.
  • Venesky, M. D., and Anthony, C. D. (2007). ''Antipredator adaptations and predator avoidance by two color morphs of the eastern red-backed salamander Plethodon cinereus.'' Herpetologica, 63, 450-458.
  • Woodhams, D. C., Vredenburg, V. T., Simon, M. A., Billheimer, D., Shakhtour B., et al. (2007). ''Symbiotic bacteria contribute to innate immune defenses of the threatened mountain yellow-legged frog, Rana muscosa.'' Biological Conservation, 138, 390-398.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

This species can be found in North America in Minnesota and western Ontario to southern Quebec and Newfoundland, south to North Carolina and northeastern Tennessee (Conant and Collins 1991, Petranka 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Minnesota and western Ontario to southern Quebec and Newfoundland, south to North Carolina and northeastern Tennessee (Conant and Collins 1991, Petranka 1998). Ranges to elevations of at least 4,800 feet (1,463 m) in West Virginia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Plethodon cinereus ranges from the Canadian Maritime provinces and southern Quebec, west to northeastern Minnesota, and south to northern and eastern North Carolina. There is an additional isolated colony in southern North Carolina (Conant and Collins 1998). Three-fourths of this range was under the last continental ice sheet 21,000 years ago, indicating that P. cinereus has the ability to rapidly disperse and has done so in recent biological history (Highton 1995). It has been estimated that the northern range of P. cinereus is expanding at a rate of 80 m per year (Cabe et al. 2007). The erythristic color phase of the species reaches its highest frequencies (20-25%) in northeastern Ohio, the Berkshire and Litchfield Hills, and the Bay of Fundy region (Tilley et al. 1982). Hybridization can occur with congener P. electromorphus, which is found in southwestern Pennsylvania, Ohio, southeastern Indiana, northern Kentucky, and northwestern West Virginia.

Individuals of P. cinereus can be found beneath old logs, bark, moss, leaf mold, and stones in evergreen, mixed, and deciduous forests (Bishop 1943). P. cinereus prefers a moist environment and becomes more abundant and more active upon introduction of seeps (Grover 1998; Grover and Wilbur 2002). It also prefers a higher cover object density, which increases abundance and average body mass by making foraging more effective (Grover 1998).

  • Highton, R. (2000). ''Detecting cryptic species using allozyme data.'' The Biology of Plethodontid Salamanders. R.C. Bruce, R.G. Jaeger, and L.D. Houck, eds., Kluwer Academic/Plenum Publishers, New York, New York, 215-241.
  • Conant, R. and Collins, J.T. (1998). A Field Guide to Reptiles and Amphibians of Eastern and Central North America. 3rd Edition. Houghton Mifflin Company, Boston, Massachusetts.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
  • Alford, R.A., and Richards, S.J. (1999). ''Global amphibian declines: A problem in applied ecology.'' Annual Review of Ecology and Systematics, 30, 133-65.
  • Anthony, C. D., Venesky, M. D., and Hickerson, C. A. M. (2008). ''Ecological separation in a polymorphic terrestrial salamander.'' Journal of Animal Ecology, 77, 646-653.
  • Bazar, M. A., Quinn, M. J., Jr., Mozzachio, K., Bleiler, J. A., Archer, C. R., Phillips, C. T., and Johnson, M. S. (2008). ''Toxicological responses of red-backed salamanders (Plethodon cinereus) to soil exposures of copper.'' Archives of Environmental Contamination and Toxicology, 57, 116-122.
  • Becker, M. H., and Harris, R. N. (2010). ''Cutaneous bacteria of the redback salamander prevent mortality associated with a lethal disease.'' PLoS One, 5(6), e10957.
  • Bergeron, C. M., Bodinof, C. M., Unrine, J. M., and Hopkins, W. A. (2010). ''Mercury accumulation along a contamination gradient and nondestructive indices of bioaccumulation in amphibians.'' Environmental Toxicology and Chemistry, 29, 980-988.
  • Brodie, E. D., Jr., and Brodie, E. D. III (1980). ''Differential avoidance of mimetic salamanders by free-ranging birds.'' Science, 208, 181-182.
  • Bruce, R. C. (2008). ''Intraguild interactions and population regulation in plethodontid salamanders.'' Herpetological Monographs, 2008, 31-53.
  • Brucker, R. M., Baylor, C. M., Walters, R. L., Lauer, A., Harris, R. N., and Minbiole, K. P. C. (2008). ''The identification of 2,4-diacetylphloroglucinol as an antifungal metabolite produced by cutaneous bacteria of the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 43, 39-43.
  • Brucker, R. M., Harris, R. N., Schwantes, C. R., Gallaher, T. N., Flaherty, D. C., Lam, B. A., and Minbiole, K. B. C. (2008). ''Amphibian chemical defense: Antifungal metabolites of the microsymbiont Janthinobacterium lividum on the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 34, 1422-1429.
  • Burton, T.M. (1975). ''Salamander populations and biomass in the Hubbard Brook Experimental Forest, New Hampshire.'' Copeia, 1975(3), 541-546.
  • Cabe, P. R., Page, R. B., Hanlon, T. J., Aldrich, M. E., Connors, L., and Marsh, D. M. (2007). ''Fine-scale population differentiation and gene flow in a terrestrial salamander (Plethodon cinereus) living in a continuous habitat.'' Heredity, 98, 53-60.
  • Cassell, R. W., and Jones, M. P. (2005). ''Syntopic occurrence of the erythristic morph of Plethodon cinereus and Notophthalmus viridescens in Pennsylvania.'' Northeastern Naturalist, 12, 169-172.
  • Davis, A. K. (2010). ''Lead-phase and red-stripe color morphs of red-backed salamanders Plethodon cinereus differ in hematological stress indices: A consequence of differential predation pressure?'' Current Zoology, 56, 238-243.
  • Deitloff, J., Adams, D. C., Olechnowski, B. F. M., and Jaeger, R. G. (2008). ''Interspecific aggression in Ohio Plethodon: implications for competition.'' Herpetologica, 64, 180-188.
  • Ducey, P.K., Schramm, K., and Cambry, N. (1994). ''Interspecific aggression between the sympatric salamanders, Ambystoma maculatum and Plethodon cinereus.'' American Midland Naturalist, 131, 320-329.
  • Fitzpatrick, B. M., Shook, K., and Izally, R. (2009). ''Frequency-dependent selection by wild birds promotes polymorphism in model salamanders.'' BMC Ecology, 9, 12.
  • Gabor, C.R., and Jaeger, R.G. (1995). ''Resource quality affects the agonistic bevariour of territorial salamanders.'' Animal Behavior, 49, 71-79.
  • Gabor, C.R., and Jaeger, R.G. (1999). ''When salamanders misrepresent threat signals.'' Copeia, 1999(4), 1123-1126.
  • Gillette, J. R., Jaeger, R.G., and Peterson, M.G. (2000). ''Social monogamy in a territorial salamander.'' Animal Behavior, 59, 1241-1250.
  • Griffis, M. R., and Jaeger, R. G. (1998). ''Competition leads to an extinction-prone species of salamander: interspecific territoriality in a metapopulation.'' Ecology, 79, 2494-2502.
  • Grover, M. C. (2000). ''Determinants of salamander distributions along moisture gradients.'' Copeia, 2000, 156-168.
  • Grover, M. C., and Wilbur, H. M. (2002). ''Ecology of ecotones: interactions between salamanders on a complex environmental gradient.'' Ecology , 83, 2112-2123.
  • Grover, M.C. (1998). ''Influence of cover and moisture on abundances of the terrestrial salamanders Plethodon cinereus and Plethodon glutinosis.'' Journal of Herpetology, 32, 489-497.
  • Grover, M.C. and Wilbur, H.M. (2002). ''Ecology of ectones: interactions between salamanders on a complex environmental gradient.'' Ecology, 83, 2112-2123.
  • Hairston, N.G. (1996). Long-term studies of vertebrate communities. Academic Press, New York, NY.
  • Harris, R. N., Brucker, R. M., Walke, J. B., Becker, M. H., Schwantes, C. R., Flaherty, D. C., Lam, B. A., Woodhams, D. C., Briggs, C. J., Vredenburg, V. T., and Minbiole, K. P. C. (2009). ''Skin microbes on frogs prevent morbidity and mortality caused by a lethal skin fungus.'' The ISME Journal, 3, 818-824.
  • Harris, R. N., Lauer, A., and Simon, M. A. (2009). '' Addition of antifungal skin bacteria to salamanders ameliorates the effects of chytridiomycosis.'' Diseases of Aquatic Organisms, 83, 11-16.
  • Highton, R. (1959). ''The inheritance of the color phases of Plethodon cinereus.'' Copeia, 1959(1), 33-37.
  • Highton, R. (1975). ''Geographic variation in genetic dominance of the color morphs of the red-backed salamander, Plethodon cinereus.'' Genetics, 80, 363-374.
  • Highton, R. (1995). ''Speciation in eastern North American salamanders of the genus Plethodon.'' Annual Review of Ecology and Systematics, 26, 579-600.
  • Highton, R. (1999). ''Geographic protein variation and speciation in the salamanders of the Plethodon cinereus group with the description of two new species.'' Herpetologica, 55, 43-90.
  • Highton, R., and Webster, T.P. (1976). ''Geographic protein variation and divergence in populations of the salamander Plethodon cinereus.'' Evolution, 30, 33-45.
  • Jaeger, R.G. (1978). ''Plant climbing by salamanders periodic availability of plant dwelling prey.'' Copeia, 1978(4), 686-691.
  • Jaeger, R.G. (1979). ''Season spatial distribution of the terrestrial salamander Plethodon cinereus.'' Herpetologica, 35, 90-93.
  • Jaeger, R.G. (1980). ''Density-dependent and density-independent causes of extinction of a salamander population.'' Evolution, 34, 617-621.
  • Jaeger, R.G. (1980). ''Fluctuations in prey availability and food limitation for a terrestrial salamander Plethodon cinereus.'' Oecologia, 44, 335-341.
  • Jaeger, R.G. (1981). ''Dear enemy recognition and the costs of aggression between salamanders.'' Animal Behavior, 29, 1100-1105.
  • Jaeger, R.G. (1981). ''Foraging tactics of a terrestrial salamander Plethodon cinereus choice of diet in structurally simple environments.'' American Naturalist, 117, 639-664.
  • Jaeger, R.G. (1984). ''Agonistic behavior of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1984(2), 309-314.
  • Jaeger, R.G. and M.G. Peterson (2002). ''Familiarity affects agonistic interactions between female Red-Backed Salamanders.'' Copeia, 2002(3), 865-869.
  • Jaeger, R.G., Gabor, R.C., and Wilbur, H.M. (1998). ''An assemblage of salamanders in the southern Appalachian mountains: competitive and predatory behavior.'' Behavior, 135, 795-821.
  • Jaeger, R.G., Gillette, J.R., and Cooper, R.C. (2002). ''Sexual coercion in a territorial salamander: males punish socially polyandrous female partners.'' Animal Behavior, 63, 871-877.
  • Jaeger, R.G., Goy, J., Tarver, M., and Marqez, C. (1986). ''Salamander Plethodon cinereus territoriality pheromonal markers as advertisement by males.'' Animal Behavior, 34, 860-864.
  • Jaeger, R.G., Kalvarsky, D., and Shimizu, N. (1982). ''Territorial behavior of the Red-Backed Salamander Plethodon cinereus expulsion of intruders.'' Animal Behavior, 30, 490-496.
  • Jaeger, R.G., Prosen, E.D., and Adams, D.C. (2002). ''Character displacement and aggression in two species of terrestrial salamanders.'' Copeia, 2002(2), 391-401.
  • Jaeger, R.G., Schwarz, J., and Wise, S.E. (1995). ''Territorial male salamanders have foraging tactics attractive to gravid females.'' Animal Behavior, 49, 633-639.
  • Jaeger, R.G., Wicknick, J.A., Griffis, M.R., and Anthony, C.D. (1995). ''Socioecology of a terrestrial salamander: juveniles enter adult territories during stressful foraging periods.'' Ecology, 76, 533-543.
  • Jaeger, R.G., and Rubin, A.M. (1982). ''Foraging tactics of a terrestrial salamander judging prey profitability.'' Journal of Animal Ecology, 51, 167-176.
  • Kleeberger, S.R. and Werner, J.K. (1982). ''Home range and homing behavior of Plethodon cinereus in northern Michigan.'' Copeia, 1982(2), 409-415.
  • Lang, C. and R.G. Jaeger (2000). ''Defense of territories by male-female pairs in the Red-Backed Salamander (Plethodon cinereus).'' Copeia, 2000(1), 169-177.
  • Lauer, A., Simon, M. A., Banning, J. L., André, E., Duncan, K., and Harris, R. N. (2007). ''Common cutaneous bacteria from the eastern red-backed salamander can inhibit pathogenic fungi.'' Copeia, 2007, 630-640.
  • Maerz, J. C., Nuzzo, V. A., and Blossey, B. (2009). ''Declines in woodland salamander abundance associated with non-native earthworm and plant invasions.'' Conservation Biology, 23, 975-981.
  • Maglia, A.M. (1996). ''Ontogeny and feeding ecology of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1996(3), 576-586.
  • Mathis, A. (1990). ''Territoriality in a terrestrial salamander the influence of resource quality and body size.'' Behavior, 112, 162-175.
  • Mitchell, J.C. and Woolcott, W.S. (1985). ''Observations of the microdistribution diet and predator-prey size relationships in the salamander Plethodon cinereus from the Virginia Piedmont.'' Virginia Journal of Science, 36, 281-288.
  • Moore, J.-D., and Wyman, R. L. (2010). ''Eastern red-backed salamanders (Plethodon cinereus) in a highly acid forest soil.'' The American Midland Naturalist, 163, 95-105.
  • Moreno, G. (1989). ''Behavioral and physiological differentiation between the color morphs of the salamander Plethodon cinereus.'' Journal of Herpetology, 23, 335-341.
  • Ng, M.V. and Wilbur, H.M. (1995). ''The cost of brooding in Plethodon cinereus.'' Herpetologica, 51, 1-8.
  • Ousterhout, B. H., and Liebgold, E. B. (2010). ''Dispersal versus site tenacity of adult and juvenile red-backed salamanders (Plethodon cinereus).'' Herpetologica, 66, 269-275.
  • Petruzzi, E. E., Niewiarowski, P. H., and Moore, F. B.-G. (2006). ''The role of thermal niche selection in maintenance of a colour polymorphism in redback salamanders (Plethodon cinereus).'' Frontiers in Zoology, 3, 10, doi:10.1186/1742-9994-3-10.
  • Rankin, J. S. (1937). ''An ecological study of parasites of some North Carolina salamanders.'' Ecological Monographs, 7, 169-269.
  • Ransom, T. S. (2010). ''Earthworms, as ecosystem engineers, influence multiple aspects of a salamander’s ecology.'' Oecologia, published online 17 September 2010, DOI: 10.1007/s00442-010-1775-1.
  • Ransom, T. S., and Jaeger, R. G. (2006). ''An assemblage of salamanders in the southern Appalachian Mountains revisited: competitive and predatory behavior.'' Behaviour, 143, 1357-1382.
  • Robertson, J. (2010). ''Mimicry: experimental design and scientific logic.'' An Introduction to Methods and Models in Ecology, Evolution, and Conservation Biology. S. Braude and B. S. Low, eds., Princeton University Press, Princeton, NJ.
  • Simons, R.R., Gelgenhauer, B.E., and Jaeger, R.G. (1994). ''Salamander scent marks: site of production and their role in territorial defence.'' Animal Behavior, 48(11), 97-103.
  • Simons, R.R., Jaeger, R.G., and Gelgenhauer, B.E. (1997). ''Competitor assessment and area defense by territorial salamanders.'' Copeia, 1997(1), 70-76.
  • Takahashi, M. K. and Pauley, T. K. (2010). ''Resource allocation and life history traits of Plethodon cinereus at different elevations.'' The American Midland Naturalist, 163, 87-94.
  • Tilley, S.G., Lundrigan, B.G., and Brower, L.P. (1982). ''Erythrism and mimicry in the salamander Plethodon cinereus.'' Herpetologica, 38, 409-417.
  • Venesky, M. D., and Anthony, C. D. (2007). ''Antipredator adaptations and predator avoidance by two color morphs of the eastern red-backed salamander Plethodon cinereus.'' Herpetologica, 63, 450-458.
  • Woodhams, D. C., Vredenburg, V. T., Simon, M. A., Billheimer, D., Shakhtour B., et al. (2007). ''Symbiotic bacteria contribute to innate immune defenses of the threatened mountain yellow-legged frog, Rana muscosa.'' Biological Conservation, 138, 390-398.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Eastern North America. The red-backed salamander's range extends west to Missouri; south to North Carolina; and north from southern Quebec and the Maritime Provinces in Canada to Minnesota (Conant 1975).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Physical Description

