Overview

Comprehensive Description

Description

Tail cylindrical, shorter than body with head. Conspicuous parotoid glands behind eyes are pigmented. Dorsal and lateral skin black, with large yellow to orange spots and/or bands. Yellow pattern varies among subspecies, although it is not entirely reliably for subspecies identification. Belly skin black or brownish. Females generally larger than males and possess relatively shorter extremities and tail. Male's cloaca much more swollen than female's cloaca.

Size: up to 250 mm, sometimes almost 300 mm.
 
The systematics of the genus Salamandra is in progress. Some forms earlier recognized as subspecies of the species S. salamandra have acquired specific rank.

  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K. and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR. Prosveshchenie, Moscow.
  • Greven, H. and Thiesmeier, B., eds. (1994). Biology of Salamandra and Mertensiella (Mertensiella Supplement 4). DGHT, Bonn.
  • Klewen, R. (1988). Die Landsalamander Europas, Teil I, Die Gattungen Salamandra und Mertensiella. A.Ziemsen, Wittenberg Lutherstadt.
  • Freytag, G.E. (1955). Feuersalamander und Alpensalamander (Die Neue Brehm Bücherei Bd. 142). A. Ziemsen, Wittenberg-Lutherstadt.
  • Thiesmeier, B. (1992). Okologie des Feuersalamanders. Westarp Wissenschaften, Essen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is present across much of central, eastern and southern Europe. In the former Soviet Union, it is known only from the mountains and foothills of the Ukrainian Carpathians. The populations of this species in Iberia are very fragmented (there is a small Area of Occupancy within the wider Extent of Occurrence). The populations of Salamandra species reported from western Anatolia, Turkey, require further investigation into the species involved and are not evaluated in this account. It occurs from lowland areas up to 2,500m asl (in central Spain).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Fire Salamander occurs in central and southern Europe, with parts of its range extending into northern Africa and the Middle East.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

The species is distributed from the Iberian Peninsula to Iran and from North Africa to North Germany. The genus consists of variable forms, the taxonomy of which has not been revised as yet. Some of the former subspecies of Salamandra salamandra are now recognized as separate species and the separation of more species can be expected. Populations of S. s. salamandra from Turkey are genetically closely related to the S. s. infraimmaculata group. The species inhabits mainly deciduous and mixed, sometimes conifer forests. Populations inhabiting anthropogenic landscapes and unforested habitats can be considered, as a rule, as relicts of formerly forest dwellers. The spotted coloration of this salamander seems to play two roles: cryptic, when the spots on black background allow the animal to hide on the forest floor, where there are alternate spots of sun and shadow, and aposematic, where bright spots indicate poisonous skin secretions.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K. and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR. Prosveshchenie, Moscow.
  • Greven, H. and Thiesmeier, B., eds. (1994). Biology of Salamandra and Mertensiella (Mertensiella Supplement 4). DGHT, Bonn.
  • Klewen, R. (1988). Die Landsalamander Europas, Teil I, Die Gattungen Salamandra und Mertensiella. A.Ziemsen, Wittenberg Lutherstadt.
  • Freytag, G.E. (1955). Feuersalamander und Alpensalamander (Die Neue Brehm Bücherei Bd. 142). A. Ziemsen, Wittenberg-Lutherstadt.
  • Thiesmeier, B. (1992). Okologie des Feuersalamanders. Westarp Wissenschaften, Essen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Salamandra salamandra is the largest species in the family Salamandridae, ranging from 15 to 25cm long, with some individuals exceeding 30cm. Its body is black with yellow or orange markings that occur in patterns varying from discrete spots to large splotches or bands. The underside is usually dark grey with fewer spots. Body length exceeds tail length, and the limbs are stout. Females tend to be slightly larger than males, but little other sexual dimorphism exists.

Range length: 15 to 30 cm.

Other Physical Features: ectothermic ; bilateral symmetry ; poisonous

Sexual Dimorphism: female larger

Average mass: 19.1 g.

