Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Comprehensive Description

Description

Females of this large bodied species can attain snout-vent lengths of over 225 mm, though most adults range from 85 to 150 mm. Adult males are yellowish-brown in color, with the yellow being most pronounced along the sides and the throat. Females and immature males have irregular brown blotches on their dorsal surface. The skin of both sexes is covered by irregularly scattered warts. In sexually active males these warts bear horny spicules. The parotoids are relatively large and often triangular and swollen in appearance. Cranial ridges are well developed. The tympanum is distinct, and the interorbital is concave. The webbing is poorly developed. The nuptial pads in the males are dark on the first 3 fingers (Easteal 1963).

Rick Speare has compiled a bibliography on this species up until 1991: Cane toad.
Karyotype:This species has a diploid chromosome (2n) with 5 large pairs and 6 small ones, which makes 22 chromosomes in total (Cole, Lowe, and Wright 1968).

A Spanish-language species account can be found at this website of Instituto Nacional de Biodiversidad (INBio).

  • Brown, G. P., Shine, R., Ward-Fear, G. (2010). ''Using a native predator (the meat ant, Iridomyrmex reburrus) to reduce the abundance of an invasive species (the cane toad, Bufo marinus) in tropical Australia.'' Journal of Applied Ecology, 47, 273â€"280.
  • Bruning, B., Phillips, B.L., Shine, R. (2010). ''Turgid female toads give males the slip: a new mechanism of female mate choice in the Anura.'' The Royal Society- Biology Letters
  • Crossland, M. R. (2000). ''Direct and indirect effects of the introduced toad Bufo marinus on populations of native anuran larvae in Australia.'' Ecography, 23(3), 283-290.
  • Drewes R. C., Roth B. (1981). ''Snail-eating frogs from the Ethiopian highlands: a new anuran specialization.'' Zoological Journal of the Linnean Society, 73, 267-287.
  • Easteal, S. (1963). ''Bufo marinus.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 395.1-395.4.
  • Ingram, G. J., Covacevich J. (1990). ''Tropidonophis mairii vs. Bufo marinus. Memoirs of the Queensland Museum.'' , 29(396).
  • Lampo, M. and De Leo, G. A. (1998). ''The invasion ecology of the toad Bufo marinus: from South America to Australia.'' Ecological Applications, 8(2), 388-396.
  • Llewelyn J., Phillips B. L., Shine R. (2009). ''Sublethal costs associated with the consumption of toxic prey by snakes.'' Austral Ecology, 34, 179â€"184.
  • Llewelyn, J., Schwarzkopf L., Alford R., Shine R. (2009). ''Something different for dinner? Responses of a native Australian predator (the keelback snake) to an invasive prey species (the cane toad).'' Biological Invasions
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Phillips, B.L., Brown, G.P., Shine, R. (2010). ''Evolutionarily accelerated invasions, the rate of dispersal evolves upwards during the range advance of cane toads.'' Journal of Evolutionary Biology
  • Seebacher, F. and Alford, R. A. (1999). ''Movement and microhabitat use of a terrestrial amphibian (Bufo marinus) on a tropical island: seasonal variation and environmental correlates.'' Journal of Herpetology, 33(2), 208-214.
  • Shine, R. (2006). ''The Ecological Impact of Invasive Cane Toads (Bufo marinus) in Australia'' Quarterly Review of Biology: in press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The non-native marine toad, Bufo marinus, is the largest of Florida's frogs and toads. It has a stout body and short legs, with the digits of the forelimbs lacking webbing and those of the hind limbs being webbed. The skin is rough and warty. Skin ranges in color from gray to tan to red-brown, dark brown, olive to dull green, to black above, and cream-colored and often flecked with brown or black on the belly. The tympani (ear membranes) are one-half to two-thirds the diameter of the eyes (Ashton and Ashton 1988)The most distinguishing feature (other than size) is the presence of two large parotid glands, located at the shoulder behind each eye. These are venom glands capable of producing toxic milky secretions when squeezed. Smaller venom glands ('warts') are distributed all over the surface of the skin (Conant and Collins 1991, Gautherot 2000).Tadpoles are jet black dorsally and silvery white with black spots ventrally (Ashton and Ashton 1988).The vocalization of B. marinus is a slow, low-pitched trill and larger males usually have deeper calls (Somma 2004).
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species ranges from southern Texas, USA, through tropical Mexico and Central America to northern South America (central Brazil and Amazonian Peru and northern parts of Amazonian Bolivia, Colombia, Venezuela [including Margarita Island] and the Guianas, throughout Trinidad and Tobago). It is introduced in southern Florida, Puerto Rico (introduced in the 1920s), St Croix, St Thomas, Hawaii (introduced from Puerto Rico in 1932, now common on all main islands), Jamaica (including Cabarita Island) (introduced from Barbados in 1844, common throughout island in lowlands), the U.S. Virgin Islands, Hispaniola (Dominican Republic and Haiti), St Kitts, Nevis, Antigua, Montserrat, Guadeloupe, the Grenadines, Martinique, St Lucia, St Vincent, Barbados, Aruba, Grenada, Guam (McCoid 1993), Saipan (Wiles and Guerrero 1996), and many other tropical and subtropical localities (Schwartz and Henderson 1988). It is also an invasive and introduced species in much of the lowlands of Papua New Guinea, the Admiralty and Bismarck Islands and the Solomon Islands. It was introduced to Australia in 1935, to north tropical Queensland to control sugar cane pests (which it failed to do). Now the southern limit of its distribution is near Coffs Harbour in northeastern New South Wales, and its range extends through most of Queensland and into the Northern Territory to Kakadu National Park (first recorded at Koolpin Gorge, 24 June 2002 and Twin Falls, 10 June 2002). It is also introduced and now widespread in the Philippines. It is found on most of the major islands. It was introduced into Japan first from Hawaii to Taiwan, Province of China, and then from Taiwan through Daito Islands (1930) to Ishigaki Island (1978). The population of Bonin Island was introduced from Guam, which in itself had the species introduced in 1937 (Christy et al. 2007). It is also found on Hatomajima. It occurs from sea level up to 3,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The natural range of Rhinella marina is from the Rio Grande Valley of Texas south to the Central Amazon and southeastern Peru. This toad has been introduced into the Caribbean Islands, South Florida (Key West and Stock islands, Tampa Bay, Hillsborough, Dade and Broward counties), the Hawaiian islands, and Australia's east coast (East Queensland and Coastal New South Wales). Rhinella marina has been called one of the 100 worst invasive species worldwide by the Invasive Species Specialist Group.

Biogeographic Regions: nearctic (Introduced , Native ); neotropical (Introduced , Native ); australian (Introduced ); oceanic islands (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Southern Texas to South America. Introduced in southern Florida, Puerto Rico (introduced in 1920s), St. Croix, St. Thomas, Hawaii (introduced from Puerto Rico in 1932, now common on all main islands), Jamaica (including Cabarita Island) (introduced from Barbados in 1844, common throughout island in lowlands), Lesser Antilles, Bermuda, Guam (McCoid 1993), Saipan (Wiles and Guerrero 1996), and many other tropical and subtropical localities (Schwartz and Henderson 1988). Elevational range: sea level to about 2900 ft (880 m) (Schwartz and Henderson 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Naturally occurring populations are found from the southern tip of Texas and northwestern Mexico to central Brazil. Introduced populations have been established in the Caribbean and Pacific regions. Upper altitudinal limits vary with latitude, from 500 m in Sinaloa, Mexico to 1600 m in Venezuela (Easteal 1963). Bufo marinus was introduced to Northern Queensland, Australia in 1929 and has since spread throughout much of the continent (Lampo and De Leo 1998).

  • Brown, G. P., Shine, R., Ward-Fear, G. (2010). ''Using a native predator (the meat ant, Iridomyrmex reburrus) to reduce the abundance of an invasive species (the cane toad, Bufo marinus) in tropical Australia.'' Journal of Applied Ecology, 47, 273â€"280.
  • Bruning, B., Phillips, B.L., Shine, R. (2010). ''Turgid female toads give males the slip: a new mechanism of female mate choice in the Anura.'' The Royal Society- Biology Letters
  • Crossland, M. R. (2000). ''Direct and indirect effects of the introduced toad Bufo marinus on populations of native anuran larvae in Australia.'' Ecography, 23(3), 283-290.
  • Drewes R. C., Roth B. (1981). ''Snail-eating frogs from the Ethiopian highlands: a new anuran specialization.'' Zoological Journal of the Linnean Society, 73, 267-287.
  • Easteal, S. (1963). ''Bufo marinus.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 395.1-395.4.
  • Ingram, G. J., Covacevich J. (1990). ''Tropidonophis mairii vs. Bufo marinus. Memoirs of the Queensland Museum.'' , 29(396).
  • Lampo, M. and De Leo, G. A. (1998). ''The invasion ecology of the toad Bufo marinus: from South America to Australia.'' Ecological Applications, 8(2), 388-396.
  • Llewelyn J., Phillips B. L., Shine R. (2009). ''Sublethal costs associated with the consumption of toxic prey by snakes.'' Austral Ecology, 34, 179â€"184.
  • Llewelyn, J., Schwarzkopf L., Alford R., Shine R. (2009). ''Something different for dinner? Responses of a native Australian predator (the keelback snake) to an invasive prey species (the cane toad).'' Biological Invasions
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Phillips, B.L., Brown, G.P., Shine, R. (2010). ''Evolutionarily accelerated invasions, the rate of dispersal evolves upwards during the range advance of cane toads.'' Journal of Evolutionary Biology
  • Seebacher, F. and Alford, R. A. (1999). ''Movement and microhabitat use of a terrestrial amphibian (Bufo marinus) on a tropical island: seasonal variation and environmental correlates.'' Journal of Herpetology, 33(2), 208-214.
  • Shine, R. (2006). ''The Ecological Impact of Invasive Cane Toads (Bufo marinus) in Australia'' Quarterly Review of Biology: in press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Faunal Affinity

This invasive species is found in all major faunal regions in the Philippines as well as many small island groups and islolated islets.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Siler, Cameron

Source: Amphibians and Reptiles of the Philippines

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species has been introduced to the Philippines and has invaded all major and many smaller islands throughout the country.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Siler, Cameron

Source: Amphibians and Reptiles of the Philippines

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Native to: Belize, Bolivia, Brazil, Colombia, Costa Rica, Ecuador, El Salvador, French Guiana, Guatemala, Guyana, Honduras, Mexico, Nicaragua, Panama, Peru, Suriname, Trinidad and Tobago, United States, Venezuela   Introduced in: Antigua and Barbuda, Aruba, Australia, Barbados, Dominican Republic, Grenada, Guadeloupe, Guam, Haiti, Jamaica, Japan, Martinique, Montserrat, Northern Mariana Islands, Papua New Guinea, Philippines, Puerto Rico, Saint Kitts and Nevis, Saint Lucia, Saint Vincent and the Grenadines, Solomon Islands, Taiwan, United States (Florida and Hawaii), Virgin Islands

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bufo marinus is a highly adaptable invader and where it occurs in Florida it is typically found in agricultural and urbanized areas.The native range of B. marinus extends from northern South America, through Central America and Mexico, and up into southernmost Texas (Conant and Collins 1991, Somma 2004).The species is established in south Florida and around Tampa on the Gulf coast, and they are also found on Stock Island and Key West (USGS/SEARMI). These populations are probably derived from intentional introductions as well as accidental introductions in agricultural products and from escapes of pets from homes and from the pet trade (Somma 2004). Collection records indicate Bufo marinus occurs in at least three of six India River Lagoon watershed counties (Palm Beach, Martin, Indian River, probably St. Lucie as well). It appears to be widely established in Palm Beach and Martin counties. Smaller populations of B. marinus pesist elsewhere in isolated pockets as, for example, an established population reported in Vero Beach near Dodgertown in 2002.
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Rhinella marina has a grey olive brown dorsal skin with many warts ending in dark brown caps. The ventral skin tends to be a whitish yellow with dark brown speckles or mottles and is granular. Rhinella marina possesses huge paratoid glands stretching from the anterior side of the tympanum to halfway down the back. A high bony ridge meets at the snout between the nostrils. Rhinella marina, like other nocturnal species, has horizontal pupils. Rhinella marina can reach a maximum length of 238 millimeters, although generally is approximately 150 to 175 millimeters.