Length: 5.7 to 12.7 cm.

The red-backed salamander has two different color phases. The "redback" phase consists of a gray or black body with a red or orange stripe down the back, extending from the neck onto the tail. The "leadback" phase lacks the red stripe, with a purely black or grey back instead. Its belly is a mottled white and gray in both phases, creating a salt and pepper pattern. Physically, P. Cinereus has 16 to 19 costal grooves, no circular constriction at the base of its tail, and it has five toes on its hind feet. These physical characteristics help to distinguish the red-backed salamander from other salamanders similar in appearance. No distinctions between males and females are noted. (Harding and Homan 1992, Conant 1975)

Range length: 5.7 to 12.7 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 0.5 g.

Average basal metabolic rate: 9.9e-05 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Size

Length: 13 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Plethodon cinereus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Detroit, Wayne, Michigan, United States, North America
  • Syntype: Sager, A. 1839. American Journal of Science and Arts. 36: 322.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Plethodon cinereus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1947
Locality: Hawksbill Mountain, foot trail to, ca. 100 yds from Skyline Drive, Madison, Virginia, United States, North America
Elevation (m): 1067 to 1067
  • Paratype: Grobman, A. B. 1945. Proc. Biol. Soc. Washington. 62: 136.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Plethodon cinereus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1947
Locality: Hawksbill Mountain, foot trail to, ca. 100 yds from Skyline Drive, Madison, Virginia, United States, North America
Elevation (m): 1067 to 1067
  • Holotype: Grobman, A. B. 1945. Proc. Biol. Soc. Washington. 62: 136.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Plethodon cinereus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1947
Locality: Hawksbill Mountain, foot trail to, ca. 100 yds from Skyline Drive, Madison, Virginia, United States, North America
Elevation (m): 1067 to 1067
  • Paratype: Grobman, A. B. 1945. Proc. Biol. Soc. Washington. 62: 136.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Plethodon cinereus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1947
Locality: Hawksbill Mountain, foot trail to, ca. 100 yds from Skyline Drive, Madison, Virginia, United States, North America
Elevation (m): 1067 to 1067
  • Paratype: Grobman, A. B. 1945. Proc. Biol. Soc. Washington. 62: 136.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Red-backed salamanders are terrestrial, and live in deciduous forests throughout their geographic range. They are found in the leaf litter on the ground as well as under rocks, logs, or in small burrows. They must live in a moist environment, as they lack lungs and require moist skin for respiration. One habitat factor affecting red-backed salamanders is soil pH. P. cinereus, like many other amphibians, is negatively effected by high levels of acidity. Red-backed salamanders have been shown to exhibit the same primary response to acidic substrate as do amphibian larvae exposed to acidic water, disruption of their sodium balance. The chronically lethal pH level for P. cinereus is between 3 and 4, and they are rarely found on soils with a pH of 3.7 or lower. (Frisbie and Wyman 1991, Harding and Holman 1992, Horne 1988)