Average basal metabolic rate: 0.00857 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is associated with wet cool deciduous, mixed, or rarely, coniferous forests with well shaded brooks and small rivers. Within the mountain forest belt, the species can be found in woodlands, glades and forest edges, rocky slopes, dense bush, and herbaceous vegetation. It is possible, that the occurrence of S. salamandra on woodless mountain pastures and within hayfields indicates the past existence of forests. In the Iberian Peninsula the species may be found in upland Mediterranean type forest and associated habitats. The species prefers microhabitats covered with dense leaf-litter and moss. In general, the female gives birth to well-developed larvae, that complete metamorphosis in streams, ponds and still waters. However, the subspecies, S.s. bernardezi and S.s. fastusa may give birth to two to eight fully metamorphosed young on land. The species does tolerate some habitat modification, and has even been found in gardens.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

S. salamandra prefers woodland habitats, especially those with much shade and nearby ponds or streams for breeding. It spends much time beneath rocks or logs, or hiding in crevices to stay protected and moist.

Habitat Regions: temperate

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of S. salamandra consists of invertebrate prey and is generally a mixture of the most abundant species available in the salamander's particular habitat. These include soft-bodied prey such as earthworms and slugs, and harder-bodied prey such as flies, millipedes, centipedes, and beetles among others. Young Fire Salamanders seem to imprint on their preferred prey types during the first few weeks following metamorphosis from the larval stage to the adult.

S. salamandra appears to employ different hunting strategies for different situations. When some light is available, it uses prey movement as its cue and ignores stationary prey. However, when hunting in the dark, it uses olfaction as its primary cue since vision is impaired. In this situation it will attack prey, if the prey is stationary, as long as it can detect the odor of the prey item.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Primary Diet: carnivore (Insectivore , Molluscivore , Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
24 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years (captivity) Observations: Anecdotal evidence, which may or may not be true, suggests these animals may live up to 50 years. It is generally classified as viviparous.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Fertilization is internal via deposition of a spermatophore by the male. The female may retain the sperm for some time before ovulation and fertilization occur. This helps to account for the long gestation between the peak of mating season in the summer and the birth of the larvae in the following spring, after the winter hibernation. This seasonal pattern shifts in the warmer Middle Eastern populations, where breeding occurs October-January, with larval birth occuring the following November-December, after the period of inactiviy that occurs during the arid summer. Breeding occurs on land, and the females deposit their young in water.

S. salamandra is considered viviparous. The female retains the developing eggs, and the embryos derive their nourishment from the yolk. At birth the larvae are usually quite advanced, although some populations deposit young that have already metamorphosed.

Fire Salamanders may live in excess of 14 years; therefore, females have the chance to breed multiple times during their lives.

Breeding interval: Breeds once per year

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous ; sperm-storing ; delayed fertilization

  • Pough, H., R. Andrews, J. Cadle, M. Crump, A. Savitzky. 1998. Herpetology. Upper Saddle River, NJ: Prentice Hall.
  • Lanza, B., S. Vanni, A. Nistri. 1998. Salamanders and Newts. Pp. 60-75 in H Cogger, R Zweifel, eds. Encyclopedia of Reptiles and Amphibians. San Diego, CA: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Salamandra salamandra