Range length: 150 to 238 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; poisonous

Sexual Dimorphism: sexes alike

Average mass: 106.25 g.

Average basal metabolic rate: 0.0303 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 22 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bufo marinus in Florida can reach sizes of around 10-15 cm (and up to nearly 24 cm elsewhere) and female toads can weigh up to 2.5 kg (Behler 1979, Somma 2004).
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Identification

Adult

Species description based on Ibanez et al (1999) and Savage (2002).  A very large toad (males to 145 mm, females to 175 mm).

Dorsal

Dorsal coloration varies from yellowish brown to dark brown. The dorsum is mottled in females and uniform in males. The paratoid glands are very large.

Eye

The iris is brown.

Extremities

The hands and feet are mostly unwebbed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Rhinella marina
Catalog Number: USNM 116513
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1940
Locality: La Esperanza, Chiapas, Mexico
  • Holotype: Taylor, E. H. & Smith, H. M. 1945. Proc. U. S. Nat. Mus. 95 (3185): 553, figure 59.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

The size of the marine toad and the presence of the large parotid glands and webbed hind digits make this species easy to distinguish from other Florida frogs and toads.
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sierra Madre Oriental Pine-oak Forests Habitat

This taxon is found in the Sierra Madre Oriental pine-oak forests, which exhibit a very diverse community of endemic and specialized species of plants, mammals, reptiles and amphibians. These high mountains run north to south, beginning in the USA and ending in Mexico. The Sierra Madre Oriental pine-oak forests are a highly disjunctive ecoregion, owing to the fact that they are present only at higher elevations, within a region with considerable expanses of lower elevation desert floor.

The climate is temperate humid on the northeastern slope, and temperate sub-humid on the western slope and highest portions of the mountain range. Pine-oak forest habitat covers most of the region, even though most of the primary forest has been destroyed or degraded. However, the wettest portions house a community of cloud forests that constitute the northernmost patches of this vegetation in Mexico. The forests grow on soils derived from volcanic rocks that have a high content of organic matter. The soils of lower elevations are derived from sedimentary rocks, and some of them are formed purely of limestone. In the northernmost portions of the ecoregion, the forests occur on irregular hummocks that constitute biological "islands" of temperate forest in the middle of the Chihuahuan Desert. To the south, from Nuevo León southward until Guanajuato and Queretaro, the ecoregion is more continuous along the mainstem of the Sierra Madre Oriental.

Dominant tree species include the pines: the endemic Nelson's Pine (Pinus nelsonii), Mexican Pinyon (P. cembroides), Smooth-bark Mexican Pine (P. pseudostrobus), and Arizona Pine (P. arizonica); and the oaks Quercus castanea and Q. affinis. In mesic environments, the most common species are P. cembroides, and Alligator Juniper (Juniperus deppeana), but in more xeric environments on the west slopes of the mountains, the endemic P. pinceana is more abundant. Gregg's Pine (P. greggii) and Jelecote Pine (P. patula) are endemic.

Many mammalian species wander these rugged hills. Mule Deer (Odocoileus hemionus), Puma (Puma concolor), Cliff Chipmunk (Tamias dorsalis), Collared Peccary (Tayassu tajacu), Coati (Nasua narica), Jaguar (Panthera onca) and Coyote (Canis latrans) are a few of the many diverse mammals that inhabit this ecoregion. Some threatened mammals found in the ecoregion are: Bolaños Woodrat (Neotoma palatina VU); Diminutive Woodrat (Nelsonia neotomodon NT), known chiefly from the western versant of the Sierra Madre; Chihuahuan Mouse (Peromyscus polius NT); and Mexican Long-nosed Bat (Leptonycteris nivalis EN).

A considerable number of reptilian taxa are found in the Sierra Madre Oriental pine-oak forests, including three endemic snakes: Ridgenose Rattlesnake (Crotalus willardi); Fox´s Mountain Meadow Snake (Adelophis foxi); and the Longtail Rattlesnake (Crotalus stejnegeri VU), restricted to the central Sierra Madre. An endemic skink occurring in the ecoregion is the Fair-headed Skink (Plestiodon callicephalus). The Striped Plateau Lizard (Sceloporus virgatus) is endemic to the ecoregion. The Sonoran Mud Turtle (Kinosternon sonoriense VU) is found in the ecoregion and ranges from southwestern New Mexico south to northwestern Chihuahua.

The following anuran taxa occur in the Sierra Madre Oriental pine-oak forests: Red-spotted Toad (Anaxyrus punctatus); Cane Toad (Rhinella marina); Elegant Narrow-mouthed Toad (Gastrophryne elegans); New Mexico Spadefoot Toad (Spea multiplicata); Sinaloa Toad (Incilius mazatlanensis); Pine Toad (Incilius occidentalis); Southwestern Toad (Anaxyrus microscaphus); Woodhouse's Toad (Anaxyrus woodhousii); Great Plains Narrowmouth Toad (Gastrophryne olivacea); Great Plains Toad (Anaxyrus cognatus); Plateau Toad (Anaxyrus compactilis); Texas Toad (Anaxyrus speciosus); Sonoran Desert Toad (Incilius alvarius), found only at lower ecoregion elevations here; Rana-ladrona Silbadora (Eleutherodactylus teretistes); Sabinal Frog (Leptodactylus melanonotus); Mexican Leaf Frog (Pachymedusa dacnicolor); Montezuma Leopard Frog (Lithobates montezumae); Yavapai Leopard Frog (Lithobates yavapaiensis); Northwest Mexico Leopard Frog (Lithobates magnaocularis); Bigfoot Leopard Frog (Lithobates megapoda), who generally breeds in permanent surface water bodies; Mexican Cascade Frog (Lithobates pustulosus); Tarahumara Frog (Lithobates tarahumarae VU); Western Barking Frog (Craugastor augusti); Lowland Burrowing Frog (Smilisca fodiens); Taylor's Barking Frog (Craugastor occidentalis); Blunt-toed Chirping Frog (Eleutherodactylus modestus VU), found only at the very lowest elevations of the ecoregion; Shiny Peeping Frog (Eleutherodactylus nitidus); California Chorus Frog (Pseudacris cadaverina); Rio Grande Frog (Lithobates berlandieri); Madrean Treefrog (Hyla eximia); Mexican Treefrog (Smilisca baudinii); Dwarf Mexican Treefrog (Tlalocohyla smithii); Canyon Treefrog (Hyla arenicolor); Northern Sheep Frog (Hypopachus variolosus); Chiricahua Leopard Frog (Lithobates chiricahuensis). There are three salamanders found in the ecoregion: the endemic Sacramento Mountains Salamander (Aneides hardii), found only in very high montane reaches above 2400 meters; Tiger Salamander (Ambystoma tigrinum); and the Tarahumara Salamander (Ambystoma rosaceum).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Rhinella marina is a tropical species that prefers forested areas with semi-permanent water nearby (Cogger 1983).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

  • Cogger, H. 1983. Reptiles and Amphibians of Australia. Sanibel, Florida: Ralph Curtis Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A nocturnal and terrestrial toad that inhabits humid areas with adequate cover, including cane fields, savannah, open forest, well watered yards and gardens. It also inhabits dry equatorial forests. It thrives in degraded habitats and man-made environments, and is occasionally found in pristine lowland and montane rainforests, but generally prefers open or disturbed habitat such as tracks, roads, low grassland and areas that are near human settlement, e.g. grazing land, suburban parks and gardens. It tends to avoid more densely vegetated areas (eg. wet sclerophyll and rainforest), which can then act as a barrier to their dispersal. It can be found by day beneath fallen trees, loose boards, matted coconut leaves, and similar cover (Lynn 1940). It feeds on arthropods (especially ants and termites) and small vertebrates. It is flexible regards breeding site (Evans et al. 1996); eggs and larvae develop in slow or still shallow waters of ponds, ditches, temporary pools, reservoirs, canals, and streams. Clutch size is between 8,000 and 17,000. Eggs and tadpoles are poisonous and displace native tadpoles. It may sometimes breed in slightly brackish water in Hawaii. Larvae are tolerant of high temperatures.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Humid areas with adequate cover, including cane fields, savanna, open forest, well-watered yards and gardens. Can be found by day beneath fallen trees, loose boards, matted coconut leaves, and similar cover (Lynn 1940). Flexible in breeding site (Evans et al. 1996, Copeia 1996:904-912); eggs and larvae develop in slow or still shallow waters of ponds, ditches, temporary pools, reservoirs, canals, and streams. May sometimes breed in slightly brackish water in Hawaii. Larvae are tolerant of high temperatures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although this species is exceptionally common in disturbed habitats, agriculatural lands (including rice fields), and residential habitat, observations have also been made of this species in distrubed, lowland forest.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Siler, Cameron

Source: Amphibians and Reptiles of the Philippines

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Rhinella marina inhabits both humid and dry environments, as long as there is some vegetation available for cover (to 3000 m.). It is typically more abundant in disturbed habitats and rare in pristine forest (Ibanez et al 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Rhinella marina forages primarily nocturnally in mature forests and roadways. It feeds on ants, beetles, and earwigs in southern Florida, but has been found with dragonflies, grasshoppers, truebugs, crustaceans, gastropods, plant matter and even dog and cat food in their stomachs (Krakauer 1968).