Habitat Regions: temperate

Terrestrial Biomes: forest

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Habitat and Ecology

Habitat and Ecology
It can be found in damp microhabitats in wooded areas; inside logs, under leaf-litter, or under surface objects during day. Goes underground during freezing or hot, dry weather. In New York, tended to be absent where soil pH was less than 3.8; much more abundant in beech forest than in hemlock forest (Wyman 1988, Wyman and Jancola 1992, Frisbie and Wyman 1992). It occurs in altered habitats where damp microhabitats remain, such as in urban and suburban gardens. Lays eggs in cavity in log or stump or under rock or other objects on ground, where they develop directly without a larval stage.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Damp microhabitats in wooded areas; inside logs, under leaf litter, or under surface objects during day. Goes underground during freezing or hot, dry weather. In New York, tended to be absent where soil pH was less than 3.8; much more abundant in beech forest than in hemlock forest (Wyman 1988, Wyman and Jancola 1992, Frisbie and Wyman 1992). Lays eggs in cavity in log or stump or under rock or other objects on ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Red-backed salamanders feed on a large variety of invertebrates. These include mites, spiders, insects, centipedes, millipedes, beetles, snails, ants, earthworms, flies, and larvae. They forage by thrusting out their tongue in a quick, forward motion and capturing the prey. The physical environment determines food supply and foraging habits. During and shortly after rains is the optimal foraging time for P. cinereus. At these times the leaf litter on the forest floor as well as the forest vegetation is very moist. The salamanders wander throughout the leaf litter during the day and climb plants and trees at night to find prey, feeding on both ground-dwelling and arboreal invertebrates. As moisture decreases they are limited to the leaf litter, and as that subsequently dries up they eventually are restricted to areas under rocks or logs or in burrows that will continue to retain moisture. The decrease in moisture does not affect the availability of prey, but it limits the mobility of the salamanders due to their moisture requirements. Food levels are scarcer under logs or rocks and in burrows and the supply is easily exhaustible. Consequently, red-backed salamanders are pulse feeders that eat large amounts when conditions are favorable and store the extra nourishment as fat to live off of when conditions become poor. (Fraser 1976, Jaeger 1972, Jaeger 1980, Maglia 1996)

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically on a wide variety of small terrestrial invertebrates. Occasionally cannibalistic. Brooding females probably do not actively forage but may feed opportunistically (Ng and Wilbur, 1995, Herpetologica 51:1-8).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Red-backed salamanders play an important biological role in both providing food for their predators as well as consuming large numbers of invertebrates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Red-backed salamanders make up an important food source for a wide variety of snakes, birds, and mammals. They have the ability to drop all or part of their tail if under attack from a predator and can grow a new one afterwards. The tail that grows back is often lighter in color than the original tail.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Plethodon cinereus preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Represented by many and/or large occurrences throughout the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but likely exceeds 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Territorial. Home range generally less than a few meters across. This species often is the most abundant vertebrate throughout its range; attains densities of up to at least 2500/ha.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red-backed Salamanders protect their limited food supply by marking out territories. This behavior occurs most often when moisture levels are low and the salamanders have to hide under logs or rocks. Both males and females leave scent marks on the ground as well as leaving their droppings. Other salamanders can learn a lot from these clues. They learn each others territorial boundaries, the size and importance of the salamanders that live in the area, and their identity, including whether or not they are related. When finding food is very hard due to dry conditions, adults who have their own territories will sometimes allow young salamanders that are related to them to use their territories. Intruders are also warned away by seeing the size of the salamander and watching it give threatening displays.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Cyclicity

Comments: Generally inactive in dry weather and in coldest months but may be active in mild weather in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Red-backed salamanders lay eggs that develop directly into small salamanders. They do not have an aquatic larva stage, such as is found in other salamanders and most amphibians.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

While there is little information on lifespan in red-backed salamanders, other plethodontid salamanders can live for up to 32 years. Plethodon jordani has a mean generation time of 9.8 years, with 77% surviving to 10 years old. There is no reason to expect that red-backed salamanders can't also reach these ages.

Average lifespan

Status: captivity:
25 years.

  • Hairston, N. 1983. Growth, survival, and reproduction of Plethodon jordani: trade-offs between selective pressures.. Copeia, 4: 1024-1035.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (wild) Observations: These animals have been estimated to live up to 20-25 years in the wild (http://www.pwrc.usgs.gov/neparc/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Reproduction

Reproduction

Mating for red-backed salamanders occurs in the fall. Courtship consists of "the male secreting a substance from a gland on his chin that is rubbed on the female's head and nostrils to stimulate her to breed. Eventually he deposits a spermatophore that the female picks up with her cloaca to fertilize the eggs" (Harding and Holman, 1992). The female lays three to fourteen eggs the following spring. The eggs are laid in a cluster in subterranean cavities, usually naturally occurring cracks and crevices. Eggs can also be laid in or under rotting wood. The mother remains coiled around the egg cluster until they hatch. They are entirely terrestrial and do not have an aquatic larval stage. Young mature in approximately two years, after which males mate every year and females mate every other year.

(Block 1985, Fraser 1976, Harding and Holman 1992, Horne and Jaeger 1988).

Breeding interval: Red-backed salamanders become sexually mature (able to mate) in approximately two years. Males mate every year and females mate once every other year.

Breeding season: Fall

Range number of offspring: 3.0 to 14.0.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average number of offspring: 8.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

The eggs are guarded by the mother until they hatch. Upon emerging from the egg, young salamanders are independent. Salamanders recognize their relatives through smell and although they are solitary, mothers will allow their young to stay in her foraging area.

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Lays a clutch of up to about 15 eggs, mostly in June or July. Female remains with eggs until hatching in 6-9 weeks (usually August or September); additional individual (probably male) may occur with attending female (Friet 1995, Herpetol. Rev. 26:198-199). Larval stage passed in egg. Female may attend hatchling for up to a few weeks after hatching. Sexually maturity reportedly occurs in about 2-3 years. Adult males exhibit courtship behavior annually in spring and fall; females apparently breed biennially.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Skin protects from fungus: red-backed salamander
 

Skin of red-backed salamanders protects from pathogenic fungus thanks to resident antifungal microbes.

   
  "The disease chytridiomycosis, which is caused by the chytrid fungus  Batrachochytrium dendrobatidis, is associated with recent declines  in amphibian populations. Susceptibility to this disease varies  among amphibian populations and species, and resistance appears  to be attributable in part to the presence of antifungal microbial  species associated with the skin of amphibians. The betaproteobacterium  Janthinobacterium lividum has been isolated from the  skins of several amphibian species and produces the antifungal  metabolite violacein, which inhibits B. dendrobatidis. In  this study, we added J. lividum to red-backed salamanders (Plethodon  cinereus) to obtain an increased range of violacein concentrations  on the skin. Adding J. lividum to the skin of the  salamander increased the concentration of violacein on the skin,  which was strongly associated with survival after experimental exposure  to B. dendrobatidis. As expected from previous work, some  individuals that did not receive J. lividum and were exposed  to B. dendrobatidis survived. These individuals had  concentrations of bacterially produced violacein on their  skins that were predicted to kill B. dendrobatidis.  Our study suggests that a threshold violacein concentration  of about 18 µM on a salamander's skin prevents mortality and  morbidity caused by B. dendrobatidis. In addition, we  show that over one-half of individuals in nature support  antifungal bacteria that produce violacein, which suggests that  there is a mutualism between violacein-producing bacteria and  P. cinereus and that adding J. lividum is effective for  protecting individuals that lack violacein-producing skin  bacteria." (Becker et al. 2009:6635)

  Learn more about this functional adaptation.
  • Becker MH; Brucker RM; Schwantes CR; Harris RN; Minbiole KP. 2009. The bacterially produced metabolite violacein is associated with survival of amphibians infected with a lethal fungus. Applied and Environmental Microbiology. 75(21): 6635 - 6638.
  • 2009. Bacterially produced antifungal on skin of amphibians may protect against lethal fungus. Science Daily [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plethodon cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0081-06|AY728232|Plethodon cinereus| ACTCGATGACTTTTTTCAACCAATCATAAAGATATTGGCACCCTATATCTAATATTTGGTGCCTGAGCCGGCACGGTGGGCACCGCCCTG---AGCCTCCTAATCCGAACAGAGCTAAGCCAACCCGGGGCCTTATTAGGCAAT---GATCAAATTTATAACGTGGTCGTTACTGCTCATGCCTTTGTAATAATTTTTTTTATGGTTATACCTGTAATAATTGGAGGATTTGGCAACTGACTCCTCCCACTCATA---ATTGGCGCTCCAGACATAGCATTCCCTCGTATAAATAATATAAGTTTTTGACTTCTCCCTCCCTCCTTCCTCCTCCTCCTGGCCTCTTCTGGAGTAGAAACCGGAGCCGGTACTGGATGGACAGTATATCCCCCTTTAGCCGGAAACCTCGCACACGCCGGAGCCTCAGTTGACTTA---ACCATTTTTTCCCTTCACCTTGCGGGAGTATCATCTATCTTGGGTGCCATTAATTTTATTACAACTACCATTAATATAAAACCCCCAGCAATATCCCAATACCAAATACCTTTATTTGTTTGATCTGTTCTTATTACTGCTATTTTACTATTACTTTCATTACCAGTGCTAGCAGCC---GGCATTACCATATTACTTACAGACCGAAACCTCAACACTACATTTTTTGACCCCGCAGGAGGGGGGGACCCGGTATTATATCAACACTTATTTTGATTTTTTGGCCACCCAGAAGTTTATATTCTCATCCTGCCTGGCTTCGGAATAATCTCTCATATTGTCACCTACTATTCTACCAAAAAA---GAGCCATTTGGGTATATAGGAATGGTTTGAGCAATAATATCAATTGGTCTCTTAGGATTTATCGTTTGAGCCCATCATATATTTACAACAGACCTTA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Plethodon cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Species: 32
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Red-backed salamander habitat is rather pervasive, and they are common in most of their range. In the future, however, they could be effected by high levels of soil acidity through human-induced factors such as acid rain.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Population

Population
This is an extremely abundant species. Total adult population size is unknown but certainly exceeds many millions of individuals. Thousands of localities are known.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Likely stable in extent of occurrence and probably stable to slightly declining in population size, area of occupancy, and number/condition of occurrences.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Likely relatively stable in extent of occurrence, probably less than 25% decline in population size, area of occurrence, and number/condition of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Life History:

P. cinereus is terrestrial and can often be found under cover objects such as logs (Bishop 1943). It also used earthworm burrows as refuges in experimental enclosures, resulting in higher survival rates over winter as well as lower predation risk from the common garter snake (Thamnophis sirtalis) when compared to encosures (Ransom 2010).

