Overview

Comprehensive Description

Description

G. carolinensis is distinguished from other species by foot structure and coloration. The toe tips are round and tapered, and the toes are not webbed. It has a brown or tan dorsum,a mottled venter, and usually has a dark median wedge.

  • Bailey, J, R. (1936). ''Microhyla carolinensis in northeastern Tennessee.'' Copeia, 1936(2), 115.
  • Carter, H. A. (1934). ''Georgia records of Gastrophryne carolinensis.'' Copeia, 1934(3), 138.
  • Nelson, C. (1972). ''Gastrophryne usta. Two-spaded Narrow-mouthed Toad.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 123.1-123.2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range extends from southern Maryland to southeastern Kansas, and south to the Florida Keys, Gulf Coast, and eastern Texas. Scattered disjunct populations occur along the northern and western margins of the range (Conant and Collins 1991). Introduced on the Little and Great Bahama banks, and on Grand Cayman Island, Cayman Islands, where very abundant(Schwartz and Henderson 1988, Schwartz and Henderson 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is native to the USA from southern Maryland to southeastern Kansas, south to Florida Keys and eastern Texas. It has scattered disjunctive populations along the northern and western margins of its range (Conant and Collins 1991). It is introduced on the Little and Great Bahama banks, and on Grand Cayman Island, Cayman Islands, where it is very abundant (Schwartz and Henderson 1988, Schwartz and Henderson 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

G. carolinensis is found only in the southeastern United States. Its range extends from the east shore of the Chesapeake Bay southward to Key West, Florida, and westward to eastern Texas, Oklahoma and Kansas. The range extends as far westward as Tulsa, Oklahoma and as far southwest as Kerr County and Brownsville, Texas. Disjunct populations occur in Maryland, southwestern Mirginia, Kentuchy, Illinois, Iowa and Missouri.
In piedmont valleys, G. carolinensis is found up to elevations of 800 ft. (Carter 1934) and 1500 ft. (Bailey 1936) and up to 2400 ft. in Oklahoma.

  • Bailey, J, R. (1936). ''Microhyla carolinensis in northeastern Tennessee.'' Copeia, 1936(2), 115.
  • Carter, H. A. (1934). ''Georgia records of Gastrophryne carolinensis.'' Copeia, 1934(3), 138.
  • Nelson, C. (1972). ''Gastrophryne usta. Two-spaded Narrow-mouthed Toad.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 123.1-123.2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The Eastern Narrowmouth Toad or Gastrophryne carolinensis can be found throughout the entire southeastern portion of North America and the Florida Keys. Their range extends into eastern Texas and Oklahoma. They have also been introduced to the Bahamas (Conant and Collins, 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

One distinguishing characteristic of G. carolinensis is the fold of skin that runs across the head directly behind their eyes. This flap of skin can fold forward to remove insects that are attacking the eyes. Color varies depending on the habitat. They can range from light tan to brown, red, and even nearly black. They have a broad dark middorsal area with light strips that are commonly covered by patches, spots, and mottlings of dark or light pigment. The stomach is strongly mottled. They also lack a tympanum. The body of G. carolinensis is round with a narrow head that is sharp and pointed, and has a small mouth. There is sexual dimorphism in color. Males have a darkly pigmented throat whereas females do not. (Conant and Collins, 1998)

Tadpoles of G. carolinensis are black and have flecks of dark blue. They also may have a tan lateral line. The tailfins have dark specks on them, as well as dark tips (Bartlett, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 4 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Eastern narrow-mouthed toads occur a wide variety of habitats, usually in areas with sandy or loamy soils. On land, they range up to several hundred meters from water. They burrow underground or hide beneath objects in daytime and when conditions are cold or dry. Breeding sites include lakes, ponds, sloughs, flooded roadside ditches, swamps, stream margins, rain puddles, etc., in both temporary and permanent waters. Males call from sheltered locations, often from beneath objects at the water's edge or partially buried in grass.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It occupies a wide variety of shaded moist habitats. It burrows into soil or hides in or under surface cover or debris when inactive. Males call from sheltered locations, often from beneath objects at water's edge or partially buried in grass (Schwartz and Henderson 1991). Eggs and larvae develop in lakes, ponds, sloughs, flooded roadside ditches, swamps, stream margins, rain puddles, etc. Uses both temporary and permanent waters. Can persist in human modified habitats such as residential areas.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gastrophryne carolinensis has a wide variety of habitats with only two requirements. These are shelter and moisture. Narrowmouth toads are very good burrowers, and therefore may be abundant in an area without leaving any visable signs. These toads can be found by over turning boards, logs, or other shelters. Also, they can be found in vegetable debris or sawdust piles (Conant and Collins, 1998). Another place that narrowmouth toads can be found is just under the surface of suburban lawns that are abundant in sand and are watered often (Bartlett, 1999).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between breeding pools and adjacent nonbreeding terrestrial habitats. In northern Florida, individuals migrated up to 914 m from the nearest breeding pool (Dodd and Cade 1998); movements between a pond and upland habitat were nonrandom, but narrow corridors did not appear to be used (Dodd and Cade 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Metamorphosed frogs eat various small arthropods, especially ants, termites, and small beetles. Larvae eat organic debris, algae, and plant tissue.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of the Eastern Narrowmouth Toad consists mostly of insects like beetles, termites, and especially ants. This toad has been found feeding right at the openings to anthills.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but likely exceeds 100,000. In Florida and eastern Texas, common to abundant even in many suburban situations (Bartlett and Bartlett 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