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

  • Krakauer, T. 1968. The Ecology of the Neotropical Toad, Bufo marinus in southern Florida. Herpetologica, 24(3): 214-221.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Metamorphosed toads eat mainly various terrestrial invertebrates, especially ants and beetles; sometimes small vertebrates; also may eat inanimate foods such as processed pet food and discarded food scraps (McCoid, 1994, Herpetol. Rev. 25:117-118). Larvae eat suspended matter, organic debris, algae, and plant tissue.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Marine toads are voracious predatory omnivores that consume not only insects and other arthropods but also molluscs, vegetation, and any other frogs or toads they encounter. In urbanized settings, they will consume cat or dog food if it is left out and they may also scavenge garbage (Alexander 1964, Cabrera et al. 1996, Somma 2004).Marine toads are primarily nocturnal and they often congregate around lights to take advantage of the insects that they attract.
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

None reported.Invasion History: Marine toads have been repeatedly introduced throughout the world as a potential biological control agent for crop-damaging insects, primarily those that damage sugarcane (Krakauer 1968, 1970). The most infamous introduction is the 1935 intentional release into the canefields of Queensland, Australia in an unsuccessful attempt to control the sugar pest the greyback cane beetle (Dermolepida albohirtum). The marine toads used in the Queensland introduction were from Hawaii where the species had been intentionally introduced just a few years earlier (McKeown 1996, Lever, 2001).The first attempts at intentional introduction of Bufo marinus into Florida occurred at approximately the same time as the Hawaii and Australia introductions. Specimens imported from Puerto Rico were released into Palm Beach County in 1936 but the species failed to become established on this occasion and in two subsequent attempts as well (Krakauer 1968).Marine toads finally did become established in Florida after an accidental release by an importer in 1955 from the Miami Airport (Krakauer 1968, Ashton and Ashton 1988). Additional intentional releases into south Florida in 1963 and 1964 facilitated establishment and subsequent explosive population growth. The species was recognized as a nuisance species requiring control as early as 1965 (Krakauer 1968, 1970). Potential to Compete With Natives: Marine toads likely compete with native species for food, living space and breeding sites and may have, in some parts of the world, been a the principal cause of local extirpation of some native amphibians (Krakauer 1968). Marine toads also eat other species of frogs and toads and practically any other suitably-sized animal they encounter. Possible Economic Consequences of Invasion: The defensive secretions produced by the parotids and other poison glands are highly toxic and are capable of killing dogs, cats, and other animals that bite into or attempt to consume them (USGS/SEARMI). Effects on native fauna are not fully known but are believed to be similar.The secretions are also capable of making humans seriously ill, and of causing serious skin and eye irritation Carmichael and Williams 1991, Conant and Collins 1991).Bufo marinus is listed by ISSG as as among "100 of the Worst" global invasive organisms, and authorities consider it to be the "most introduced amphibian in the world" (Behler 1979, Carmichael and Williams 1991).
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Bufo marinus is prey of:
Buteo jamaicensis
Scolopendra alternans
Epilobocera situatifrons
Diptera
Secernentia nematodes

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Bufo marinus preys on:
Hymenoptera
Isoptera
Coleoptera
non-insect arthropods
Arthropoda
Insecta

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Total adult population size likely exceeds 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bufo marinus is considered to be abundant in Dade and in some areas of Monroe Counties, occurring in lesser numbers elsewhere in south Florida (USGS/SEARMI).
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Very mobile. In Puerto Rico, moved as far as 165 m to water hole and back to activity center in same or next night; activity centers up to 862 sq m; 3-17 days between visits to water hole; water hole and damp surfaces used for rehydration (Carpenter and Gillingham 1987).

Dry-season dessication may be a major mortality factor.

Population density in seminatural habitats may be 50-150 adults and late-term juveniles per ha, with about 66% annual population turnover (Schwartz and Henderson 1991). Chernin (1979, MS thesis, Univ. Guam) reported densities as high as 225/ha in Guam.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Ecology

Rhinella marina nocturnal, and is commonly encountered on the ground in urban environments (Ibanez et al 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: choruses

Perception Channels: tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

Call

A long, low trill (Ibanez et al 1999). The call can be heard from very far away (Ibanez et al 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Mostly nocturnal, though often observed during daylight. Most active during warm, wet weather. Individuals may not be active every night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The eggs hatch between forty-eight hours and one week. The tadpoles tend to be small and black and aggregate in dense numbers. Tadpoles metamorphose into small toadlets identical to the adults in forty-five to fifty-five days (Bureau of Rural Sciences 1998).

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

Breeding season

Breeding occurs year-round (Ibanez et al 1999). Rhinella marina uses a wide variety of aquatic habitats for breeding, ranging from temporary pools to rivers and lakes (Ibanez et al 1999).

Egg

Small, black eggs are laid in strings in shallow water (Ibanez et al 1999).

Tadpole

The tadpoles are small and black (Ibanez et al 1999). The tadpoles often aggregate while feeding during the day (Hughey pers. obs.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Rhinella marina is a relatively long-lived toad, reaching ages up to ten years (Cogger 1983).

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Sex: female

Status: captivity:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24.8 years (captivity) Observations: In non-tropical tempered zones this toads may take 2 years to reach reproductive maturity (http://amphibiaweb.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males congregate in temporary or permanent still or slow moving water and call for mates. More than one male may fertilize the eggs of a single female, and a particularly successful males may fertilize the eggs of multiple females in a breeding season.

Mating System: polygynandrous (promiscuous)

Rhinella marina is able to reproduce nearly year round. The females are able to lay eggs after their second year. Eggs are laid in long jelly-like strings on rocks, debris, or emergent vegetation; in excess of 30,000 eggs at a time. The eggs hatch in 2 to 7 days.

Breeding interval: These toads breed once yearly.

Range number of offspring: 30,000 (high) .

Range time to hatching: 2 to 7 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Once the eggs are fertilized and arrayed in the water, there is no further parental care.

Parental Investment: pre-fertilization (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually breeds after rains; capable of breeding any time of year in most areas. Eggs hatch in a few days. Larvae metamorphose in 1-3 months. Sexually mature generally in 1-2 years, possibly in as few as 6 months in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Florida, Bufo marinus typically breeds in man-made habitats such as drainage canals and ditches, fish ponds, temporary pools and other shallow water bodies (Somma 2004). Breeding in Florida typically occurs during the wet season from early spring into the fall, and typically occurs during or just after rain events (Conant and Collins 1991).B. marinus exhibits high fecundity with large females capable of producing 20,000 eggs or more (Somma 2004).
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mate attraction in frogs and toads typically involves multiple males calling and females responding to these acoustic signals, often choosing which prospective male to approach based at least in part on differences among the calls of different males. Mating typically involves the male grasping the female in amplexus (a tight "embrace" in which the male mounts the female, wrapping his front legs around her). In most frogs and toads, including Cane Toads, fertilization is external, with males depositing sperm on eggs as they are laid. In many species, "satellite males" may also be present at breeding sites. A satellite male may remain silent, but rather than compete with other males to attract a female, he may instead intercept a female attracted by another male and attempt to force a mating by grasping her in amplexus and fertilizing her eggs.

Bruning et al. (2010) investigated the possibility that female Cane Toads may be able to affect the outcome of competition among males for the primary amplexus position by making it more or less difficult for particular aspiring mates to maintain amplexus. This would allow females to retain a greater degree of female mate choice. The authors suggest that female Cane Toads (and presumably some other species as well) have co-opted a common anti-predator strategy for this purpose. Frogs and toads often defend themselves against predators by inflating their body: the increased girth may deter predators by both increasing the apparent size of the animal and by rendering it too large to ingest (e.g., Williams et al. 2000). Bruning et al. carried out experiments in which male frogs were induced to clasp model females with adjustable balloons inserted inside them. The researchers then measured the force required to pull males off females inflated to varying degrees. They also carried out mating trials using live females that had had their ability to inflate eliminated by placing a catheter into the trachea, preventing the tracheal glottis from closing (which is necessary to keep the body inflated). The results reported by Bruning et al. indicate that inflated female toads are indeed more difficult for males to hold on to, and that the ability of a female in amplexus to inflate her body can facilitate takeovers by larger rival males. In females who were unable to inflate, a small male could maintain his amplectant position despite takeover attempts by larger rivals. Thus, a female toad’s ability to inflate her body can influence the body size of her eventual mate. Given that females may often benefit from mating with larger-than-average males (Davies and Halliday 1977), females might use their ability to inflate to make it easier for a rival male to dislodge a smaller male. This could explain why field studies typically find that larger males are able to dislodge smaller ones.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Egg strings may be free-floating or wrapped around submerged as well as surface material (Somma 2004). Eggs hatch into tadpoles at around three days and the tadpoles metamorphose to juvenile toads around 45-55 days later (Krakauer 1970, Ashton and Ashton 1988).
  • Alexander T.R. 1964. Observations on the feeding behavior of Bufo marinus (Linne). Herpetologica 20:255-259.
  • Ashton, R.E. and P.S. Ashton. 1988. Handbook Of Reptiles And Amphibians of Florida. Part Three, the Amphibians. Windward Publishing, 191 p.
  • Behler J.L. 1979. The Audubon Society Field Guide to North American Retiles and Amphibians. Alfred A. Knopf, New York. 743 p.
  • Cabrera J., Barrantes R., and D. Rodriguez. 1996. Habitos alimentarios de Bufo marinus (Anura Bufonidae) en Costa Rica. Revista de Biologia Tropical 45:702-703.
  • Carmichael P. and W. Williams. 1991. Florida's Fabulous Reptiles and Amphibians. World Publications. Tampa, FL. 120 p.
  • Conant R., and J.T. Collins. 1991. Reptiles And Amphibians, Eastern/Central North America. Houghton Mifflin Company. Boston. 450 p.
  • Ely C.A. 1944. Development of Bufo marinus larvae in dilute sea water. Copeia 56:256.
  • Krakauer T. 1968. The ecology of the neotropical toad, Bufo marinus, in south Florida. Herpetologica 24:214-221.
  • Krakauer T. 1970. The invasion of the toads. Florida Naturalist 1970:12-14.Lever, C. 2001. The Cane Toad. The History and Ecology of a Successful Colonist. Westbury Publishing, England. 230 p.
  • McKeown S. 1996. A Field Guide to Reptiles and Amphibians in the Hawaiian Islands. Diamond Head Publishing, Inc., California. 172 p.
  • Somma L.A. 2004. Bufo marinus species profile. USGS Nonindigenous Aquatic Species Database. Gainesville, FL. Available online.
  • Wright A.H., and A.A. Wright. 1949. Handbook of Frogs and Toads. Comstock Publishing Associates, Ithaca NY. 640 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chaunus marinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Rhinella marina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAATCTTTGGTGCCTGAGCAGGAATAGTGGGAACTGCCCTCAGTCTTCTCATCCGAGCCGAACTGAGCCAACCAGGCTCCCTCCTTGGTGACGATCAGATCTATAATGTTATCGTTACCGCACATGCTTTTGTTATAATTTTCTTTATGGTTATGCCAATCCTAATTGGCGGCTTTGGTAACTGACTTGTGCCTTTAATAATCGGAGCCCCTGATATGGCTTTCCCTCGTATAAACAACATAAGCTTTTGATTACTGCCCCCATCTTTCCTCCTCCTTCTGGCCTCCGCTGGAGTAGAAGCCGGAGCGGGGACCGGCTGAACTGTTTATCCCCCATTAGCCGGAAATCTCGCCCATGCAGGGCCGTCTGTAGACTTAACTATTTTTTCCCTTCATTTGGCAGGTGTTTCATCCATTCTAGGAGCAATTAATTTTATTACCACAACCCTGAATATGAAACCTCCATCAATAACTCAATATCAAACACCTTTATTTGTCTGGTCTGTGTTGATTACCGCTGTTCTACTACTTCTCTCCCTACCAGTTCTCGCAGCGGGAATTACAATACTTTTAACTGATCGCAACTTAAATACAACATTCTTTGATCCCGCTGGAGGAGGAGACCCTATCTTATACCAACATCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhinella marina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 89
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bufo marinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

In their native range cane toads are common, and not considered in need of special conservation efforts. Cane toads are considered one of the world's top 100 most widely-introduced species. Where they have been introduced they are considered pests, and targets of extermination efforts.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Frank Solís, Roberto Ibáñez, Geoffrey Hammerson, Blair Hedges, Arvin Diesmos, Masafumi Matsui, Jean-Marc Hero, Stephen Richards, Luis Coloma, Santiago Ron, Enrique La Marca, Jerry Hardy, Robert Powell, Federico Bolaños, Gerardo Chaves, Paulino Ponce

Reviewer/s
Stuart, S., Chanson, J., Cox, N. & Young, B. (Global Amphibian Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a very abundant species, and its range is increasing.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The mating call is long and has 12 notes/sec. The dominant frequencies are .35 and .7 kHz without frequency modulation to clear harmonics ((Cole et.al. 1968).