During the summer noncourtship season, two-thirds of individuals are found alone, while the other third lives in male-female pairs (Gillette et al. 2000). Breeding takes place from October to December, during which time the pairs remain together (Bishop 1943). In the early spring, groups of 2-7 can be found together under rocks and logs (Jaeger 1979). Insemination takes place in the spring and eggs are laid in June and July (Bishop 1943; Lang and Jaeger 2000). Clutch size ranges from 3-14 eggs, usually from 8-10 (Bishop 1943; Ng and Wilbur 1995). The eggs are suspended by a common pedicel from the roof of the nest cavity, which is usually a well-rotted log (Bishop 1943). The females protect the eggs until they hatch 6-9 weeks later. Brooding females do not actively forage, but will eat opportunistically. This causes them to grow less than non-brooding females (Ng and Jaeger 1995). Females usually breed in alternate years because they normally require two years in order to store enough energy to yolk a clutch of ova and survive brooding. This is due to scarcity of prey (Jaeger et al. 2002a).

P. cinereus, in the red-backed form, may avoid predation by mimicking the red eft (terrestrial) stage of the red-spotted newt, Notophthalmus viridescens, which is toxic; if so, this would be an example of Batesian mimicry since it is assumed that P. cinereus is not toxic (Brodie and Brodie 1980; Cassell and Jones 2005; Robertson 2010). Although Highton (1959) suggested that the most logical explanation for the observed dimorphism of P. cinereus is that the gene for striping (which makes the red-backed phase) is dominant to the gene for the unicolored, nonstriped condition (which makes the lead-backed phase), Highton (1975) observed that the striped morph was dominant in one Virginia locality but recessive in another (in a different county), and suggested that epistatic interaction of two or more loci was responsible for the dimorphism. Fitzpatrick et al. (2009), using model salamanders with and without dorsal stripes, found that the striping polymorphism was maintained due to frequency-dependent selection by ground-foraging wild birds. The two forms appear to differ in various ways: red-striped morphs were found to obtain prey with higher nutritional value than lead-backed morphs (Anthony et al. 2008); one study suggested that red-striped morphs have a different temperature threshold for above-ground activity, as they have higher metabolic rates (Moreno 1989), but another study did not find a consistent difference in metabolic rates (Petruzzi et al. 2006); red-striped forms were found to be less likely to flee from predators and less mobile than the lead-backed forms (Venesky and Anthony 2007); and red-striped morphs had lower stress hormone levels than the lead-phase form, possibly due to differential predation pressure (Davis and Milaonvich 2010).

Amphibians harbor microsymbionts on their skin surfaces, which aid in defense against pathogens. Plethodon cinereus has been shown to harbor different species of bacteria on its skin that serve as part of the innate immune system and protect the salamander against fungal infections. These cutaneous bacteria include Janthinobacterium lividum, which secretes the antifungal metabolite violacein (Brucker et al. 2008a, 2008b), as well as the beneficial bacterium Lysobacter gummosus, which also has antifungal activity (Lauer et al. 2007). The bacterial species J. lividum has been shown to protect the salamander P. cinereus against infection by the chytrid fungal pathogen Batrachochytrium dendrobatidis, when it is present in sufficient numbers on the salamander's skin, and reduces clinical symptoms of the fungal disease chytridiomycosis in the salamanders (Brucker et al. 2008b; Harris et al. 2009b; Becker and Harris 2010). Bioaugmentation with this beneficial skin bacterium (J. lividum) in the laboratory appears to protect not only salamanders (P. cinereus) against chytridiomycosis (Harris et al. 2009b) but also at least one species of frog (Rana muscosa) (Harris et al. 2009a). The strategy of increasing beneficial skin bacteria (bioaugmentation) is now being tried in wild Rana muscosa frogs (Vredenburg pers. comm.), which carry some J. lividum on their skin but have been almost completely extirpated due to chytridiomycosis (Woodhams et al. 2007).

P. cinereus has also been found to sometimes harbor an intracellular bacterium (order Rickettsiales, probably family Anaplasmatacea) within red blood cells. The bacteria live in a membrane-bound vacuole within the erythrocyte that appears as a cytoplasmic violet-colored inclusion following Giemsa staining. Inclusions were generally found in nucleated erythrocytes but occasionally also in enucleated erythrocytes. Davis et al. (2009) found that males were more likely to be infected than females and that infected salamanders were actually larger and had higher body condition scores than uninfected salamanders (even after accounting for gender). It is thought that the parasitic bacteria are likely to be transmitted by trombiculid mites. Trombiculid mites inhabit leaf litter and are the only ectoparasite known for salamanders in the genus Plethodon (Rankin 1937).

Abundance:
Abundance of P. cinereus has been estimated as high as 2.8 individuals/m2 at Mountain Lake Biological Station in Virginia, where it probably reaches its highest density. This makes it the most abundant vertebrate species at the site, and more abundant than all birds and mammals combined (Hairston 1996; Jaeger et al. 2002a). At the Hubbard Brook Experimental Forest in New Hampshire, the estimate for the population density of P. cinereus is 2,583 individuals/hectare, which corresponds to a biomass of 1658 grams wet wt./hectare. This biomass is approximately 2.4 times that for all birds and approximately equal to that for mice and shrews (Burton and Likens 1975). Throughout its range P. cinereus is an extremely abundant species.

Inter-Specific Behaviors:
A number of observations have been made concerning the relationship of P. cinereus with other salamander species (reviewed by Bruce 2008). For instance, it is aggressive against intrusion by Eurycea cirrigera, juvenile P. glutinosus, P. hoffmani, P. shenandoah, and P. electromorphus (Jaeger 1980; Jaeger et al. 1998; Jaeger et al. 2002b; Griffis and Jaeger 1998; Deitloff et al. 2008). In the case of P. shenandoah, competition with P. cinereus has forced it onto dry talus slopes where it is in danger of extinction due to desiccation (Jaeger 1980). In the case of Eurycea cirrigera, this species was found to shift its distribution closer to the stream in field plots where P. cinereus had been removed. For other salamander species, such as Ambystoma maculatum and Desmognathus fuscus, P. cinereus is a potential prey (Ducey et al. 1994; Grover and Wilbur 2002; Ransom and Jaeger 2006), although Ransom and Jaeger (2006) concluded that predation by D. fuscus on P. cinereus was probably rare in nature. Grover (2000) suggested that P. cinereus is probably forced into the drier end of a stream-to-forest habitat gradient due to competition with and predation by Desmognathus species. Streamside D. fuscus and Gyrinophilus porphyriticus were able to displace P. cinereus from artificial seeps created inside forest at various distances from naturally occurring streams (Grover and Wilbur 2002). In attacks by A. maculatum, 62% of P. cinereus escaped and 9% were consumed (Ducey et al. 1994). A common response to these predation attempts is tail autonomy (Jaeger et al. 1998).

Foraging Habits:
Plethodon cinereus commonly feeds on invertebrate insects found in the leaf litter, such as ants, collembola, mites, and termites (Jaeger et al. 1995a; Lang and Jaeger 2000; Mitchell and Woolcott 1985). On rainy and foggy nights individuals can be found climbing the vegetation to forage on homopterans and hemipterans. This greatly increases volume of food ingested, but cannot be regularly undertaken because of the danger of desiccation (Jaeger 1978). Overall foraging success increases with rainfall, because this makes it possible to forage out into the leaf litter (Jaeger 1980).

When there are low prey densities, individuals have an indiscriminate diet and normally pursue prey. When there are high prey densities, individuals have a discriminate diet and normally ambush prey (Jaeger and Barnard 1981). Each individual learns through foraging experience which prey types are the most profitable. Gross caloric intake, which depends on size of the prey, and rate at which prey can be digested, which depends on the amount of chitin in the exoskeleton, are both factors that need to be considered (Jaeger and Rubin 1982). Thus, P. cinereus prefers termites to ants, because they are larger and have a softer exoskeleton (Gabor and Jaeger 1995).

In individuals from higher-elevation habitat, stored tail fat relative to body size was found to be greater than in individuals from lower-elevation habitat (Takahashi and Pauley 2010).

Intra-Specific Behaviors:
A number of intraspecific behaviors have been recorded for P. cinereus. Threatening behaviors include the all-trunk-raised (ATR) position and looking toward the opposing individual (Jaeger 1984; Jaeger et al. 2002a). Violence can be carried out by a rapid nip with the anterior part of the mouth, which does not cause physical damage to the skin of the bitten animal, or by a full mouth hold, which may lacerate the skin (Jaeger et al. 2002a). Bites are usually delivered to the tail or the snout in order to cause the most damage. Bites on the tail may cause tail autonomy, which involves a loss of fat reserves. Bites on the snout may damage the nasolabial grooves, thus decreasing chemoreception and causing a reduced rate of prey capture during foraging, and a reduced ability to find mates and competitors (Jaeger 1981). Submissive behaviors include the flat posture, where the whole length of the body is pressed firmly against the ground, and looking away from the opposing individual (Jaeger 1984). Tapping nasolabial cirri against the substrate is an indication of interest, because it allows chemical information to pass up the nasolabial grooves to the vomeronasal organ in the nares. The front-trunk-raised position is a resting posture (Gillette et al. 2000).