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBAP749-09|EU880331|Salamandra salamandra| ACTCGATGATTGTTTTCTACAAATCACAAAGACATTGGCACCCTTTACCTGATTTTCGGTGCATGAGCTGGCATAGTGGGTACAGCCCTT---AGTCTCCTAATCCGGGCTGAACTAAGCCAACCGGGCACTTTTCTTGGGGAT---GACCAGATTTATAATGTAATTGTAACCGCACATGCTTTTGTAATGATCTTCTTTATAGTAATGCCTGTGATAATTGGAGGCTTTGGAAACTGACTTGTCCCCTTAATG---ATCGGGGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTCTGACTCCTTCCCCCATCATTTTTACTATTACTAGCCTCATCCGGAGTGGAAGCTGGTGCAGGAACAGGATGAACAGTTTACCCCCCCCTTGCTGGAAATCTGGCCCATGCAGGCGCCTCCGTTGACCTA---ACAATCTTTTCTTTACATTTAGCAGGGGTATCCTCGATTCTAGGGGCAATTAACTTTATTACAACTTCAATTAATATAAAACCCCCATCAATAACACAATATCAAACACCCTTATTCGTATGATCTGTCTTAATTACCGCAATCCTACTCCTCCTATCTCTCCCCGTGCTCGCAGCA---GGAATTACTATACTTCTTACAGATCGAAACCTAAACACTACATTTTTTGACCCGGCTGGGGGTGGAGACCCAGTTCTTTACCAACACTTATTCTGATTTTTTGGTCATCCAGAAGTATATATTCTAATCCTCCCAGGATTCGGAATAATTTCTCACATTGTTACTTATTATTCTGCAAAAAAA---GAACCCTTTGGTTATATAGGAATAGTATGGGCCATGATATCTATTGGATTATTAGGCTTCATTGTATGAGCCCACCATATGTTTACAGTAGATTTAA  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Salamandra salamandra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Sergius Kuzmin, Theodore Papenfuss, Max Sparreboom, Ismail H. Ugurtas, Steven Anderson, Trevor Beebee, Mathieu Denoël, Franco Andreone, Brandon Anthony, Benedikt Schmidt, Agnieszka Ogrodowczyk, Maria Ogielska, Jaime Bosch, David Tarkhnishvili, Vladimir Ishchenko

Reviewer/s
Cox, N. and Temple, H.J. (Global Amphibian Assessment)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category. A number of subspecies of Salamandra salamandra are restricted in range and may be considered to be threatened, in particular: S.s. longirostris in southern Spain (listed as Vulnerable in Spain), and S.s. bejarae-almanzoris in the mountains of north-central Spain (listed as Vulnerable in Spain).

History
  • 2006
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Better legislation has helped to reduce the numbers of Fire Salamanders that are caught in the wild for both the pet trade and for research.

Perhaps more of a threat is the crucial issue of habitat preservation. Like all amphibians, the Fire Salamander is susceptible to pollutants in its environment. Habitat fragmentation is also a potential problem since these animals are so loyal to their home ranges and overwintering sites. The ecological requirements of the species must be taken into consideration for any habitat protection effort (Griffiths 1996).

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A number of large, stable populations of this salamander exist in Central Europe. Some local populations declines have been observed over parts of its range (e.g., through habitat loss, introduced predatory fish, and increased aridity in Spain). A severe decline has been reported in the Netherlands. Some local populations have disappeared, and its population density has also been reduced in parts of Spain.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Over a large part of its range, S. salamandra seems to be not a rare species, but its abundance declines in many regions. In unwooded areas the species is generally rarer than in forests.

Females are active in daytime during the breeding period; afterwards adults are active at twilight, spending the day under logs, snags, stones, rodent burrows and holes. During rainy weather salamanders regularly leave their hiding places by day. The appearance of active salamanders on the land surface in day time indicates the approach of rain. Hibernation, typically in groups, occurs in the northern part of the range, whereas in the south (e.g., in Israel) activity ceases during hot summer period. Similarly, in central Europe reproduction occurs between spring and autumn, whereas at the south of the range it is confined to winter. Mating takes place on land, and male-male combats for a female often takes place. The species is typically viviparous, and the female releases the young into water, usually shallow brooks. The number of larvae per female, as well as their stage at birth time, varies among subspecies. Salamandra salamandra bernardezi and, sometimes, S. s. fastuosa give birth to completely metamorphosed young salamanders. Larval development takes several months, but in many cases they overwinter and finish their metamorphosis in the next year. Most larvae occur in fishless parts of brooks, which is caused by fish predation. As a rule, larvae start active feeding just after birth. Age changes in diet during ontogeny are minor and related mainly to the use of larger prey. Larvae consume primarily upon rheophilous invertebrates: Gammaridae, larval Ephemeroptera, Diptera, etc. In semi-flowing waters, typical limnophilous preys (e.g., Diaptomidae) are included in their diet. Adults do not consume the small preys that are eaten by juveniles: Acarina, Geophylomorpha, and Collembola. However, they eat large Mollusca, Myriapoda (Oniscomorpha, Polydesmida and Juliformia), Coleoptera, etc.