Potential Impacts: This toad is highly toxic, secretions from the skin serve as a natural defense against predators. The toxin is stored in the ovum, not the jelly coat. The toxicity of cane toads shifts rapidly during the course of their lifetime. Toad eggs are extremely toxic, while later-stage tadpoles were less toxic. Animals that bite these toads are often seriously affected, many are killed. Domestic dogs and cats often are killed by the toxins. Native wild animals are also affected especially in places where the toads are introduced (especially in places like Australia and in Florida, USA). Marine toads may compete with and prey upon native amphibians (Rabor in Krakauer, 1968).

As an invasive species, cane toads have the potential to bring harmful viral pathogens to native fauna. Scientists found that cane toads carried three of the 14 protozoan species of neotropical origin. Cane toads in Australia also contain nematode lungworm, a parasite endemic to the Americas. While these pathogens and parasites could potentially infect native frog species, observations show that infection has not spread to other native species.

In addition to the direct impacts that cane toads may have on native fauna, the cane toad may also have indirect impacts on food webs and population dynamics. For example, predation on dung beetles by cane toads could reduce dung breakdown rates, affecting many aspects of ecosystem function. Toad invasion can massively reduce the population of predators such as varanid lizards, elapid snakes, freshwater crocodiles, and northern quolls that die from consuming cane toad toxins.

Metamorphosis occurs in tadpoles between 14 and 28 days after hatching, depending on the water temperature. Eggs hatched late in the dry season will metamorphose before the late wet season, when food is most readily available and moisture stress is reduced (Lampo and De Leo 1998). After metamorphosis these toads leave the water and seek diurnal refuges to avoid dehydration and predation. B. marinus uses hollow trees for shelter during the dry season and dense vegetation during the wet season in addition to rock crevices which are used throughout the year (Seebacher and Alford 1999). These toads show more nocturnal activity and travel greater distances per night in Australia than in South America (Seebacher and Alford 1999).

Introduced to many localities in the first half of the 20th century as a means to control sugar cane pests, these toads have undergone a population explosion. They have established widespread ranges in these non-native areas and attain higher densities in Australia than they do in their native range (Lampo and De Leo 1998). This has caused much concern about the effects of B. marinus on native anuran species. The eggs and hatchlings of B. marinus are toxic to many native predators in Australia. The predatory frog species Limnodynastes ornatus showed decreased survivorship where it co-occurred with B. marinus. However Limnodynastes rutella, which is preyed upon by L. ornatus, showed increased survival rates (Crossland 2000). Bufo marinus can inhabit open land near human habitations and sugarcane fields.

B. marinus is an opportunistic feeder, and readily feeds upon land snails as well as centipedes, cockroaches, beetles, grasshoppers, ants, and small field mice. Stomach samples of this species in particular areas of the world show that terrestrial gastropod prey can comprise over 40% of the stomach contents (Hinckley 1963; Bailey 1976; Grant 1996). In laboratory trials under wet conditions, it was found that B. marinus readily consumes a range of camaenid snail species. This makes it unique from other anurans that typically do not prey upon molluscs. While some scientists have proposed that B. marinus consumes vertebrates (e.g., ground-nesting birds such as bee-eaters), this has been found to be very rare. In follow-up studies, cane toads avoided (rather than selected) birds and their eggs as prey (Merops ornatus: Boland 2004).

B. marinus is primarily diurnal in activity, and lacks defense against ant species that are immune to toad toxins. Freshwater crayfish, adult dytiscid diving beetles, dragonfly larvae, and mosquitoes are among other native invertebrates that feed upon the cane toad without ill effects. However, leeches and aquatic snails that feed on larval or adult toads often die from the toxins that are consumed. It should be noted that other invertebrates vary in their susceptibility to toads. Some dytiscid diving beetle larvae can consume hatchlings and tadpoles while others die. Belastomatid giant water bugs can consume some developmental stages of tadpoles without ill-effect, but not others.

Cane toads can serve as an additional food source to vertebrates. Snakes like the keelback (Tropidonophis mairii) and slatey-grey snakes (Stegonotus cucullatus) can consume the cane toads without dying, but keelbacks do show ill-effects. When given a choice, keelback snakes prefer native frogs to cane toads (Llewelyn et al. 2009b). Similarly, raptors consume road-killed toads, but preferentially select native frogs when given a choice. Water rats and introduced black rats frequently consume cane toads.

Most species of Australian freshwater fish often mouth and spit out cane toad early life stages without apparent ill effects. For the fly-specked hardyhead (Craterocephalus stercusmuscarum), the banded and spangled grunters (Amniataba percoides and Leiopotherapon unicolor respectively), the purple-spotted gudgeon (Morgurnda adspersa), glassfish (Family Ambassidae), western rainbowfish (Melanotaenia australis), and black catfish (Neosilurus ater), consuming cane toad eggs or tadpoles are toxic. However, most fish avoid cane toad early life stages because they can detect their noxiousness. For most fish, toad eggs are likely to be more lethal than toad tadpoles.

In 1975, Covacevich and Archer reported that saltwater crocodiles (Crocodylus porosus) could ingest cane toads without ill-effect, while freshwater crocodiles (Crocodylus johnstoni) died after mouthing or ingesting cane toads (Begg et al. 2000). In 1990, Freeland found that C. johnstoni actively hunts and ingests cane toads. It was later reported in 2009 that the deaths of some freshwater crocodiles in the Daly River were due to toad ingestion. A population-level impact study found 34 dead freshwater crocodiles in the Victoria River caused by cane toad ingestion (Letnic et al., 2008). Evidence included a wave of crocodile deaths moving upriver and coinciding with the areas in which cane toads were invading, as well as toad remains found in the stomachs of some of the dead crocodiles.

Turtles also vary in their tolerance for cane toad toxicity. In some cases, turtles ingest toads without ill effect, while other predation attempts by the same species result in fatality. The long-neck turtle (Chelodina sp.) ate a dead cane toad without ill effect, while the saw-shelled turtles (Elseya latisternum) and Krefft's river turtles (Emydura krefftii) consumed toad tadpoles and were also unaffected. In a study by Kruger, long-necked turtles (Chelodina rugosa) seized and spit out toad tadpoles and survived, yet died after consumption of toad eggs.

The area of Australia invaded by cane toads contains high densities of lizards belonging to several phylogenetic lineages. The impact of toads across the lineages is highly nonrandom. Fatal poisoning occurs in three lineages: the Varanidae (goannas), the Scincidae (skinks), and the Agamidae (dragons). Varanids often grow to large body sizes and are therefore more likely to attack a large cane toad more readily than a lizard from most other lineages. Varanids often die after ingesting or mouthing cane toads. Most species of scincid lizards have a relatively small adult body size. Due to their small body size, most Scincid lizards are unlikely to be at risk from consuming a cane toad large enough to kill them. However, some species such as the bluetongue skink (Tiliqua scincoides intermedia) readily consume small toads and die as a result.

Snake species at risk from cane toads are frog-eating species that cannot tolerate toad toxins, can swallow toads large enough to be fatal, and whose geographic distribution overlaps with that of the cane toad. Using this criteria, 49 snake species were found to be potentially at risk from toad invasion. The toad invasion is a potential threat to 70% of the Australian colubrid snakes, 40% of the pythons, and 41% of the elapids. Nine of the species that were deemed "at risk" are currently recognized as threatened species on a federal or state level. Recent work on the feeding patterns of snakes in captivity have shown that species that were previously identified as potentially at risk species were reluctant to take cane toads as prey, or immediately rejected the cane toad after striking it. Colubrids and pythons appear to be less at risk than the elapid snake species, with high mortality rates in death adders (Acanthophis praelongus), black whip snakes (Demansia papuensis), and king brown snakes (Pseudechis australis)(M. Greenlees et al. unpubl. data in Shine 2006).

In 1975, Covacevich and Archer reported that some crows (Corvus sp.) and kookaburras (Dacelo novaeguineae) died after mouthing cane toads, while other individuals of the same species consumed young or road-killed toads without showing any ill effects. At least seven native bird species can eat toads successfully. Reasons for this tolerance may be because they eat only non-toxic parts of the toad or because they are immune to the toxins. In 1997, Dorfman predicted that 76 species in the Kakadu National Park were potentially under threat from cane toads. However, more recent studies by Beckmann and Shine in 2009 have concluded that cane toads appear to have minimal impact on Australian birds. The ability to survive toad invasion may be due to a widespread physiological tolerance of bufotoxins, perhaps reflecting close genetic ties between Australian birds and taxa in Asia, where many bufonid species are similar in toxicity to the cane toad.

In 2004, Webb and Glanznig listed nine species of native mammals and two species of introduced mammals as potentially at risk from cane toad ingestion. Due to previous reports of domestic dogs dying from mouthing cane toads, dingos may also be at risk. Feral cats and pigs also may be negatively affected by cane toads. In captivity, native rodents (Melomys burtoni, Rattus colletti, R. tunneyi) readily killed and consumed small toads, but did not appear to suffer any ill effects. Other rodents (Must domesticus, Pseudomys nanus, Zyzomys argurus) did not attack cane toads as prey at all. Small dasyurid marsupial species, like planigales (Planigale ingrami, P. maculata) and dunnarts (Sminthopsis virginiae) initially attacked toads, became ill as a result, and were later reluctant to attack toads. Relatively few of these dasyurids died as a result of attempting to ingest toads. The species of mammal that is most often a victim of toad invasion is the northern quoll, Dasyurus hallucatus. Lethal ingestion of cane toads is responsible for the local extinction of northern quoll populations in the Mary River region of Kakadu National Park. One study showed that only four of 14 quolls that died from toad ingestion, suggesting that perhaps other factors may be playing a role in quoll extinction. However, more recent studies show that seven out of eight quoll deaths resulted from ingestion of cane toads. In addition, quolls have been killed by toads in areas where very few toads were spotted, suggesting that even in low toad density areas, quolls are still threatened.