These behaviors are often used to establish territoriality. Territories are used by both sexes to defend scarce prey and to avoid desiccation during rainless periods. In addition, they are used by males for courtship (Jaeger et al. 2002a; Lang and Jaeger 2000). Territories are established under cover objects, such as rocks and logs, and can be set within 5 days by placing pheromones on the substrate (Jaeger et al. 2002a). Home ranges for P. cinereus are about 1.15 m in diameter, and may be due to site tenacity, since the range of both adult (max 0.88 m) and juvenile (max 1.22 m) movement between years was roughly equal to the diameter of the home range (Ousterhout and Liebgold 2010). Scent markers are produced by the post-cloacal gland, so marking can be accomplished by touching the cloacal area to the substrate (Jaeger 1984; Simons et al. 1994). Fecal pellets are also used to mark territory (Jaeger et. al. 1986). An intruder can learn characteristics of the resident male, such as size, by sampling airborne odors through gular pumping, or by touching nasolabial cirri to the fecal pellets (Jaeger 1984; Simons et al. 1997).

Females are more attracted to large males, males that have a prey-rich territory, and males that do not have odors from other females (Gillette et al. 2000). Females can discover how prey-rich a male's territory is by squashing his fecal pellets and seeing if it has the residue of light-armored termites or heavy armored ants (Jaeger et al. 1995a). Since prey-rich territories are the more valuable ones, both resident and intruder males are more aggressive when the resident has eaten higher quality food (Gabor and Jaeger 1995). During an invasion of another male's territory, both the intruder and defender assume threat posture about half the time (Jaeger et al. 1982). Both combatants are usually in ATR prior to biting attack, but the defender exhibits the higher rate of biting and successfully defends his territory 74% of the time (Jaeger et al. 1982; Jaeger 1984). Larger individuals are in general better competitors, and are thus more likely to hold the prey-rich territories (Mathis 1990). Since competition is normally harmful, neighboring males exhibit dear enemy recognition, which consists of less aggression and more submissive behavior towards territorial neighbors than toward strangers (Jaeger 1981). Females that are familiar with each other also spend less time in threat displays toward each other (Jaeger and Peterson 2002).

Once a female has selected a male, the two of them form a pair and defend the territory together. In both the courtship and noncourtship seasons, males spend more time in aggression toward invading males than females do, and females spend more time in aggression toward invading females than males do. Thus, pairs can codefend a territory more successfully, but not in a cooperative manner. Their success can be seen in the fact that females spend less time intruding a territory defended by a pair than by a single individual, and that both female and male intruders spend less time on a pair's territory during courtship season than during noncourtship season. Still, the fact that the male and female of a pair cannot cooperate seems to indicate that males are not willing to pass up future polygynous relationships and females are not willing to pass up future polyandrous relationships (Lang and Jaeger 2000).

To some extent, however, the relationship between the members of a pair is monogamous. During the noncourtship season, partners show no preference to associate with each other over novel conspecifics of the opposite sex. Even during the courtship season, they show no preference toward each other over single conspecifics of the opposite sex. At this time, however, they do prefer each other over paired conspecifics of the opposite sex. During the courtship season, the male profits from the presence of the female because it increases his reproductive fitness. As a result he undertakes mate guarding. The female profits from a monogamous male because with no other female in the territory she can obtain more prey for yolking ova (Gillette et al. 2000).

The male takes this monogamous relationship so far as to punish a socially polyandrous female partner, meaning one who has foraged with another male. The male can sense if his partner has associated with another male by detecting the other male's pheromones on her skin. Punishment takes the form of increased used of threat postures and even nipping if it is during the courtship season. Males also stay farther away from female partners that are socially polyandrous during both the courtship and noncourtship seasons, while they spend more time touching socially monogamous female partners. Socially polyandrous females in response show an increase in escape behavior. This sort of sexual coercion on the part of the male is logical, because he should not allow polyandrous females to feed in his territory. This might mean investing his own resources on the offspring of another male (Jaeger et al. 2002a).

Another interesting behavior among P. cinereus is the association between juveniles and adults. Juveniles normally inhabit the leaf litter between cover objects. They are attracted by the pheromones of adults and when the leaf litter dries out and foraging becomes difficult, they enter the adults' territories. Males are less aggressive toward juveniles than toward adult males and both male and female adults are more tolerant of juveniles with which they have cohabited previously. This type of behavior seems to be some sort of kin-selection. When it rains, the juveniles return to the leaf litter (Jaeger et. al. 1995b).

A final fact about P. cinereus behavior is that they seem to exhibit a certain degree of homing ability. The average daily movement of individuals is only 0.43 m/day, yet when they are displaced 30 m, 90% of them return to their territories. This return is usually along a fairly straight path and is almost immediate. When displacement increases to 90 m, only 25% of individuals return to their territories (Kleeberger and Werner 1982).