The toxic skin secretions of these toads protect them from many kinds of predators and may deter ant attacks as the toad forage near ant mounds. Skin secretions also help the male cling to the female while mating.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: These little toads are most active at night during wet weather of spring and summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
6.1 years.

Average lifespan

Status: captivity:
6.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.8 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs usually after heavy rains, mostly in spring and summer but as early as March or as late as November. Individual females produce a clutch of up to about 850 eggs (divided among several batches). Aquatic larvae hatch from floating jelly in a couple days, metamorphose into the terrestrial form in about 3-10 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding sites are usually in shallow water, but deep water is also used if covered by a mat of floating vegetation. These breeding sites can be anything from shallow ditches, to semipermanent ponds and irrigated agricultural areas. Rains initiate their breeding season, which may occur between early April and October in the south or midsummer in areas farther to the north. Most often the narrowmouth toad will call from the grasses surrounding the breeding pool. The male also will sometimes call the female while floating in the water, although it is more rare.

Eggs are deposited in small floating clusters, and up to 800 eggs have been reported coming from a single female (Bartlett, 1999).

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
547 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gastrophryne carolinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GAC---GACCAAATTTATAACGTAATTGTTACCGCCCACGCCTTTGTAATAATTTTTTTTATAGTTATACCAATTATGATTGGTGGCTTCGGCAATTGACTAATTCCCCTGATACTGGGAGCACCAGATATAGCTTTCCCCCGAATAAATAACATAAGCTTTTGACTTCTTCCACCATCCTTTCTCCTTCTTCTAGCATCGTCTGCAGTAGAAGCAGGTGCCGGAACCGGATGAACTGTTTATCCCCCATTAGCAGGCAACCTTGCACATGCCGGCCCATCAGTTGACCTCACTATTTTTTCACTCCACCTTGCAGGCGTTTCCTCCATCCTCGGGGCTATTAACTTTATTACAACTATTATTAACATAAAACCCCCCTCAGTAACCCAATACCAAACCCCATTATTTGTCTGATCTGTTATTATTACCGCTGTACTTCTCCTTCTTTCCCTTCCAGTCCTCGCAGCGGGAATTACTATACTCCTCACAGACCGCAACCTTAATACCACTTTTTTTGACCCCGCAGGTGGAGGCGACCCAATTCTCTATCAACACCTGTTCTGATTCTTTGGGCACCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gastrophryne carolinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson, Blair Hedges

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is represented by many and/or large populations throughout most of the range (Nelson 1972). In Florida and eastern Texas, common to abundant even in many suburban situations (Bartlett and Bartlett 1999). The introduced population on Grand Cayman is very abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation methods are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gastrophryne carolinensis

The eastern narrow-mouthed toad (Gastrophryne carolinensis) is a species of microhylid frog. It is a relatively small, toad-like amphibian found in damp, shady habitats. The species is highly fossorial, and feeds primarily on ants. These North American microhylids (Family: Microhylidae) are distinguished from true toads (genus Bufo), and other anurans due to their moist, smooth skin, their lack of eardrum or tympanum, it’s distinguishable squat body shape, and the unique fold of skin superior to their eyes.[2][3] It is found in the United States, from southern Maryland to the Florida keys, west to Missouri and Texas. While not a true toad, they are so called because they are terrestrial.