Cane toad impacts are affected by attributes of toad biology. Cane toads have a multiphasic life history. Eggs and tadpoles reside in waterbodies, metamorphs are only found in riparian areas, and larger juveniles and adults occupy large areas of drier landscape. In addition, the types and amounts of toxins present in toads vary throughout their lifetime. One specific feature of the cane toad is that their highly toxic eggs are coated in a non-toxic jelly, fooling aquatic predators into consuming them when they would otherwise be able to detect bufotoxins in their prey (Greenlees and Shine 2010).

There also seems to be competitive interactions between cane toads and three species of native tree frogs around waterholes in the Gulf of Carpentaria: Litora pallida, L. rothii, and L. rubella. Evidence suggests that cane toads are likely to have a more adverse impact on larger terrestrial frogs like Cyclorana australis and Limnodynastes convexiusculus. These impacts may be caused by direct behavioral interference rather than competition for food. In a study done in 2009 by Pizzatto and Shine, nine out of ten native frog species avoided sites scented by cane toad chemical cues (all except Litoria rubella), and in 2007, Greenlees et al. found that the presence of cane toads reduced the nocturnal activity levels of the native frog Cyclorana australis. Sexual harassment of female frogs by male toads is also known to occur between native and introduced taxa in other phylogenetic linages (e.g. Valero et al. 2008). In addition to competition involving native anurans, other vertebrate species may also compete with toads for limited resources. In 2004, Boland suggested that cane toads may compete with the nesting burrows of bee-eaters, Merops ornatus.

Cane toads were first introduced into northern Australia in 1936, and have rapidly spread across 1.3 million square kilometers of northern and eastern Australia since (Urban et al., 2007). In northern Australia, toad population expansion has accelerated steadily, from approximately 10 to 55 kilometers per year. On the invasion front, toads move far distances (up to 1.8 km per night), and mostly move in straight lines, actively using cleared areas such as roads as dispersal corridors (Brown et al., 2006; Phillips et al., 2007). This expansion behavior can be compared with toads from older populations. Currently, invasioni front individuals move more often, travel farther per move, and tend to move in straighter lines. However, environmental correlates do not adequately explain these changes (Urban et al., 2008). In order to test whether these differences in behavior resulted from evolution or just plasticity associated with new toad environments, an experiment was created. The dispersal rates of parent populations during the cane toads invasive history was measured and compared to dispersal rates of the offspring. Through this collection method, researchers hoped to minimize environmental effects on on dispersal ability and estimate the heritability of dispersal. 184 toads were radiotracked over two seasons. Toads with larger bodies consistently moved farther than toads with normal or smaller body sizes. The breeding cohort resulted in high levels of variance in daily dispersal of the adult toads. This suggests that differences in birth date can have large influences in dispersal.The estimate of mean within-population genetic variance was large and suggested a narrow sense heritability of 0.24. In addition, there was a log mean daily displacement in this species with a large 95% interval of 0.02-0.72. Thus, there is evidence to suggest that there does seem to be a heritable variance within toad populations for dispersal. This selection on disperse could produce evolutionary change.

Female anurans have been shown to be the choosier sex, selecting mates that show good resource defense techniques or attractive male displays. However, the only way that females can exercise mate choice is by approaching a male with an attractive call or mating site. When a female approaches such sites, she may be intercepted by a "satellite" male that attempts to mate with the female by grasping her in amplexus (Wells 2007). This is particularly common in areas of high density. In a recent study conducted with B. marinus, it was found that perhaps females are not just passive participants in the mating process, but rather have a mechanism of exercising control. Evolutionarily, frogs and toads are able to protect themselves from predators by inflating their bodies. This increased girth may deter predators who may be threatened by an anuran that is too large to ingest. Similarly, female anurans frequently inflate their bodies when being amplexed from males. In this sense, the female cane toads could facilitate male-male competition by reducing the ability of undesirable mates to grasp onto her. In females who were unable to inflate their bodies, the small "satellite" male was aable to grasp onto the female despite takeover attempts by larger rivals. Body size of mates is a factor in female mate choice because fertilization success is highest when the males and females are close in size. Since females are the larger size, choosing a larger male increases the fitness of their offspring. Larger males are often able to displace smaller males, but smaller males rarely displace larger rivals. However, smaller males can resist takeover attempts if the female does not inflate her body. Therefore, this study shows that takeovers by larger males can show female and male tactics in sexual selection.

  • Brown, G. P., Shine, R., Ward-Fear, G. (2010). ''Using a native predator (the meat ant, Iridomyrmex reburrus) to reduce the abundance of an invasive species (the cane toad, Bufo marinus) in tropical Australia.'' Journal of Applied Ecology, 47, 273â€"280.
  • Bruning, B., Phillips, B.L., Shine, R. (2010). ''Turgid female toads give males the slip: a new mechanism of female mate choice in the Anura.'' The Royal Society- Biology Letters
  • Crossland, M. R. (2000). ''Direct and indirect effects of the introduced toad Bufo marinus on populations of native anuran larvae in Australia.'' Ecography, 23(3), 283-290.
  • Drewes R. C., Roth B. (1981). ''Snail-eating frogs from the Ethiopian highlands: a new anuran specialization.'' Zoological Journal of the Linnean Society, 73, 267-287.
  • Easteal, S. (1963). ''Bufo marinus.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 395.1-395.4.
  • Ingram, G. J., Covacevich J. (1990). ''Tropidonophis mairii vs. Bufo marinus. Memoirs of the Queensland Museum.'' , 29(396).
  • Lampo, M. and De Leo, G. A. (1998). ''The invasion ecology of the toad Bufo marinus: from South America to Australia.'' Ecological Applications, 8(2), 388-396.
  • Llewelyn J., Phillips B. L., Shine R. (2009). ''Sublethal costs associated with the consumption of toxic prey by snakes.'' Austral Ecology, 34, 179â€"184.
  • Llewelyn, J., Schwarzkopf L., Alford R., Shine R. (2009). ''Something different for dinner? Responses of a native Australian predator (the keelback snake) to an invasive prey species (the cane toad).'' Biological Invasions
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Phillips, B.L., Brown, G.P., Shine, R. (2010). ''Evolutionarily accelerated invasions, the rate of dispersal evolves upwards during the range advance of cane toads.'' Journal of Evolutionary Biology
  • Seebacher, F. and Alford, R. A. (1999). ''Movement and microhabitat use of a terrestrial amphibian (Bufo marinus) on a tropical island: seasonal variation and environmental correlates.'' Journal of Herpetology, 33(2), 208-214.
  • Shine, R. (2006). ''The Ecological Impact of Invasive Cane Toads (Bufo marinus) in Australia'' Quarterly Review of Biology: in press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Overall, there are no significant threats to this very adaptable, invasive species. Introduced animals are carrying salmonella in Puerto Rico, putting other native species at risk. In some parts of its introduced range it competes with native frogs and has a negative impact on native wildlife that attempt to consume it. Survival and development of tadpoles in Bermuda are being affected both by contaminants found in a number of its ponds and by transfer of accumulated contaminants (Bacon et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No significant threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

According to the Global Amphibian Assessment (GAA), Bufo marinus is of least concern with regards to extinction and its population is actually increasing. There are currently no significant threats to this species. Some animals that have been introduced to Puerto Rico carry salmonella, putting species that consume them at risk. In Bermuda, survival and development of tadpoles are being negatively affected due to contaminants in ponds and the transfer of accumulated contaminants (Bacon et al. 2006).

  • Brown, G. P., Shine, R., Ward-Fear, G. (2010). ''Using a native predator (the meat ant, Iridomyrmex reburrus) to reduce the abundance of an invasive species (the cane toad, Bufo marinus) in tropical Australia.'' Journal of Applied Ecology, 47, 273â€"280.
  • Bruning, B., Phillips, B.L., Shine, R. (2010). ''Turgid female toads give males the slip: a new mechanism of female mate choice in the Anura.'' The Royal Society- Biology Letters
  • Crossland, M. R. (2000). ''Direct and indirect effects of the introduced toad Bufo marinus on populations of native anuran larvae in Australia.'' Ecography, 23(3), 283-290.
  • Drewes R. C., Roth B. (1981). ''Snail-eating frogs from the Ethiopian highlands: a new anuran specialization.'' Zoological Journal of the Linnean Society, 73, 267-287.
  • Easteal, S. (1963). ''Bufo marinus.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 395.1-395.4.
  • Ingram, G. J., Covacevich J. (1990). ''Tropidonophis mairii vs. Bufo marinus. Memoirs of the Queensland Museum.'' , 29(396).
  • Lampo, M. and De Leo, G. A. (1998). ''The invasion ecology of the toad Bufo marinus: from South America to Australia.'' Ecological Applications, 8(2), 388-396.
  • Llewelyn J., Phillips B. L., Shine R. (2009). ''Sublethal costs associated with the consumption of toxic prey by snakes.'' Austral Ecology, 34, 179â€"184.
  • Llewelyn, J., Schwarzkopf L., Alford R., Shine R. (2009). ''Something different for dinner? Responses of a native Australian predator (the keelback snake) to an invasive prey species (the cane toad).'' Biological Invasions
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Phillips, B.L., Brown, G.P., Shine, R. (2010). ''Evolutionarily accelerated invasions, the rate of dispersal evolves upwards during the range advance of cane toads.'' Journal of Evolutionary Biology
  • Seebacher, F. and Alford, R. A. (1999). ''Movement and microhabitat use of a terrestrial amphibian (Bufo marinus) on a tropical island: seasonal variation and environmental correlates.'' Journal of Herpetology, 33(2), 208-214.
  • Shine, R. (2006). ''The Ecological Impact of Invasive Cane Toads (Bufo marinus) in Australia'' Quarterly Review of Biology: in press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures needed for this highly invasive species; rather, conservation measures for those species adversely affected by the expansion of the range of this species are what is required. Research on biology, impacts and methods to control their population growth in Australia are in place, but to date no effective controls have been implemented. In Papua New Guinea, the Solomon Islands, the Philippines and Japan, the impacts of this species on native frogs should be examined. An officially organized eradication programme has been initiated in the Grenadines (Daudin and Silva 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

This toad is considered the most widely-introduced amphibian species in the world. People have tried to use it to control insects such as the greybacked cane beetle, Lepidoderma albohirtum which threatened sugar cane production. However, there is no evidence that it has controlled any pest in Australia and it is now considered a pest species itself in its introduced range of Australia and on Pacific and Caribbean Islands. It preys on and outcompetes native amphibians and also causes predator declines, since these predators have no natural immunity to the bufotoxin it secretes. (Bureau of Rural Sciences 1998, Aguirre and Poss 1999).

Negative Impacts: injures humans (poisonous ); household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Introduced in many areas in effort to reduce populations of agricultural pests (insects, white sugar cane grub in Puerto Rico).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: As an introduced species, B. marinus can negatively impact native species and predator assemblages through competition, predation, and toxicity of its eggs or metamorphosed individuals(Punzo and Lindstrom 2001, Phillips et al. 2003). Phillips et al. (2003) concluded that introduced B. marinus potentially threaten populations of approximately 30 percent of terrestrial Australian snake species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relation to Humans

Humans are affected by the toxic skin secretions. Symptoms include irritation of the skin and burning of the eyes (Wright and Wright, 1949; Krakauer, 1968, 1970; Behler, 1979; Carmichael and Williams, 1991; Conant and Collins, 1991).