  • Highton, R. (2000). ''Detecting cryptic species using allozyme data.'' The Biology of Plethodontid Salamanders. R.C. Bruce, R.G. Jaeger, and L.D. Houck, eds., Kluwer Academic/Plenum Publishers, New York, New York, 215-241.
  • Conant, R. and Collins, J.T. (1998). A Field Guide to Reptiles and Amphibians of Eastern and Central North America. 3rd Edition. Houghton Mifflin Company, Boston, Massachusetts.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
  • Alford, R.A., and Richards, S.J. (1999). ''Global amphibian declines: A problem in applied ecology.'' Annual Review of Ecology and Systematics, 30, 133-65.
  • Anthony, C. D., Venesky, M. D., and Hickerson, C. A. M. (2008). ''Ecological separation in a polymorphic terrestrial salamander.'' Journal of Animal Ecology, 77, 646-653.
  • Bazar, M. A., Quinn, M. J., Jr., Mozzachio, K., Bleiler, J. A., Archer, C. R., Phillips, C. T., and Johnson, M. S. (2008). ''Toxicological responses of red-backed salamanders (Plethodon cinereus) to soil exposures of copper.'' Archives of Environmental Contamination and Toxicology, 57, 116-122.
  • Becker, M. H., and Harris, R. N. (2010). ''Cutaneous bacteria of the redback salamander prevent mortality associated with a lethal disease.'' PLoS One, 5(6), e10957.
  • Bergeron, C. M., Bodinof, C. M., Unrine, J. M., and Hopkins, W. A. (2010). ''Mercury accumulation along a contamination gradient and nondestructive indices of bioaccumulation in amphibians.'' Environmental Toxicology and Chemistry, 29, 980-988.
  • Brodie, E. D., Jr., and Brodie, E. D. III (1980). ''Differential avoidance of mimetic salamanders by free-ranging birds.'' Science, 208, 181-182.
  • Bruce, R. C. (2008). ''Intraguild interactions and population regulation in plethodontid salamanders.'' Herpetological Monographs, 2008, 31-53.
  • Brucker, R. M., Baylor, C. M., Walters, R. L., Lauer, A., Harris, R. N., and Minbiole, K. P. C. (2008). ''The identification of 2,4-diacetylphloroglucinol as an antifungal metabolite produced by cutaneous bacteria of the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 43, 39-43.
  • Brucker, R. M., Harris, R. N., Schwantes, C. R., Gallaher, T. N., Flaherty, D. C., Lam, B. A., and Minbiole, K. B. C. (2008). ''Amphibian chemical defense: Antifungal metabolites of the microsymbiont Janthinobacterium lividum on the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 34, 1422-1429.
  • Burton, T.M. (1975). ''Salamander populations and biomass in the Hubbard Brook Experimental Forest, New Hampshire.'' Copeia, 1975(3), 541-546.
  • Cabe, P. R., Page, R. B., Hanlon, T. J., Aldrich, M. E., Connors, L., and Marsh, D. M. (2007). ''Fine-scale population differentiation and gene flow in a terrestrial salamander (Plethodon cinereus) living in a continuous habitat.'' Heredity, 98, 53-60.
  • Cassell, R. W., and Jones, M. P. (2005). ''Syntopic occurrence of the erythristic morph of Plethodon cinereus and Notophthalmus viridescens in Pennsylvania.'' Northeastern Naturalist, 12, 169-172.
  • Davis, A. K. (2010). ''Lead-phase and red-stripe color morphs of red-backed salamanders Plethodon cinereus differ in hematological stress indices: A consequence of differential predation pressure?'' Current Zoology, 56, 238-243.
  • Deitloff, J., Adams, D. C., Olechnowski, B. F. M., and Jaeger, R. G. (2008). ''Interspecific aggression in Ohio Plethodon: implications for competition.'' Herpetologica, 64, 180-188.
  • Ducey, P.K., Schramm, K., and Cambry, N. (1994). ''Interspecific aggression between the sympatric salamanders, Ambystoma maculatum and Plethodon cinereus.'' American Midland Naturalist, 131, 320-329.
  • Fitzpatrick, B. M., Shook, K., and Izally, R. (2009). ''Frequency-dependent selection by wild birds promotes polymorphism in model salamanders.'' BMC Ecology, 9, 12.
  • Gabor, C.R., and Jaeger, R.G. (1995). ''Resource quality affects the agonistic bevariour of territorial salamanders.'' Animal Behavior, 49, 71-79.
  • Gabor, C.R., and Jaeger, R.G. (1999). ''When salamanders misrepresent threat signals.'' Copeia, 1999(4), 1123-1126.
  • Gillette, J. R., Jaeger, R.G., and Peterson, M.G. (2000). ''Social monogamy in a territorial salamander.'' Animal Behavior, 59, 1241-1250.
  • Griffis, M. R., and Jaeger, R. G. (1998). ''Competition leads to an extinction-prone species of salamander: interspecific territoriality in a metapopulation.'' Ecology, 79, 2494-2502.
  • Grover, M. C. (2000). ''Determinants of salamander distributions along moisture gradients.'' Copeia, 2000, 156-168.
  • Grover, M. C., and Wilbur, H. M. (2002). ''Ecology of ecotones: interactions between salamanders on a complex environmental gradient.'' Ecology , 83, 2112-2123.
  • Grover, M.C. (1998). ''Influence of cover and moisture on abundances of the terrestrial salamanders Plethodon cinereus and Plethodon glutinosis.'' Journal of Herpetology, 32, 489-497.
  • Grover, M.C. and Wilbur, H.M. (2002). ''Ecology of ectones: interactions between salamanders on a complex environmental gradient.'' Ecology, 83, 2112-2123.
  • Hairston, N.G. (1996). Long-term studies of vertebrate communities. Academic Press, New York, NY.
  • Harris, R. N., Brucker, R. M., Walke, J. B., Becker, M. H., Schwantes, C. R., Flaherty, D. C., Lam, B. A., Woodhams, D. C., Briggs, C. J., Vredenburg, V. T., and Minbiole, K. P. C. (2009). ''Skin microbes on frogs prevent morbidity and mortality caused by a lethal skin fungus.'' The ISME Journal, 3, 818-824.
  • Harris, R. N., Lauer, A., and Simon, M. A. (2009). '' Addition of antifungal skin bacteria to salamanders ameliorates the effects of chytridiomycosis.'' Diseases of Aquatic Organisms, 83, 11-16.
  • Highton, R. (1959). ''The inheritance of the color phases of Plethodon cinereus.'' Copeia, 1959(1), 33-37.
  • Highton, R. (1975). ''Geographic variation in genetic dominance of the color morphs of the red-backed salamander, Plethodon cinereus.'' Genetics, 80, 363-374.
  • Highton, R. (1995). ''Speciation in eastern North American salamanders of the genus Plethodon.'' Annual Review of Ecology and Systematics, 26, 579-600.
  • Highton, R. (1999). ''Geographic protein variation and speciation in the salamanders of the Plethodon cinereus group with the description of two new species.'' Herpetologica, 55, 43-90.
  • Highton, R., and Webster, T.P. (1976). ''Geographic protein variation and divergence in populations of the salamander Plethodon cinereus.'' Evolution, 30, 33-45.
  • Jaeger, R.G. (1978). ''Plant climbing by salamanders periodic availability of plant dwelling prey.'' Copeia, 1978(4), 686-691.
  • Jaeger, R.G. (1979). ''Season spatial distribution of the terrestrial salamander Plethodon cinereus.'' Herpetologica, 35, 90-93.
  • Jaeger, R.G. (1980). ''Density-dependent and density-independent causes of extinction of a salamander population.'' Evolution, 34, 617-621.
  • Jaeger, R.G. (1980). ''Fluctuations in prey availability and food limitation for a terrestrial salamander Plethodon cinereus.'' Oecologia, 44, 335-341.
  • Jaeger, R.G. (1981). ''Dear enemy recognition and the costs of aggression between salamanders.'' Animal Behavior, 29, 1100-1105.
  • Jaeger, R.G. (1981). ''Foraging tactics of a terrestrial salamander Plethodon cinereus choice of diet in structurally simple environments.'' American Naturalist, 117, 639-664.
  • Jaeger, R.G. (1984). ''Agonistic behavior of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1984(2), 309-314.
  • Jaeger, R.G. and M.G. Peterson (2002). ''Familiarity affects agonistic interactions between female Red-Backed Salamanders.'' Copeia, 2002(3), 865-869.
  • Jaeger, R.G., Gabor, R.C., and Wilbur, H.M. (1998). ''An assemblage of salamanders in the southern Appalachian mountains: competitive and predatory behavior.'' Behavior, 135, 795-821.
  • Jaeger, R.G., Gillette, J.R., and Cooper, R.C. (2002). ''Sexual coercion in a territorial salamander: males punish socially polyandrous female partners.'' Animal Behavior, 63, 871-877.
  • Jaeger, R.G., Goy, J., Tarver, M., and Marqez, C. (1986). ''Salamander Plethodon cinereus territoriality pheromonal markers as advertisement by males.'' Animal Behavior, 34, 860-864.
  • Jaeger, R.G., Kalvarsky, D., and Shimizu, N. (1982). ''Territorial behavior of the Red-Backed Salamander Plethodon cinereus expulsion of intruders.'' Animal Behavior, 30, 490-496.
  • Jaeger, R.G., Prosen, E.D., and Adams, D.C. (2002). ''Character displacement and aggression in two species of terrestrial salamanders.'' Copeia, 2002(2), 391-401.
  • Jaeger, R.G., Schwarz, J., and Wise, S.E. (1995). ''Territorial male salamanders have foraging tactics attractive to gravid females.'' Animal Behavior, 49, 633-639.
  • Jaeger, R.G., Wicknick, J.A., Griffis, M.R., and Anthony, C.D. (1995). ''Socioecology of a terrestrial salamander: juveniles enter adult territories during stressful foraging periods.'' Ecology, 76, 533-543.
  • Jaeger, R.G., and Rubin, A.M. (1982). ''Foraging tactics of a terrestrial salamander judging prey profitability.'' Journal of Animal Ecology, 51, 167-176.
  • Kleeberger, S.R. and Werner, J.K. (1982). ''Home range and homing behavior of Plethodon cinereus in northern Michigan.'' Copeia, 1982(2), 409-415.
  • Lang, C. and R.G. Jaeger (2000). ''Defense of territories by male-female pairs in the Red-Backed Salamander (Plethodon cinereus).'' Copeia, 2000(1), 169-177.
  • Lauer, A., Simon, M. A., Banning, J. L., André, E., Duncan, K., and Harris, R. N. (2007). ''Common cutaneous bacteria from the eastern red-backed salamander can inhibit pathogenic fungi.'' Copeia, 2007, 630-640.
  • Maerz, J. C., Nuzzo, V. A., and Blossey, B. (2009). ''Declines in woodland salamander abundance associated with non-native earthworm and plant invasions.'' Conservation Biology, 23, 975-981.
  • Maglia, A.M. (1996). ''Ontogeny and feeding ecology of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1996(3), 576-586.
  • Mathis, A. (1990). ''Territoriality in a terrestrial salamander the influence of resource quality and body size.'' Behavior, 112, 162-175.
  • Mitchell, J.C. and Woolcott, W.S. (1985). ''Observations of the microdistribution diet and predator-prey size relationships in the salamander Plethodon cinereus from the Virginia Piedmont.'' Virginia Journal of Science, 36, 281-288.
  • Moore, J.-D., and Wyman, R. L. (2010). ''Eastern red-backed salamanders (Plethodon cinereus) in a highly acid forest soil.'' The American Midland Naturalist, 163, 95-105.
  • Moreno, G. (1989). ''Behavioral and physiological differentiation between the color morphs of the salamander Plethodon cinereus.'' Journal of Herpetology, 23, 335-341.
  • Ng, M.V. and Wilbur, H.M. (1995). ''The cost of brooding in Plethodon cinereus.'' Herpetologica, 51, 1-8.
  • Ousterhout, B. H., and Liebgold, E. B. (2010). ''Dispersal versus site tenacity of adult and juvenile red-backed salamanders (Plethodon cinereus).'' Herpetologica, 66, 269-275.
  • Petruzzi, E. E., Niewiarowski, P. H., and Moore, F. B.-G. (2006). ''The role of thermal niche selection in maintenance of a colour polymorphism in redback salamanders (Plethodon cinereus).'' Frontiers in Zoology, 3, 10, doi:10.1186/1742-9994-3-10.
  • Rankin, J. S. (1937). ''An ecological study of parasites of some North Carolina salamanders.'' Ecological Monographs, 7, 169-269.
  • Ransom, T. S. (2010). ''Earthworms, as ecosystem engineers, influence multiple aspects of a salamander’s ecology.'' Oecologia, published online 17 September 2010, DOI: 10.1007/s00442-010-1775-1.
  • Ransom, T. S., and Jaeger, R. G. (2006). ''An assemblage of salamanders in the southern Appalachian Mountains revisited: competitive and predatory behavior.'' Behaviour, 143, 1357-1382.
  • Robertson, J. (2010). ''Mimicry: experimental design and scientific logic.'' An Introduction to Methods and Models in Ecology, Evolution, and Conservation Biology. S. Braude and B. S. Low, eds., Princeton University Press, Princeton, NJ.
  • Simons, R.R., Gelgenhauer, B.E., and Jaeger, R.G. (1994). ''Salamander scent marks: site of production and their role in territorial defence.'' Animal Behavior, 48(11), 97-103.
  • Simons, R.R., Jaeger, R.G., and Gelgenhauer, B.E. (1997). ''Competitor assessment and area defense by territorial salamanders.'' Copeia, 1997(1), 70-76.
  • Takahashi, M. K. and Pauley, T. K. (2010). ''Resource allocation and life history traits of Plethodon cinereus at different elevations.'' The American Midland Naturalist, 163, 87-94.
  • Tilley, S.G., Lundrigan, B.G., and Brower, L.P. (1982). ''Erythrism and mimicry in the salamander Plethodon cinereus.'' Herpetologica, 38, 409-417.
  • Venesky, M. D., and Anthony, C. D. (2007). ''Antipredator adaptations and predator avoidance by two color morphs of the eastern red-backed salamander Plethodon cinereus.'' Herpetologica, 63, 450-458.
  • Woodhams, D. C., Vredenburg, V. T., Simon, M. A., Billheimer, D., Shakhtour B., et al. (2007). ''Symbiotic bacteria contribute to innate immune defenses of the threatened mountain yellow-legged frog, Rana muscosa.'' Biological Conservation, 138, 390-398.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Intensive timber harvest causes major declines in abundance (deMaynadier and Hunter 1995). Negative impacts of intensive timber harvesting extend at least 25-35m into uncut forest (deMaynadier and Hunter 1998). Roads negatively impact salamander abundance in roadside habitat and might serve as partial barriers to movement (deMaynadier and Hunter 2000). Animals have been exported from the United States to Canada as part of the international pet trade. However, none of these factors pose serious threats to the global population, and the species can adapt to certain modified habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Intensive timber harvest causes major declines in abundance (deMaynadier and Hunter 1995). Negative impacts of intensive timber harvesting extend at least 25-35 m into uncut forest (deMaynadier and Hunter 1998). Roads negatively impact salamander abundance in roadside habitat and may serve as partial barriers to movement (deMaynadier and Hunter 2000). However, these factors do not pose a major threat to the global population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Based on observations made at Hawksbill Mountain, VA between 1966 and 1980, there was no variation in the population density of P. cinereus during that time period (Jaeger 1980).