Taxonomy and Nomenclature[edit]

Members of Gastrophryne carolinensis belong to one of the largest anuran families, the microhylids.[4] No subspecies are currently recognized.[5]

Description[edit]

Eastern narrowmouth toads are comparably small, growing to a maximum length of approximately 53 mm (2.1 in). They have an oval shaped body and a narrow head with a pointed snout. They vary in color from brown, grey, to green, often with black and white spotting. Gastrophryne carolinensis toads have a typical teardrop-shaped body that is characteristic to members of the Microhylidae family. Though its morphology lacks a tympanum (eardrum), the subgular vocal sac is clearly visible.[2] The Eastern narrow-mouthed toad can grow to approximately 38 mm (1.5 in) long. They have a distinguishable pointed, narrow head with a small mouth, and a fold of skin that runs immediately behind their small eyes, and when viewed from above, the species appears ovoid.

An uncommon characteristic among other varieties of toads is their skin. Though most toads have rough skin that is usually lumpy in appearance and texture, the skin of Gastrophryne carolinensis is smooth and without ridges or warts. Yet, the skin is extremely tough, which most likely protects themselves from the ants they feed upon.[6][7]

The color of the toad varies from brown, red, light tan, black, grey, to olive green, and can change its color depending on its activities and environment.[2] The colors on its sides are generally faded, but its dorsum is dark and broad with various light or dark spots, mottling, or patches that cover the light strip along its middorsal area. Its stomach is generally highly mottled, but its ventral surface is nearly light or unmarked. The venters of certain Narrow-mouthed Toads in the Great Plains are generally unmarked, or virtually so, while the venters of eastern toads are strongly pigmented.[8]

Its legs are generally stubby with short, heavy legs, and the tips of the toes are round and tapered.[9] Like the Leptodactylidae, the toes are absent of webbing or toe pads.[5] However, the heels on the back foot have one “spade” or tubercle for digging.[10]

The sex of the Eastern Narrow-mouthed Toad can easily be determined due to its characteristic sexual dimorphism. The coloration of the throat region for males is dark and highly pigmented, while the females throat is absent of this discriminate coloration.[8]

Ecology/Habitat[edit]

Altitudes[edit]

The narrow-mouthed toads can reach elevations up to 550 meters (1,800 feet). They are generally absent from most Blue Ridge Mountains and the Appalachia's.[11]

Geographic location[edit]

G. carolinensis is only one of three species belonging to the Microhylidae family that is native to the United States. The species resides in the southeastern quarter of the United States, extending from west to Missouri and eastern Texas, and from southern Maryland to the Florida Keys, as well as in an isolated colony in Iowa.[12][13] Many have also been introduced to the little and great Bahamas, as well as the Cayman Islands.[14]

Habitat/Range Description[edit]

Although they live in a broad range of habitats and are rather ubiquitous, their most important environmental variables must include moisture and shelter.[15] They reside in either freshwater or terrestrial systems, and are able to utilize both temporary and permanent waters, as well as human modified habitats.[1] The members of this species tend to discount dry areas and mountains, though some may live in near desert-like conditions.[13][5]

General habitat types include:

  • Borders of swamps
  • Cypress-gum swamps
  • Bottomland hardwoods
  • Live-oak ridges
  • Pine-oak uplands
  • Sandy woodlands and hillsides
  • Open woods
  • Pine forests
  • Coastal secondary dune scrub forest
  • Maritime forests
  • Small streams
  • Beneath logs[8]
  • Near ponds with fallen logs and other debris[10]
  • Urban habitats such as:
    • Woodland lots
    • Sandy pinelands
  • Suburban Habitats such as:
    • Sandy soils around the lawn[2]

Population[edit]

The species population is currently large throughout most of its range, and also in many suburban locations. Additionally, the species introduced to Grand Cayman is equally abundant. Though this particular species of microhylid’s experienced a severe population bottleneck effect in the past, its succeeding expansion has allowed its current population trend to remain stable.[1][12]

Reproduction[edit]

Size/description at reproductive maturity[edit]

Adults range from 22 to 35 mm (0.9-1.4 inches) in body length; females usually attain larger sizes than males and exceed a little over 1.25 inches. Adult males are at an inch or less in length.[2] Males can be distinguished from females during breeding season due to the visibility of a dark-pigmented vocal sac on their throat. Breeding males also exhibit enlarged tubercles on the chin, as well as a visible anterior edge of the lower jaw.[5]

Breeding habitat[edit]

G. carolinensis reproduce in aquatic habits, and may breed in either temporary or permanent waters. The toad species will breed in deep water only if it is covered with a dense mat of floating vegetation/debris.[8] They may also breed in ephemeral aquatic habitats such as temporary ponds, roadside ditches, borrow pits, deep wheel ruts in dirt roads, and shallow drainage ditches.[2]