Marine toads have probably been introduced more widely than any other amphibian in the world (Behler, 1979; Carmichael and Williams, 1991). They have been introduced as a control agent for insects that damage sugarcane (Riemer, 1959; Krakauer, 1968; King, 1970), however, since they are nocturnal and many sugarcane pests are diurnal, they are not effective biocontrol agents. For information on introductions into Australia, please see Cane toad-Australia.

Human perceptions of the cane toad are largely negative, with many fearing its size, appearance, and potential invasive impact on Australian communities. Between 1986 and 1996, the state and federal government spent more than $9,500,000 (Shine et al. 2006) and enormous efforts by volunteers to control local toad populations by collection. However, these negative community perceptions of invasive species impacts are often in error. In actuality, the direct impact of cane toads falls heavily on a small number of native taxa, not a wide spectrum of native fauna. Others suggest a more direct effect on humans by claiming that toads are poisoning waterholes with their toxins and are even leading to drug abuse for humans that become addicted to licking the toads or smoking their dried skins (Clarke et al. 2009). However, there are no data that actually supports these claims.

Recently, humans have thought that a native predator, the meat ant (genus Iridomyrmex), could control the invasive cane toad populations. In an experimental setting, 98% of metamorph toads encountered at least one predator ant species in a high density ant environment, while 87% of metamorph toads encountered at least one predator ant species in a low density ant environment. Most of these toads were attacked, with 82.5% killed at high density and 51% killed at low density. From these data, it appears as though high ant density is more effective at controlling cane toad populations. There are multiple reasons to explain why this may have occurred. First, higher density inevitably leads to more encounters. In addition, at higher ant densities, ants are more likely to swarm onto a prey item. Lastly, higher ant densities increase the body-size threshold at which metamorph toads shift their defense mechanism from the active escape tactic to crypsis. As a result of this higher ant density, more toads of a wider range of body sizes are killed.

In the field, smaller metamorph deaths were most commonly observed. This may be because small metamorphs have a less effective response to ant attack and are also more vulnerable to disease and parasites, such as lungworm (Kelehear 2007), as well as dessication (Child et al. 2008). In addition, the low level of toxins in metamorphs make them even more susceptible to predator attack.

However, it should be noted that meat ants alone are not entirely feasible for controlling cane toad populations. Meat ants are only effective at killing metamorph toads, and may be less effective during the wet-season recruitment events. Increased ant densities might even serve as a food source for adult cane toads. Many are also cautious because using biocontrol in other instances have often vastly negatively affected ecosystems in ways that could not have been predicted. In this instance, the predator is already a native species and is simply being redirected to areas with high populations of cane toads. But reduced or increased populations of ants in certain areas may still affect native fauna, and meat ants can still competitively exclude ecologically similar ant species.

  • Brown, G. P., Shine, R., Ward-Fear, G. (2010). ''Using a native predator (the meat ant, Iridomyrmex reburrus) to reduce the abundance of an invasive species (the cane toad, Bufo marinus) in tropical Australia.'' Journal of Applied Ecology, 47, 273â€"280.
  • Bruning, B., Phillips, B.L., Shine, R. (2010). ''Turgid female toads give males the slip: a new mechanism of female mate choice in the Anura.'' The Royal Society- Biology Letters
  • Crossland, M. R. (2000). ''Direct and indirect effects of the introduced toad Bufo marinus on populations of native anuran larvae in Australia.'' Ecography, 23(3), 283-290.
  • Drewes R. C., Roth B. (1981). ''Snail-eating frogs from the Ethiopian highlands: a new anuran specialization.'' Zoological Journal of the Linnean Society, 73, 267-287.
  • Easteal, S. (1963). ''Bufo marinus.'' Catalogue of American Amphibians and Reptiles. American Society of Ichthyologists and Herpetologists, 395.1-395.4.
  • Ingram, G. J., Covacevich J. (1990). ''Tropidonophis mairii vs. Bufo marinus. Memoirs of the Queensland Museum.'' , 29(396).
  • Lampo, M. and De Leo, G. A. (1998). ''The invasion ecology of the toad Bufo marinus: from South America to Australia.'' Ecological Applications, 8(2), 388-396.
  • Llewelyn J., Phillips B. L., Shine R. (2009). ''Sublethal costs associated with the consumption of toxic prey by snakes.'' Austral Ecology, 34, 179â€"184.
  • Llewelyn, J., Schwarzkopf L., Alford R., Shine R. (2009). ''Something different for dinner? Responses of a native Australian predator (the keelback snake) to an invasive prey species (the cane toad).'' Biological Invasions
  • Maeda, N. and Matsui, M. (1990). Frogs and Toads of Japan, 2nd edition. Bun-Ichi Sogo Shuppan Co., Ltd., Tokyo, Japan.
  • Phillips, B.L., Brown, G.P., Shine, R. (2010). ''Evolutionarily accelerated invasions, the rate of dispersal evolves upwards during the range advance of cane toads.'' Journal of Evolutionary Biology
  • Seebacher, F. and Alford, R. A. (1999). ''Movement and microhabitat use of a terrestrial amphibian (Bufo marinus) on a tropical island: seasonal variation and environmental correlates.'' Journal of Herpetology, 33(2), 208-214.
  • Shine, R. (2006). ''The Ecological Impact of Invasive Cane Toads (Bufo marinus) in Australia'' Quarterly Review of Biology: in press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cane toad

For other uses, see Cane toads (disambiguation).

The cane toad (Rhinella marina), also known as the giant neotropical toad or marine toad, is a large, terrestrial true toad which is native to Central and South America, but has been introduced to various islands throughout Oceania and the Caribbean as well as northern Australia. It is a member of the genus Rhinella but was formerly in the genus Bufo, which includes many different true toad species found throughout Central and South America. The cane toad is a prolific breeder; females lay single-clump spawns with thousands of eggs. Its reproductive success is partly because of opportunistic feeding: it has a diet, unusual among anurans, of both dead and living matter. Adults average 10–15 cm (3.9–5.9 in) in length; the largest recorded specimen weighed 2.65 kg (5.8 lb) with a length of 38 cm (15 in) from snout to vent.

The cane toad is an old species. A fossil toad (specimen UCMP 41159) from the La Venta fauna of the late Miocene of Colombia is indistinguishable from modern cane toads from northern South America.[5] It was discovered in a floodplain deposit, which suggests the R. marina habitat preferences have always been for open areas.[6]

The cane toad has poison glands, and the tadpoles are highly toxic to most animals if ingested. Because of its voracious appetite, the cane toad has been introduced to many regions of the Pacific and the Caribbean islands as a method of agricultural pest control. The species derives its common name from its use against the cane beetle (Dermolepida albohirtum). The cane toad is now considered a pest and an invasive species in many of its introduced regions; of particular concern is its toxic skin, which kills many animals—native predators and otherwise—when ingested.

Taxonomy[edit]

Originally, the cane toads were used to eradicate pests from sugar cane, giving rise to their common name. The cane toad has many other common names, including "giant toad" and "marine toad"; the former refers to its size and the latter to the binomial name, R. marina. It was one of many species described by Linnaeus in his 18th-century work Systema Naturae (1758).[7] Linnaeus based the specific epithet marina on an illustration by Dutch zoologist Albertus Seba, who mistakenly believed the cane toad to inhabit both terrestrial and marine environments.[8] Other common names include "giant neotropical toad",[9] "Dominican toad",[10] "giant marine toad",[11] and "South American Cane Toad".[12] In Trinidadian English, they are commonly called crapaud, the French word for toad.[13]

The genus Rhinella is considered to constitute a distinct genus of its own, thus changing the scientific name of the cane toad. In this case the specific name marinus changes to marina to conform with the rules of gender agreement as set out by the International Code of Zoological Nomenclature changing the binomial name from Bufo marinus to Rhinella marina; the binomial Rhinella marinus was subsequently introduced as a synonym through misspelling by Pramuk, Robertson, Sites, and Noonan (2008).[2][3] Though controversial (with many traditional herpetologists still using Bufo marinus) the binomial Rhinella marina is gaining in acceptance with such bodies as the IUCN,[14] Encyclopaedia of Life,[15] Amphibian Species of the World [2] and increasing numbers of scientific publications adopting its usage.

A large, adult cane toad, showing the light colouration present in some specimens of the species
Light-coloured cane toad

In Australia, the adults may be confused with large native frogs from the genera Limnodynastes, Cyclorana and Mixophyes. These species can be distinguished from the cane toad by the absence of large parotoid glands behind their eyes and the lack of a ridge between the nostril and the eye.[16] Cane toads have been confused with the giant burrowing frog (Heleioporus australiacus), because both are large and warty in appearance; however, the latter can be readily distinguished from the former by its vertical pupils and its silver-grey (as opposed to gold) iris.[17] Juvenile cane toads may be confused with species of the Uperoleia genus, but their adult colleagues can be distinguished by the lack of bright colouring on the groin and thighs.[18]

In the United States, the cane toad closely resembles many bufonid species. In particular, it could be confused with the southern toad (Bufo terrestris), which can be distinguished by the presence of two bulbs in front of the parotoid glands.[19]

Description[edit]

A juvenile cane toad, showing many of the features of the adult toads, but without the large parotoid glands
Young cane toad

The cane toad is very large;[20] the females are significantly longer than males,[21] reaching an average length of 10–15 cm (3.9–5.9 in).[20] "Prinsen", a toad kept as a pet in Sweden, is listed by the Guinness Book of Records as the largest recorded specimen. It reportedly weighed 2.65 kg (5.84 lb) and measured 38 cm (15 in) from snout to vent, or 54 cm (21 in) when fully extended.[22] Larger toads tend to be found in areas of lower population density.[23] They have a life expectancy of 10 to 15 years in the wild,[24] and can live considerably longer in captivity, with one specimen reportedly surviving for 35 years.[25]

The skin of the cane toad is dry and warty.[20] It has distinct ridges above the eyes, which run down the snout.[16] Individual cane toads can be grey, yellowish, red-brown or olive-brown, with varying patterns.[26] A large parotoid gland lies behind each eye.[20] The ventral surface is cream-coloured and may have blotches in shades of black or brown. The pupils are horizontal and the irises golden.[17] The toes have a fleshy webbing at their base,[20] and the fingers are free of webbing.[26]

The juvenile cane toad is much smaller than the adult cane toad at 5–10 cm (2.0–3.9 in) long. Typically, they have smooth, dark skin, although some specimens have a red wash. Juveniles lack the adults' large parotoid glands, so they are usually less poisonous.[23] The tadpoles are small and uniformly black, and are bottom-dwellers, tending to form schools.[27] Tadpoles range from 10 to 25 mm (0.39 to 0.98 in) in length.[28]

Ecology, behaviour and life history[edit]

The common name "marine toad" and the scientific name Rhinella marina suggest a link to marine life,[29] but the adult cane toad is entirely terrestrial, only venturing to fresh water to breed. Tadpoles have been found to tolerate salt concentrations equivalent to at most 15% that of seawater.[30] The cane toad inhabits open grassland and woodland, and has displayed a "distinct preference" for areas that have been modified by humans, such as gardens and drainage ditches.[31] In their native habitats, the toads can be found in subtropical forests,[28] although dense foliage tends to limit their dispersal.[32]