  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K. and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR. Prosveshchenie, Moscow.
  • Greven, H. and Thiesmeier, B., eds. (1994). Biology of Salamandra and Mertensiella (Mertensiella Supplement 4). DGHT, Bonn.
  • Klewen, R. (1988). Die Landsalamander Europas, Teil I, Die Gattungen Salamandra und Mertensiella. A.Ziemsen, Wittenberg Lutherstadt.
  • Freytag, G.E. (1955). Feuersalamander und Alpensalamander (Die Neue Brehm Bücherei Bd. 142). A. Ziemsen, Wittenberg-Lutherstadt.
  • Thiesmeier, B. (1992). Okologie des Feuersalamanders. Westarp Wissenschaften, Essen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The principal threats include localized general habitat destruction, unsympathetic forest management, and pollution of breeding sites by agrochemicals, collection for commercial purposes (i.e., the pet trade), introduction of predatory species (salmonids and crayfish (Procambarus clarkii)) and population fragmentation. The mortality of adults on roads is a localized threat in some parts of its range. The presence of chytridiomycosis has been reported in some Spanish populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

In historical perspective, the range seemed to be constricted, mainly due to deforestation. In some places (e.g., in Ukrainian Carpathians) declines of populations take place due to anthropogenic influences.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K. and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR. Prosveshchenie, Moscow.
  • Greven, H. and Thiesmeier, B., eds. (1994). Biology of Salamandra and Mertensiella (Mertensiella Supplement 4). DGHT, Bonn.
  • Klewen, R. (1988). Die Landsalamander Europas, Teil I, Die Gattungen Salamandra und Mertensiella. A.Ziemsen, Wittenberg Lutherstadt.
  • Freytag, G.E. (1955). Feuersalamander und Alpensalamander (Die Neue Brehm Bücherei Bd. 142). A. Ziemsen, Wittenberg-Lutherstadt.
  • Thiesmeier, B. (1992). Okologie des Feuersalamanders. Westarp Wissenschaften, Essen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix III of the Bern Convention and is protected by national legislation over much of its range. It occurs in many protected areas, and is listed in a number of national and sub national Red Data Books and Lists. Some populations of this salamander are being monitored (e.g., central Spain; Zlote Mountains [southwestern Poland, East Sudety Mountains]). Further research into the impacts of chytridiomycosis on this salamander is urgently needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The Fire Salamander has been a popular species in the pet trade, and has also been utilized as an animal model in research (Griffiths 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Relation to Humans

Habitat destruction, pollution, and collecting for commercial purposes (mainly pet trade) are the main threats for the populations. Destruction of forests and overcollecting cause the declines of some populations.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K. and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR. Prosveshchenie, Moscow.
  • Greven, H. and Thiesmeier, B., eds. (1994). Biology of Salamandra and Mertensiella (Mertensiella Supplement 4). DGHT, Bonn.
  • Klewen, R. (1988). Die Landsalamander Europas, Teil I, Die Gattungen Salamandra und Mertensiella. A.Ziemsen, Wittenberg Lutherstadt.
  • Freytag, G.E. (1955). Feuersalamander und Alpensalamander (Die Neue Brehm Bücherei Bd. 142). A. Ziemsen, Wittenberg-Lutherstadt.
  • Thiesmeier, B. (1992). Okologie des Feuersalamanders. Westarp Wissenschaften, Essen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fire Salamander

The fire salamander (Salamandra salamandra) is probably the best-known salamander species in Europe. It is black with yellow spots or stripes to a varying degree; some specimens can be nearly completely black while on others the yellow is dominant. Shades of red and orange may sometimes appear, either replacing or mixing with the yellow according to subspecies. Fire salamanders can have a very long lifespan. A salamander lived for more than 50 years in Museum Koenig, a German natural history museum.

Contents

Habitat, behavior and diet

Fire salamanders live in central European forests and are more common in hilly areas. They prefer deciduous forests, since they like to hide in fallen leaves and around mossy tree trunks. They need small brooks or ponds with clean water in their habitat for the development of the larvae. Whether on land or in water, fire salamanders are inconspicuous. They spend much of their time hidden beneath stones, wood or other objects. They are active in the evening and the night, but on rainy days they are active in daytime as well.