Breeding migrations[edit]

The male toad species call for mating at reproductive maturity. They generally call from the edge of the water when concealed by plant debris. Though more rare, they have also been observed to call while floating in the water with their forelimbs resting on stem or twig.[10] Many times, they will also extend their hind limbs.[14] They can also call the female while sitting on a bank, or on rainy nights while buried in the damp sand with only their head and vocal sac exposed.[2]

The mating call sounds like a high-pitched, penetrating, nasal sheep-like bleat. It may also sound like a buzzing quality, and lasts for approximately 1 to 1.5 seconds.[8] Unlike other frog and toad species, G. carolinensis does not exhibit the typical trill sound in their mating call.

In the south, April to October rains initiate their breeding season, or midsummer in areas farther to the north.[6] They congregate to breeding ponds depending on the heavy spring and early summer rains. The G. carolinensis species is particularly successful at breeding in ephemeral bodies of water.[16] When the male amplexes the female, special glands in the sternal region of males secretes a sticky substance to allow adhesion of breeding pairs, and also presumably to help him resist other males’ attempts to dislodge him.[5] Breeding grasp (amplexus) for the toad species is axillary (behind the forelimbs).[2]

Egg deposition[edit]

The female spawns clear marble-like eggs on the surface of the water, which is deposited as a mosaic structure.[17] The egg mass is round or squarish, with approximately 10 to 150 eggs deposited as clusters in each mass.[18] The female deposits over 800 tiny eggs that hatch within 1.5 to 3 days.[19]

Larvae Metamorphosis[edit]

Tadpoles transform in approximately 23–67 days, and unlike other anurans, the larvae of G. carolinensis filter-feed on plankton.[16]

Post-metamorphic[edit]

The tadpole’s head has a pointed head with lateral eyes, and appears dorso-laterally flattened when viewed from above. Their bodies are dark in color (almost jet black), and are flecked with blue. Its belly is marked with lateral whitish blotches, and the intestinal coil is not transparent through the skin.[2] A lateral white stripe extends from the body to the tail, and a single spiracle is visible from the anus.[20] The tadpole’s head is slightly pointed, and its tailfins are dark dipped and dark-flecked. They lack beaklike mandibles and the specialized labial tooth generally associated with most tadpoles. The newly transformed toads range from approximately 7–12 mm (0.3-0.5 in) in body length. Like adults, they are found to share the same habitat, and the older stages of the larvae are also toxic to many predators. The males reach sexual maturity in a year, while the females reach sexual maturity in approximately 1–2 years of age.[5]

Feeding behavior[edit]

These toads feed predominantly on ants, termites, small beetles, and other various arthropods, and have been found feeding immediately at the opening of anthills.[16][6] These various arthropods make up to 75% of their diet, though other prey include small snails, spiders, mites, collembolans, and lepidopterans.[5][11]

Life history and behavior[edit]

  • Movement

The G. carolinensis toads are weak jumpers, and thus, either run or move by short and rapid hops.[10] In general, the males move more than the females.[2]

  • Sleeping patterns

These toads are mainly nocturnal, and generally remain underground or hidden in debris during the day.[2]

A few species are reported to prey on the Gastrophryne carolinensis toads such as the Copperheads (Agkistrodon contortrix) and the common garter snakes (Thamnophis sirtalis). Other known predators include the glossy watersnakes (Regina rigida), the Eastern cottonmouths (Agkistrodon piscivorus), and the Cattle egrets (Bubulcus ibis).

  • Anti-predator methods

This particular toad species avoids predators by burrowing, seeking cover, and/or nocturnal activity patterns. Chemically, they are also capable of producing mucous secretions that produce a violent burning sensation, irritate membranes. The toxins secreted from their skin deter predators, but they also plays a role in inhibiting ant attacks when individuals forage near ant mounds.

  • Other behavior

The G. carolinensis toads are accomplished burrowers, and are seldom seen on the surface of the ground. Though they may be present in large numbers, their existence is hardly suspected.[2]

  • Territories

Though they are not known to establish territories, their mating calling positions can be as close as 2 cm, or as distant as several meters apart.