The cane toad begins life as an egg, which is laid as part of long strings of jelly in water. A female lays 8,000–25,000 eggs at once and the strings can stretch up to 20 metres (66 ft) in length.[29] The black eggs are covered by a membrane and their diameter is approximately 1.7–2.0 mm (0.067–0.079 in).[29] The rate at which an egg evolves into a tadpole is dependent on the temperature; the pace of development increases with temperature. Tadpoles typically hatch within 48 hours, but the period can vary from 14 hours up to almost a week.[29] This process usually involves thousands of tadpoles—which are small, black and have short tails—forming into groups. It takes between 12 and 60 days for the tadpoles to develop into toadlets, with four weeks being typical.[29] Similarly to their adult counterparts, eggs and tadpoles are toxic to many animals.[20]

When they emerge, toadlets typically are about 10–11 mm (0.39–0.43 in) in length, and grow rapidly. While the rate of growth varies by region, time of year and gender, Zug and Zug found an average initial growth rate of 0.647 mm (0.0255 in) per day, followed by an average rate of 0.373 mm (0.0147 in) per day. Growth typically slows once the toads reach sexual maturity.[33] This rapid growth is important for their survival; in the period between metamorphosis and subadulthood, the young toads lose the toxicity that protected them as eggs and tadpoles, but have yet to fully develop the parotoid glands that produce bufotoxin.[34] Because they lack this key defence, only 0.5% of cane toads are estimated to reach adulthood.[23][35]

As with rates of growth, the point at which the toads become sexually mature varies across different regions. In New Guinea, sexual maturity is reached by female toads with a snout–vent length between 70 and 80 mm (2.8 and 3.1 in), while toads in Panama achieve maturity when they are between 90 and 100 mm (3.5 and 3.9 in) in length.[36] In tropical regions, such as their native habitats, breeding occurs throughout the year, but in subtropical areas, breeding occurs only during warmer periods that coincide with the onset of the wet season.[37]

The cane toad is estimated to have a critical thermal maximum of 40–42 °C (104–108 °F) and a minimum of around 10–15 °C (50–59 °F).[38] The ranges can change due to adaptation to the local environment.[39] The cane toad has a high tolerance to water loss—one study showed some can withstand a 52.6% loss of body water, allowing them to survive outside tropical environments.[39]

Diet[edit]

Most frogs identify prey by movement, and vision appears to be the primary method by which the cane toad detects prey; however, the cane toad can also locate food using its sense of smell.[40] They eat a wide range of material; in addition to the normal prey of small rodents, reptiles, other amphibians, birds and a range of invertebrates, they also eat plants, dog food and household refuse. [41]

An adult cane toad with dark colouration, as found in El Salvador: The parotoid gland is prominently displayed on the side of the head.
Specimen from El Salvador: The large parotoid glands are visible behind the eyes.

Defenses[edit]

The skin of the adult cane toad is toxic, as well as the enlarged parotoid glands behind the eyes, and other glands across their backs. When the toads are threatened, their glands secrete a milky-white fluid known as bufotoxin.[42] Components of bufotoxin are toxic to many animals;[43] there have even been human deaths due to the consumption of cane toads.[28]

Bufotenin, one of the chemicals excreted by the cane toad, is classified as a class 1 drug under Australian law, alongside heroin and cannabis. The effects of bufotenin are thought to be similar to those of mild poisoning; the stimulation, which includes mild hallucinations, lasts for less than an hour.[44] As the cane toad excretes bufotenin in small amounts, and other toxins in relatively large quantities, toad licking could result in serious illness or death.[45]

In addition to releasing toxin, the cane toad is capable of inflating its lungs, puffing up and lifting its body off the ground to appear taller and larger to a potential predator.[42]

Poisonous sausages containing toad meat are being trialled in the Kimberley (Western Australia) to try to protect native animals from cane toads' deadly impact. The Western Australian Department of Environment and Conservation has been working with the University of Sydney to develop baits to train native animals not to eat the toads. By blending bits of toad with a nausea-inducing chemical, the baits train the animals to stay away from the amphibians. Researcher David Pearson says trials run in laboratories and in remote parts of the Kimberley region of WA are looking promising, although the baits will not solve the cane toad problem altogether.[46]

Predators[edit]

Many species prey on the cane toad and its tadpoles in its native habitat, including the broad-snouted caiman (Caiman latirostris), the banded cat-eyed snake (Leptodeira annulata), the eel (family: Anguillidae), various species of killifish,[47] the rock flagtail (Kuhlia rupestris), some species of catfish (order: Siluriformes). some species of ibis (subfamily: Threskiornithinae).[47] and Paraponera clavata (bullet ants). Predators outside the cane toad's native range include the whistling kite (Haliastur sphenurus), the rakali (Hydromys chrysogaster), the black rat (Rattus rattus) and the water monitor (Varanus salvator). There have been occasional reports of the tawny frogmouth (Podargus strigoides) and the Papuan frogmouth (Podargus papuensis)[48] feeding on cane toads; some Australian crow species (Corvus spp.) have also learned strategies allowing them to feed upon cane toads.[49][50] Opossums of the Didelphis genus likely can eat cane toads with impunity.[51]

Meat ants are able to kill poisonous cane toads, an introduced pest, as the toxins that usually kill a cane toad's predators do not affect the meat ants.[52] The cane toad's normal response to attack is to stand still and let their toxin kill the attacker, which allows the ants to attack and eat the toad.[53]

Distribution[edit]

The cane toad is native to the Americas, and its range stretches from the Rio Grande Valley in South Texas to the central Amazon and southeastern Peru.[54][55] This area encompasses both tropical and semiarid environments. The density of the cane toad is significantly lower within its native distribution than in places where it has been introduced. In South America, the density was recorded to be 20 adults per 100 m (109 yd) of shoreline, 1 to 2% of the density in Australia.[56]

Introductions[edit]

The cane toad has been introduced to many regions of the world—particularly the Pacific—for the biological control of agricultural they were brought to help get rid of pests.[54] These introductions have generally been well documented, and the cane toad may be one of the most studied of any introduced species.[57]

Before the early 1840s, the cane toad had been introduced into Martinique and Barbados, from French Guiana and Guyana.[58] An introduction to Jamaica was made in 1844 in an attempt to reduce the rat population.[59] Despite its failure to control the rodents, the cane toad was introduced to Puerto Rico in the early 20th century in the hope that it would counter a beetle infestation ravaging the sugarcane plantations. The Puerto Rican scheme was successful and halted the economic damage caused by the beetles, prompting scientists in the 1930s to promote it as an ideal solution to agricultural pests.[60]

As a result, many countries in the Pacific region emulated the lead of Puerto Rico and introduced the toad in the 1930s.[61] There are introduced populations in Australia, Florida,[62] Papua New Guinea,[63] the Philippines,[64] the Ogasawara, Ishigaki Island and the Daitō Islands of Japan,[65] most Caribbean islands,[61] Fiji and many other Pacific islands,[61] including Hawaii.[66][67] Since then, the cane toad has become a pest in many host countries, and poses a serious threat to native animals.[68]

Australia[edit]

A map of Australia with the cane toad's distribution highlighted: The area follows the northeastern coast of Australia, ranging from the Northern Territory through to the north end of New South Wales.
Distribution of the cane toad in Australia (note: map out of date - current range includes Nthn WA)

Following the apparent success of the cane toad in eating the beetles threatening the sugarcane plantations of Puerto Rico, and the fruitful introductions into Hawaii and the Philippines, there was a strong push for the cane toad to be released in Australia to negate the pests that were ravaging the Queensland cane fields.[69] As a result, 102 toads were collected from Hawaii and brought to Australia.[70] After an initial release in August 1935, the Commonwealth Department of Health decided to ban future introductions until a study was conducted into the feeding habits of the toad. The study was completed in 1936 and the ban lifted, at which point large-scale releases were undertaken; by March, 1937, 62,000 toadlets had been released into the wild.[70][71] The toads became firmly established in Queensland, increasing exponentially in number and extending their range into the Northern Territory and New South Wales.[26][70] Recently, the toads have made their way into Western Australia and one has even been found on the far western coast in Broome.[72]

However, the toad was generally unsuccessful in reducing the targeted grey backed beetles, in part because the cane fields provided insufficient shelter for the predators during the day,[73] in part because the beetles live at the tops of sugar cane - and Cane toads are not good climbers.[69] Since its original introduction, the cane toad has had a particularly marked effect on Australian biodiversity. The population of a number of native predatory reptiles has declined, such as the varanid lizards Varanus mertensi, V. mitchelli, and V. panoptes, the land snakes Pseudechis australis and Acanthophis antarcticus, and the crocodile species Crocodylus johnstoni; in contrast, the population of the agamid lizard Amphibolurus gilberti—known to be a prey item of V. panoptes—has increased.[74]

Caribbean[edit]

The cane toad was introduced to various Caribbean islands to counter a number of pests infesting local crops.[75] While it was able to establish itself on some islands, such as Barbados, Jamaica, and Puerto Rico, other introductions, such as in Cuba before 1900 and in 1946, and on the islands of Dominica and Grand Cayman, were unsuccessful.[76]

The earliest recorded introductions were to Barbados and Martinique. The Barbados introductions were focused on the biological control of pests damaging the sugarcane crops,[77] and while the toads became abundant, they have not been as successful in controlling the pests as in Australia.[78] The toad was introduced to Martinique from French Guiana before 1944 and became established. Today, they reduce the mosquito and mole cricket populations.[79] A third introduction to the region occurred in 1884, when toads appeared in Jamaica, reportedly imported from Barbados to help control the rodent population. While they had no significant effect on the rats, they nevertheless became well established.[80] Other introductions include the release on Antigua—possibly before 1916, although there are suggestions that this initial population may have died out by 1934 and been reintroduced at a later date—[81] and Montserrat, which saw an introduction before 1879 that led to the establishment of a solid population, which was apparently sufficient to survive the Soufrière Hills volcano eruption in 1995.[82]

In 1920, the cane toad was introduced into Puerto Rico to control the populations of white-grub (Phyllophaga spp.), a sugarcane pest.[83] Before this, the pests were manually collected by humans, so the introduction of the toad eliminated labor costs.[83] A second group of toads was imported in 1923, and by 1932, the cane toad was well established.[84] The population of white-grubs dramatically decreased,[83] and this was attributed to the cane toad at the annual meeting of the International Sugar Cane Technologists in Puerto Rico.[68] However, there may have been other factors.[68] The six-year period after 1931—when the cane toad was most prolific, and the white-grub saw dramatic decline—saw the highest-ever rainfall for Puerto Rico.[85] Nevertheless, the cane toad was assumed to have controlled the white-grub; this view was reinforced by a Nature article titled "Toads save sugar crop",[68] and this led to large-scale introductions throughout many parts of the Pacific.[86]

The cane toad has been spotted in Carriacou and Dominica, the latter appearance occurring in spite of the failure of the earlier introductions.[87] On September 8, 2013, the cane toad was also discovered on the island of New Providence in the Bahamas.[88]

The Philippines[edit]