The major threat is clearcutting, which has reduced salamander populations in the southern Appalachians by almost 9%, or more than one-quarter of a billion salamanders (Alford and Richards 1999). Logging exposes terrestrial salamanders to altered microclimates, increased soil compaction and desiccation, and reduced habitat complexity.

Another threat is presented by invasive species of earthworms, which decrease forest leaf litter and thus habitat for the small arthropods that serve as prey items for salamanders. Maerz et al. (2009) conducted a mark-recapture study of woodland salamander abundance at ten sites in central New York and northeastern Pennsylvania, examining whether earthworm or plant invasions were associated with decreased salamander abundance. At these sites, P. cinereus constituted 80-99% of the salamanders captured. Salamander abundance was found to decline exponentially with decreasing leaf litter volume and was significantly associated with non-native earthworm abundance but not invasive plants. Earthworm invasions can be major drivers of change in temperate forests.

It has also been suggested that salamanders in the vicinity of military installations might be at risk from high copper contamination (due to its use in bullet casings, shot, and explosives), based on toxicity studies (Bazar et al. 2008). Mercury accumulation might also pose a threat; salamanders from a contaminated site on the South River in Virginia had elevated mercury concentrations in their tissues, at much higher levels (14-fold higher) than those shown to negatively impact development and metamorphic success in the frog Rana sphenocephala. However, P. cinereus had much lower levels than the sympatric species Eurycea bislineata, probably due to life history (direct development in a terrestrial environment for P. cinereus vs. an aquatic larval stage and riverine association plus aquatic prey in the adult stage for E. bislineata) (Bergeron et al. 2010).

Although some previous studies have shown that P. cinereusis sensitive to increased habitat acidity, Moore and Wyman (2010) reported that 87% of juveniles and 83% of adults were found under coverboards on a highly acidic forest floor (pH less than or equal to 3.8) in a northern hardwood forest of Québec, Canada.

  • Highton, R. (2000). ''Detecting cryptic species using allozyme data.'' The Biology of Plethodontid Salamanders. R.C. Bruce, R.G. Jaeger, and L.D. Houck, eds., Kluwer Academic/Plenum Publishers, New York, New York, 215-241.
  • Conant, R. and Collins, J.T. (1998). A Field Guide to Reptiles and Amphibians of Eastern and Central North America. 3rd Edition. Houghton Mifflin Company, Boston, Massachusetts.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
  • Alford, R.A., and Richards, S.J. (1999). ''Global amphibian declines: A problem in applied ecology.'' Annual Review of Ecology and Systematics, 30, 133-65.
  • Anthony, C. D., Venesky, M. D., and Hickerson, C. A. M. (2008). ''Ecological separation in a polymorphic terrestrial salamander.'' Journal of Animal Ecology, 77, 646-653.
  • Bazar, M. A., Quinn, M. J., Jr., Mozzachio, K., Bleiler, J. A., Archer, C. R., Phillips, C. T., and Johnson, M. S. (2008). ''Toxicological responses of red-backed salamanders (Plethodon cinereus) to soil exposures of copper.'' Archives of Environmental Contamination and Toxicology, 57, 116-122.
  • Becker, M. H., and Harris, R. N. (2010). ''Cutaneous bacteria of the redback salamander prevent mortality associated with a lethal disease.'' PLoS One, 5(6), e10957.
  • Bergeron, C. M., Bodinof, C. M., Unrine, J. M., and Hopkins, W. A. (2010). ''Mercury accumulation along a contamination gradient and nondestructive indices of bioaccumulation in amphibians.'' Environmental Toxicology and Chemistry, 29, 980-988.
  • Brodie, E. D., Jr., and Brodie, E. D. III (1980). ''Differential avoidance of mimetic salamanders by free-ranging birds.'' Science, 208, 181-182.
  • Bruce, R. C. (2008). ''Intraguild interactions and population regulation in plethodontid salamanders.'' Herpetological Monographs, 2008, 31-53.
  • Brucker, R. M., Baylor, C. M., Walters, R. L., Lauer, A., Harris, R. N., and Minbiole, K. P. C. (2008). ''The identification of 2,4-diacetylphloroglucinol as an antifungal metabolite produced by cutaneous bacteria of the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 43, 39-43.
  • Brucker, R. M., Harris, R. N., Schwantes, C. R., Gallaher, T. N., Flaherty, D. C., Lam, B. A., and Minbiole, K. B. C. (2008). ''Amphibian chemical defense: Antifungal metabolites of the microsymbiont Janthinobacterium lividum on the salamander Plethodon cinereus.'' Journal of Chemical Ecology, 34, 1422-1429.
  • Burton, T.M. (1975). ''Salamander populations and biomass in the Hubbard Brook Experimental Forest, New Hampshire.'' Copeia, 1975(3), 541-546.
  • Cabe, P. R., Page, R. B., Hanlon, T. J., Aldrich, M. E., Connors, L., and Marsh, D. M. (2007). ''Fine-scale population differentiation and gene flow in a terrestrial salamander (Plethodon cinereus) living in a continuous habitat.'' Heredity, 98, 53-60.
  • Cassell, R. W., and Jones, M. P. (2005). ''Syntopic occurrence of the erythristic morph of Plethodon cinereus and Notophthalmus viridescens in Pennsylvania.'' Northeastern Naturalist, 12, 169-172.
  • Davis, A. K. (2010). ''Lead-phase and red-stripe color morphs of red-backed salamanders Plethodon cinereus differ in hematological stress indices: A consequence of differential predation pressure?'' Current Zoology, 56, 238-243.
  • Deitloff, J., Adams, D. C., Olechnowski, B. F. M., and Jaeger, R. G. (2008). ''Interspecific aggression in Ohio Plethodon: implications for competition.'' Herpetologica, 64, 180-188.
  • Ducey, P.K., Schramm, K., and Cambry, N. (1994). ''Interspecific aggression between the sympatric salamanders, Ambystoma maculatum and Plethodon cinereus.'' American Midland Naturalist, 131, 320-329.
  • Fitzpatrick, B. M., Shook, K., and Izally, R. (2009). ''Frequency-dependent selection by wild birds promotes polymorphism in model salamanders.'' BMC Ecology, 9, 12.
  • Gabor, C.R., and Jaeger, R.G. (1995). ''Resource quality affects the agonistic bevariour of territorial salamanders.'' Animal Behavior, 49, 71-79.
  • Gabor, C.R., and Jaeger, R.G. (1999). ''When salamanders misrepresent threat signals.'' Copeia, 1999(4), 1123-1126.
  • Gillette, J. R., Jaeger, R.G., and Peterson, M.G. (2000). ''Social monogamy in a territorial salamander.'' Animal Behavior, 59, 1241-1250.
  • Griffis, M. R., and Jaeger, R. G. (1998). ''Competition leads to an extinction-prone species of salamander: interspecific territoriality in a metapopulation.'' Ecology, 79, 2494-2502.
  • Grover, M. C. (2000). ''Determinants of salamander distributions along moisture gradients.'' Copeia, 2000, 156-168.
  • Grover, M. C., and Wilbur, H. M. (2002). ''Ecology of ecotones: interactions between salamanders on a complex environmental gradient.'' Ecology , 83, 2112-2123.
  • Grover, M.C. (1998). ''Influence of cover and moisture on abundances of the terrestrial salamanders Plethodon cinereus and Plethodon glutinosis.'' Journal of Herpetology, 32, 489-497.
  • Grover, M.C. and Wilbur, H.M. (2002). ''Ecology of ectones: interactions between salamanders on a complex environmental gradient.'' Ecology, 83, 2112-2123.
  • Hairston, N.G. (1996). Long-term studies of vertebrate communities. Academic Press, New York, NY.
  • Harris, R. N., Brucker, R. M., Walke, J. B., Becker, M. H., Schwantes, C. R., Flaherty, D. C., Lam, B. A., Woodhams, D. C., Briggs, C. J., Vredenburg, V. T., and Minbiole, K. P. C. (2009). ''Skin microbes on frogs prevent morbidity and mortality caused by a lethal skin fungus.'' The ISME Journal, 3, 818-824.
  • Harris, R. N., Lauer, A., and Simon, M. A. (2009). '' Addition of antifungal skin bacteria to salamanders ameliorates the effects of chytridiomycosis.'' Diseases of Aquatic Organisms, 83, 11-16.
  • Highton, R. (1959). ''The inheritance of the color phases of Plethodon cinereus.'' Copeia, 1959(1), 33-37.
  • Highton, R. (1975). ''Geographic variation in genetic dominance of the color morphs of the red-backed salamander, Plethodon cinereus.'' Genetics, 80, 363-374.
  • Highton, R. (1995). ''Speciation in eastern North American salamanders of the genus Plethodon.'' Annual Review of Ecology and Systematics, 26, 579-600.
  • Highton, R. (1999). ''Geographic protein variation and speciation in the salamanders of the Plethodon cinereus group with the description of two new species.'' Herpetologica, 55, 43-90.
  • Highton, R., and Webster, T.P. (1976). ''Geographic protein variation and divergence in populations of the salamander Plethodon cinereus.'' Evolution, 30, 33-45.
  • Jaeger, R.G. (1978). ''Plant climbing by salamanders periodic availability of plant dwelling prey.'' Copeia, 1978(4), 686-691.
  • Jaeger, R.G. (1979). ''Season spatial distribution of the terrestrial salamander Plethodon cinereus.'' Herpetologica, 35, 90-93.
  • Jaeger, R.G. (1980). ''Density-dependent and density-independent causes of extinction of a salamander population.'' Evolution, 34, 617-621.
  • Jaeger, R.G. (1980). ''Fluctuations in prey availability and food limitation for a terrestrial salamander Plethodon cinereus.'' Oecologia, 44, 335-341.
  • Jaeger, R.G. (1981). ''Dear enemy recognition and the costs of aggression between salamanders.'' Animal Behavior, 29, 1100-1105.
  • Jaeger, R.G. (1981). ''Foraging tactics of a terrestrial salamander Plethodon cinereus choice of diet in structurally simple environments.'' American Naturalist, 117, 639-664.
  • Jaeger, R.G. (1984). ''Agonistic behavior of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1984(2), 309-314.
  • Jaeger, R.G. and M.G. Peterson (2002). ''Familiarity affects agonistic interactions between female Red-Backed Salamanders.'' Copeia, 2002(3), 865-869.
  • Jaeger, R.G., Gabor, R.C., and Wilbur, H.M. (1998). ''An assemblage of salamanders in the southern Appalachian mountains: competitive and predatory behavior.'' Behavior, 135, 795-821.
  • Jaeger, R.G., Gillette, J.R., and Cooper, R.C. (2002). ''Sexual coercion in a territorial salamander: males punish socially polyandrous female partners.'' Animal Behavior, 63, 871-877.
  • Jaeger, R.G., Goy, J., Tarver, M., and Marqez, C. (1986). ''Salamander Plethodon cinereus territoriality pheromonal markers as advertisement by males.'' Animal Behavior, 34, 860-864.
  • Jaeger, R.G., Kalvarsky, D., and Shimizu, N. (1982). ''Territorial behavior of the Red-Backed Salamander Plethodon cinereus expulsion of intruders.'' Animal Behavior, 30, 490-496.
  • Jaeger, R.G., Prosen, E.D., and Adams, D.C. (2002). ''Character displacement and aggression in two species of terrestrial salamanders.'' Copeia, 2002(2), 391-401.
  • Jaeger, R.G., Schwarz, J., and Wise, S.E. (1995). ''Territorial male salamanders have foraging tactics attractive to gravid females.'' Animal Behavior, 49, 633-639.
  • Jaeger, R.G., Wicknick, J.A., Griffis, M.R., and Anthony, C.D. (1995). ''Socioecology of a terrestrial salamander: juveniles enter adult territories during stressful foraging periods.'' Ecology, 76, 533-543.
  • Jaeger, R.G., and Rubin, A.M. (1982). ''Foraging tactics of a terrestrial salamander judging prey profitability.'' Journal of Animal Ecology, 51, 167-176.
  • Kleeberger, S.R. and Werner, J.K. (1982). ''Home range and homing behavior of Plethodon cinereus in northern Michigan.'' Copeia, 1982(2), 409-415.
  • Lang, C. and R.G. Jaeger (2000). ''Defense of territories by male-female pairs in the Red-Backed Salamander (Plethodon cinereus).'' Copeia, 2000(1), 169-177.
  • Lauer, A., Simon, M. A., Banning, J. L., André, E., Duncan, K., and Harris, R. N. (2007). ''Common cutaneous bacteria from the eastern red-backed salamander can inhibit pathogenic fungi.'' Copeia, 2007, 630-640.
  • Maerz, J. C., Nuzzo, V. A., and Blossey, B. (2009). ''Declines in woodland salamander abundance associated with non-native earthworm and plant invasions.'' Conservation Biology, 23, 975-981.
  • Maglia, A.M. (1996). ''Ontogeny and feeding ecology of the Red-Backed Salamander Plethodon cinereus.'' Copeia, 1996(3), 576-586.
  • Mathis, A. (1990). ''Territoriality in a terrestrial salamander the influence of resource quality and body size.'' Behavior, 112, 162-175.
  • Mitchell, J.C. and Woolcott, W.S. (1985). ''Observations of the microdistribution diet and predator-prey size relationships in the salamander Plethodon cinereus from the Virginia Piedmont.'' Virginia Journal of Science, 36, 281-288.
  • Moore, J.-D., and Wyman, R. L. (2010). ''Eastern red-backed salamanders (Plethodon cinereus) in a highly acid forest soil.'' The American Midland Naturalist, 163, 95-105.
  • Moreno, G. (1989). ''Behavioral and physiological differentiation between the color morphs of the salamander Plethodon cinereus.'' Journal of Herpetology, 23, 335-341.
  • Ng, M.V. and Wilbur, H.M. (1995). ''The cost of brooding in Plethodon cinereus.'' Herpetologica, 51, 1-8.
  • Ousterhout, B. H., and Liebgold, E. B. (2010). ''Dispersal versus site tenacity of adult and juvenile red-backed salamanders (Plethodon cinereus).'' Herpetologica, 66, 269-275.
  • Petruzzi, E. E., Niewiarowski, P. H., and Moore, F. B.-G. (2006). ''The role of thermal niche selection in maintenance of a colour polymorphism in redback salamanders (Plethodon cinereus).'' Frontiers in Zoology, 3, 10, doi:10.1186/1742-9994-3-10.
  • Rankin, J. S. (1937). ''An ecological study of parasites of some North Carolina salamanders.'' Ecological Monographs, 7, 169-269.
  • Ransom, T. S. (2010). ''Earthworms, as ecosystem engineers, influence multiple aspects of a salamander’s ecology.'' Oecologia, published online 17 September 2010, DOI: 10.1007/s00442-010-1775-1.
  • Ransom, T. S., and Jaeger, R. G. (2006). ''An assemblage of salamanders in the southern Appalachian Mountains revisited: competitive and predatory behavior.'' Behaviour, 143, 1357-1382.
  • Robertson, J. (2010). ''Mimicry: experimental design and scientific logic.'' An Introduction to Methods and Models in Ecology, Evolution, and Conservation Biology. S. Braude and B. S. Low, eds., Princeton University Press, Princeton, NJ.
  • Simons, R.R., Gelgenhauer, B.E., and Jaeger, R.G. (1994). ''Salamander scent marks: site of production and their role in territorial defence.'' Animal Behavior, 48(11), 97-103.
  • Simons, R.R., Jaeger, R.G., and Gelgenhauer, B.E. (1997). ''Competitor assessment and area defense by territorial salamanders.'' Copeia, 1997(1), 70-76.
  • Takahashi, M. K. and Pauley, T. K. (2010). ''Resource allocation and life history traits of Plethodon cinereus at different elevations.'' The American Midland Naturalist, 163, 87-94.
  • Tilley, S.G., Lundrigan, B.G., and Brower, L.P. (1982). ''Erythrism and mimicry in the salamander Plethodon cinereus.'' Herpetologica, 38, 409-417.
  • Venesky, M. D., and Anthony, C. D. (2007). ''Antipredator adaptations and predator avoidance by two color morphs of the eastern red-backed salamander Plethodon cinereus.'' Herpetologica, 63, 450-458.
  • Woodhams, D. C., Vredenburg, V. T., Simon, M. A., Billheimer, D., Shakhtour B., et al. (2007). ''Symbiotic bacteria contribute to innate immune defenses of the threatened mountain yellow-legged frog, Rana muscosa.'' Biological Conservation, 138, 390-398.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures are needed. It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Red-backed salamanders may help control pest populations where they occur in high numbers.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Wikipedia