Fossil record[edit]

Though little is known about its fossil records and evolutionary history, a few fossils belonging to the Miocene Epoch have been found in Florida.[12]

The ilia of Gastrophryne is very distinctive and different from other small anurans. Based on observances of the different developmental features of the ilium between G. carolinensis and G. olivacea, it appears that the two species could have differentiated from the early Miocene.[15]

Conservation status[edit]

According to the IUCN Red List category and criteria, Gastrophryne carolinensis is listed as a species of least concern due to its presumed large population, wide distribution, and ability to adapt to various habitats. Thus, no conservation actions are currently needed, though the population in northern Maryland is protected as an endangered species.[1][12]

References[edit]

  1. ^ a b c d "'". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. 2004. Retrieved 22 March 2014. 
  2. ^ a b c d e f g h i j k l Bartlett, Richard D. and Patricia Pope. A Field Guide to Texas Reptiles & Amphibians. Houghton Mifflin. p. [12–13]. 
  3. ^ Anonymous, "Gastrophryne Carolinensis, Illinois Natural History Survey", Illinois Natural History Survey – University of Illinois, 28 Oct. 2008
  4. ^ Frost, Darrel R.; Grant, Taran; Faivovich, Julián; Bain, Raoul H.; Haas, Alexander; Haddad, Celio F. B.; De Sa, Rafael O.; Channing, A.; Wilkinson, Mark; Donnellan, Stephen C.; Raxworthy, Christopher J.; Campbell, Jonathan A.; Blotto, Boris L.; Moler, Paul; Drewes, Robert C.; Nussbaum, Ronald A.; Lynch, John D.; Green, David M.; Wheeler, Ward C. (2006). The amphibian tree of life. Bulletin of the American Museum of Natural History ; no. 297. New York: American Museum of Natural History. hdl:2246/5781. 
  5. ^ a b c d e f g Jensen, John B. Amphibians and Reptiles of Georgia. University of Georgia. p. [94]. 
  6. ^ a b c Kalis, D.,"Gastrophryne carolinensis", Animal Diversity Web, 24 Sept. 2010
  7. ^ Stebbins, Robert C. A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin. p. [77]. 
  8. ^ a b c d e Conant, Roger. A Field Guide to Reptiles and Amphibians. Houghton Mifflin. p. [294–295]. 
  9. ^ Anonymous, "Gastrophryne carolinensis", Kansas Herpetofaunal Atlas, Sterberg Museum of Natural History, 1999-2010
  10. ^ a b c d Anonymous, "Gastrophryne carolinensis", University of Texas College of Natural Sciences and the Texas Memorial Museum, 25 Nov. 1998
  11. ^ a b Lannoo, Michael J (2005). Amphibian Declines: the Conservation Status of United States Species. University of California, Berkeley. 
  12. ^ a b c d Makowsky, R; Chesser, J; Rissler, LJ (2009). "A striking lack of genetic diversity across the wide-ranging amphibian Gastrophryne carolinensis (Anura: Microhylidae)". Genetica 135: 169–183. doi:10.1007/s10709-008-9267-5. PMID 18392940. 
  13. ^ a b Anonymous, "Narrow-Mouthed Frogs: Microhylidae – Eastern Narrow-mouthed Toad (Gastrophryne Carolinensis)", Species Accounts, 23 Sept. 2010
  14. ^ a b Schwartz, Albert; Henderson, Robert W (1991). Amphibians and Reptiles of the West Indies: Descriptions, Distributions, and Natural History. University of Florida. p. [94]. 
  15. ^ a b Holman, J. Alan (2003). Fossil Frogs and Toads of North America. Indiana UP. p. [185–186]. 
  16. ^ a b c Hopkins, William Alexander; DuRant, Sarah Elizabeth; Staub, Brandon Patrick; Rowe, Christopher Lee; Jackson, Bruab Ogukkuo. "Reproduction, embryonic development, and maternal transfer of contaminants in the amphibian Gastrophryne carolinensis". Environmental Health Perspectives 114: 661–665. 
  17. ^ Wright, Albert Hazen. Life Histories of the Frogs of Okefinokee Swamp, Georgia. Comstock Pub. Associates. p. [15, 31, 37]. 
  18. ^ Dodd, C. Kenneth. The Amphibians of Great Smoky Mountains National Park. University of Tennessee. p. [233]. 
  19. ^ Trauth, Stanley E.; Walter, E. Meshaka, Jr.; Cox, Robert L. (1999). "Post-metamorphic Growth and Reproduction in the Eastern Narrowmouth Toad (Gastrophryne Carolinensis) from Northeastern Arkansas". Journal of the Arkansas Academy of Science (Florida: Department of Biological Sciences, Arkansas State University). 53:120 124. 
  20. ^ Anonymous,"Eastern Narrow-mouthed Toad, Gastrophryne Carolinensis", USGS National Wetlands Research Center, U.S. Department of the Interior, 23 Oct. 2009
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!