The diet of the fire salamander consists of various insects, spiders, earthworms and slugs, but they also occasionally eat newts and young frogs. Small prey will be caught within the range of the vomerine teeth or by the posterior half of the tongue, to which the prey adheres. The fire salamander can grow to be 15–25 cm long.[1]

Etymology

It is possible that the common name of this species, fire salamander, derives from old tales of these amphibians. The salamanders hide within holes and crevasses in damp wood and tree trunks. When humans cut down wood to use for heating, the salamanders often remained hidden within. When a fire was lit, the heat forced the animals to leave the wood and crawl to safety. Because of this they appeared as though they were "crawling from within the flames".

Reproduction

Salamandara salamandra MHNT 3.jpg

Males and females look very similar except during the breeding season, when the most conspicuous difference is a swollen gland around the male's vent. This gland produces the spermatophore, which carries a sperm packet at its tip. The courtship happens on land. After the male becomes aware of a potential mate, he confronts her and blocks her path. The male rubs her with his chin to express his interest in mating, then crawls beneath her and grasps her front limbs with his own in amplexus. He deposits a spermatophore on the ground, then attempts to lower the female's cloaca into contact with it. If successful, the female draws the sperm packet in and her eggs are fertilized internally. The eggs develop internally and the female deposits the larvae into a body of water just as they hatch. In some subspecies the larvae continue to develop within the female until she gives birth to fully formed metamorphs. Breeding has not been observed in neotenic fire salamanders.

Toxicity

Samandarin structure.

Salamanders may actively defend themselves once they are grasped by a predator. Besides various antipredator postures, S. salamandra adults are able to exude toxic skin secretions such as the neurotoxic alkaloid Samandarin. This alkaloid causes strong muscle convulsions and hypertension combined with hyperventilation in all vertebrates. The poison glands of the Fire Salamander are concentrated in certain areas of the body, especially around the head and the dorsal skin surface. The coloured portions of the animal's skin usually coincide with these glands. Compounds in the skin secretions may be effective against bacterial and fungal infections of the epidermis; some are potentially dangerous to human life.

Distribution

Distribution in Europe
Feuersalamander.ogg
Video of a Fire Salamander in its natural habitat in Austria

Fire Salamanders are found in most of southern and central Europe. They are most commonly found at altitudes between 400 and 1000 m, only rarely below (in Northern Germany sporadically down to 25 m). However in the Balkans or Spain they are commonly found in higher altitudes as well.

Nominae Herpetofaunae Europaeae: Salamandra salamandra (Linnaeus, 1758)

Common names, by countries in alphabetical order:

In Slovakia

Subspecies

Several subspecies of the Fire Salamander are recognized. Most notable are the subspecies fastuosa and bernadezi, which are the only viviparous subspecies - the others are ovoviviparous.

Fire salamander (orange coloured morph)
  • S. s. alfredschmidti
  • S. s. almanzoris – Spotted Fire Salamander
  • S. s. bejarae
  • S. s. bernardezi
  • S. s. beschkovi
  • S. s. crespoi
  • S. s. fastuosa (or bonalli) – Yellow Striped Fire Salamander
  • S. s. gallaica – Portuguese Fire Salamander
  • S. s. gigliolii
  • S. s. morenica
  • S. s. salamandra - Spotted Fire Salamander, Nominate supspecies
  • S. s. terrestris – Barred Fire Salamander
  • S. s. werneri

Some former subspecies have been lately recognized as species due to genetic reasons.

  • S. algira Bedriaga, 1883 - African Fire Salamander
  • S. corsica Savi, 1838 - Corsican Fire Salamander
  • S. infraimmaculata Martens, 1885 - Arouss Al Ayn (Near-Eastern Fire Salamander)
  • S. longirostris Joger & Steinfartz, 1994 - South Iberian Fire Salamander

Gallery

References

  1. ^ Griffiths, R. 1996. Newts and Salamanders of Europe. London: Academic Press.
  • Manenti, R., Ficetola, G. F., De Bernardi, F. 2009 - Water, stream morphology and landscape: complex habitat determinants for the fire salamander Salamandra salamandra. Amphibia-Reptilia 30: 7-15.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!