Red Back Salamander

The red back (or redback or red-backed) salamander (Plethodon cinereus) is a small, hardy woodland salamander. It inhabits wooded slopes in Eastern North America; west to Missouri; south to North Carolina; and north from southern Quebec and the Maritime Provinces in Canada to Minnesota. It is also known as the Northern redback salamander to distinguish it from the Southern redback salamander (Plethodon serratus). The red-backed salamander is found mostly in two color variations: the nominate red variety, 'redback', as well as a darker phase known as the 'leadback' which lacks most or all of the red pigmentation found in the red phase.[1] However, one can also find a variety of other color variations (e.g., stripe of yellow, orange, white, or an uncommon erythristic morph, which is completely reddish-orange).

Contents

Reproduction and biomass

Males and females typically establish separate feeding and/or mating territories underneath rocks and logs. However, some red back salamanders are thought to engage in social monogamy, and may maintain co-defended territories throughout their active period. Breeding occurs in June and July. Females produce from 4–17 eggs in a year. The eggs will hatch in 6–8 weeks. Not much is known about the dispersal of neonates, although it is thought that neonates and juveniles are philopatric. The species largely consumes invertebrates and other detritus dwellers. In some areas with good habitat, these salamanders are so numerous that their population densities may surpass 1,000 individuals per acre.[2]

Captivity

Red back salamanders are very popular pets because of their hardiness. Cages do not need to be exceptionally large, and a common sweater box may be used with small holes poked on the sides. This can be done by using a hot pin. The enclosure must have a secure lid, for red back salamanders are able to climb on smooth surfaces. They require driftwood and some sort of ground cover in them to keep the salamander feeling secure. The environment must be partially moist and kept out of direct sunlight or the salamander's skin will dry out and it will suffocate. Too much water can cause stress especially when it forms pools (salamanders can swim but hate it because of the lack of oxygen present in water and will drown if they cannot escape).

Ideal temperature for them would be 58 to 65 °F (14 to 18 °C), if it gets over 75 °F (24 °C) the salamander will either dry out and suffocate, or burrow very deeply. If the temperature reaches anywhere from 35–50 °F (2–10 °C) they will start to hibernate and anywhere below freezing they will die if they are not underground. Staple diets consist of small black or red ants, small spiders, pinhead crickets, chopped earthworms, small mealworms[3] or even other salamanders. One should be cautious when putting two red back salamanders that were not found together in a small container with little food; as they are canibalistic, they may eat their own eggs and hatchlings.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some published literature on this species actually pertains to Serratus, which was given full species status in mid-1970s.

Mahoney (2001) used mtDNA data to examine phylogenetic relationships of western and eastern Plethodon and Aneides. She found strong support for eastern Plethodon as a clade, but monophyly of Aneides was only weakly supported in some analyses, though "the monophyly of this clade is not in doubt." Analyses indicated that Plethodon stormi and P. ELONGATUS are clearly sister taxa, and P. DUNNI and P. VEHICULUM also are well-supported sister taxa. Plethodon larselli and P. VANDYKEI appear to be closely related, whereas P. NEOMEXICANUS did not group with any other lineage. All analyses yielded a paraphyletic Plethodon but constraint analyses did not allow rejection of a monophyletic Plethodon. Mahoney recommended continued recognition of Aneides as a valid genus and adoption of the metataxon designation for Plethodon*, indicating this status with an asterisk. (A metataxon is a group of lineages for which neither monophyly nor paraphyly can be demonstrated.)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!