Rhinella marina in the Philippines are referred to as kamprag, a corruption of 'American frog'.[89]

The cane toad was first introduced deliberately into the Philippines in 1930 as a biological control agent of pests in sugarcane plantations. This was done after the 'success' of the experimental introductions into Puerto Rico.[90][91] It subsequently became the most ubiquitous amphibian in the islands. It still retains the common name of kamprag in the Visayan languages, a corruption of 'American frog', referring to its origins.[89] It is also commonly known as 'bullfrog' in Philippine English.[92]

Fiji[edit]

The cane toad was introduced into Fiji to combat insects that infested sugarcane plantations. The introduction of the cane toad to the region was first suggested in 1933, following the successes in Puerto Rico and Hawaii. After considering the possible side effects, the national government of Fiji decided to release the toad in 1953, and 67 specimens were subsequently imported from Hawaii.[93] Once the toads were established, a 1963 study concluded, as the toad's diet included both harmful and beneficial invertebrates, it was considered "economically neutral".[67] Today, the cane toad can be found on all major islands in Fiji, although they tend to be smaller than their counterparts in other regions.[94]

New Guinea[edit]

The cane toad was successfully introduced into New Guinea to control the hawk moth larvae eating sweet potato crops.[63] The first release occurred in 1937 using toads imported from Hawaii, with a second release the same year using specimens from the Australian mainland. Evidence suggests a third release in 1938, consisting of toads being used for human pregnancy tests—many species of toad were found to be effective for this task, and were employed for about 20 years after the discovery was announced in 1948.[95][96] Initial reports argued the toads were effective in reducing the levels of cutworms and sweet potato yields were thought to be improving.[97] As a result, these first releases were followed by further distributions across much of the region,[97] although their effectiveness on other crops, such as cabbages, has been questioned; when the toads were released at Wau, the cabbages provided insufficient shelter and the toads rapidly left the immediate area for the superior shelter offered by the forest.[98] A similar situation had previously arisen in the Australian cane fields, but this experience was either unknown or ignored in New Guinea.[98] The cane toad has since become abundant in rural and urban areas.[99]

United States[edit]

The cane toad naturally exists in South Texas, but attempts (both deliberate and accidental) have been made to introduce the species to other parts of the country. These include introductions to Florida and to the islands of Hawaii, as well as largely unsuccessful introductions to Louisiana.[100]

Initial releases into Florida failed. Attempted introductions before 1936 and 1944, made with the objective of controlling sugarcane pests, were unsuccessful as the toads failed to proliferate. Later attempts failed in the same way.[101][102] However, the toad gained a foothold in the state after an accidental release by an importer at Miami International Airport in 1957, and deliberate releases by animal dealers in 1963 and 1964 established the toad in other parts of Florida.[102][103] Today, the cane toad is well established in the state, from the Keys to north of Tampa, and they are gradually extending further northward.[104] In Florida, the toad is a regarded as a threat to both native species [105] and to pets,[106] so much so, the Florida Fish and Wildlife Conservation Commission recommends residents kill them.[107]

A selection of cane toad merchandise, including key rings made from their legs, a coin purse made from the head, front limbs and body of a toad, and a stuffed cane toad
Cane toad merchandise

Around 150 cane toads were introduced to Oahu in Hawaii in 1932, and the population swelled to 105,517 after 17 months.[61] The toads were sent to the other islands, and more than 100,000 toads were distributed by July 1934;[108] eventually over 600,000 were transported.[109]

Uses[edit]

Other than the previously mentioned use as a biological control for pests, the cane toad has been employed in a number of commercial and noncommercial applications. Traditionally, within the toad's natural range in South America, the Embera-Wounaan would "milk" the toads for their toxin, which was then employed as an arrow poison. The toxins may have been used as an entheogen by the Olmec people. The toad has been hunted as a food source in parts of Peru, and eaten after the removal of the skin and parotoid glands.[110] When properly prepared, the meat of the toad is considered healthy and as a source of omega-3 fatty acids.[111] More recently, the toad's toxins have been used in a number of new ways: bufotenin has been used in Japan as an aphrodisiac and a hair restorer, and in cardiac surgery in China to lower the heart rates of patients.[28] New research has suggested that the cane toad's poison may have some applications in treating prostate cancer.[112]

Other modern applications of the cane toad include pregnancy testing,[110] as pets,[113] laboratory research,[114] and the production of leather goods. Pregnancy testing was conducted in the mid-20th century by injecting urine from a woman into a male toad's lymph sacs, and if spermatozoa appeared in the toad's urine, the patient was deemed to be pregnant.[110] The tests using toads were faster than those employing mammals; the toads were easier to raise, and, although the initial 1948 discovery employed Bufo arenarum for the tests, it soon became clear that a variety of anuran species were suitable, including the cane toad. As a result, toads were employed in this task for around 20 years.[96] As a laboratory animal, the cane toad is regarded as ideal; they are plentiful, and easy and inexpensive to maintain and handle. The use of the cane toad in experiments started in the 1950s, and by the end of the 1960s, large numbers were being collected and exported to high schools and universities.[114] Since then, a number of Australian states have introduced or tightened importation regulations.[115] Even dead toads have value. Cane toad skin has been made into leather and novelty items;[116][117] stuffed cane toads, posed and accessorised, have found a home in the tourist market,[118] and attempts have been made to produce fertilizer from their bodies.[119]

See also[edit]

References[edit]

  1. ^ Solis et al. 2008. Database entry includes a range map and justification for this species is of least concern.
  2. ^ a b c "Amphibian Species of the World: an Online Reference. Version 5.5". Frost, Darrel R. American Museum of Natural History, New York, USA. 31 January 2011. Retrieved June 4, 2012. 
  3. ^ a b "Around the world in 10 million years: biogeography of the nearly cosmopolitan true toads (Anura: Bufonidae)". Global Ecology and Biogeography, 17: 76. Retrieved June 4, 2012. 
  4. ^ a b Crossland, Alford & Shine 2009, p. 626
  5. ^ Estes, Richard and Richard Wassersurg (1963). A Miocene toad from Colombia, South America. Breviora, 193:1-13, December 5.
  6. ^ Zug, George R., and Patricia B. Zug (1979). The Marine Toad, Bufo marinus: A Natural History Resume of Native Populations. Smithsonian Contributions to Zoology, number 284, 58 pages.
  7. ^ Linnaeus 1758, p. 824
  8. ^ Beltz 2007
  9. ^ Easteal et al. 1985, p. 185
  10. ^ "Cane Toad (Bufo marinus)". National Invasive Species Information Center. United States Department of Agriculture. June 15, 2009. Retrieved June 17, 2009. 
  11. ^ Caughley & Gunn 1996, p. 140
  12. ^ Australian State of the Environment Committee 2002, p. 107
  13. ^ Kenny 2008, p. 35
  14. ^ "Rhinella marina". IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2. Solís, F., Ibáñez, R., Hammerson, G., Hedges, B., Diesmos, A., Matsui, M., Hero, J.-M., Richards, S., Coloma, L., Ron, S., La Marca, E., Hardy, J., Powell, R., Bolaños, F., Chaves, G. & Ponce, P. 2009. Retrieved June 4, 2012. 
  15. ^ "Rhinella marina". Encyclopaedia of Life. Retrieved June 4, 2012. 
  16. ^ a b Vanderduys & Wilson 2000, p. 1
  17. ^ a b "Giant Burrowing Frog". Wildlife of Sydney. Australian Museum. April 15, 2009. Retrieved June 17, 2009. 
  18. ^ Barker, Grigg & Tyler 1995, p. 381
  19. ^ Brandt & Mazzotti 2005, p. 3
  20. ^ a b c d e f Robinson 1998
  21. ^ Lee 2001, p. 928
  22. ^ Wyse 1997, p. 249
  23. ^ a b c Tyler 1989, p. 117
  24. ^ Tyler 1989, pp. 117–118
  25. ^ Grenard 2007, p. 55
  26. ^ a b c Cameron 2009
  27. ^ Tyler 1976, p. 81
  28. ^ a b c d Invasive Species Specialist Group 2006
  29. ^ a b c d e Tyler 1989, p. 116
  30. ^ Ely 1944, p. 256
  31. ^ Lever 2001, p. 3
  32. ^ Barker, Grigg & Tyler 1995, p. 380
  33. ^ Zug & Zug 1979, pp. 14–15
  34. ^ Zug & Zug 1979, p. 15
  35. ^ Anstis 2002, p. 274
  36. ^ Zug & Zug 1979, p. 8
  37. ^ Lever 2001, p. 6
  38. ^ Tyler 1989, p. 118
  39. ^ a b Tyler 1989, p. 119
  40. ^ Lever 2001, p. 10
  41. ^ Tyler 1989, pp. 130–132
  42. ^ a b Tyler 1989, p. 134
  43. ^ Tyler 1989, pp. 134–136
  44. ^ Fawcett 2004, p. 9
  45. ^ Weil & Davis 1994, pp. 1–8
  46. ^ "Cane toad sausages". abc.net.au. Retrieved 2011-11-15. 
  47. ^ a b Tyler 1989, p. 138–139
  48. ^ Angus 1994, pp. 10–11
  49. ^ Katrina Bolton (2007-09-15). "Toads fall victim to crows in NT – ABC News (Australian Broadcasting Corporation)". Abc.net.au. Retrieved 2011-11-12. 
  50. ^ "Cane Toad (Bufo marinus)". Ozanimals.com. Retrieved 2011-11-12. 
  51. ^ "American possums the solution to cane toads in Australia? - Science Show - 20 March 2010". Abc.net.au. Archived from the original on 2010-03-22. Retrieved 2010-04-26. 
  52. ^ Sweeney, Claire (31 March 2009). "Killer ants are weapons of mass toad destruction". London: Times Online. Retrieved 2009-03-31. 
  53. ^ sjwt, sjwt. "Cane Toads". Queensland Museum. Retrieved 2012-07-31. 
  54. ^ a b Tyler 1989, p. 111
  55. ^ Zug & Zug 1979, pp. 1–2
  56. ^ Lampo & De Leo 1998, p. 392
  57. ^ Easteal 1981, p. 94
  58. ^ Easteal 1981, p. 96
  59. ^ Lannoo 2005, p. 417
  60. ^ Tyler 1989, pp. 112–113
  61. ^ a b c d Tyler 1989, pp. 113–114
  62. ^ Smith 2005, pp. 433–441
  63. ^ a b Zug, Lindgrem & Pippet 1975, pp. 31–50
  64. ^ Alcala 1957, pp. 90–96
  65. ^ Kidera et al. 2008, pp. 423–440
  66. ^ Oliver & Shaw 1953, pp. 65–95
  67. ^ a b Hinckley 1963, pp. 253–259
  68. ^ a b c d Tyler 1989, p. 113
  69. ^ a b Tyler 1976, p. 77
  70. ^ a b c Easteal 1981, p. 104
  71. ^ Tyler 1976, pp. 78–79
  72. ^ Cane toads found on WA coast, Australian Geographic, July 21, 2010
  73. ^ Tyler 1976, p. 83
  74. ^ Doody et al. 2009, pp. 46–53. On snake populations see Shine 2009, p. 20.
  75. ^ Lever 2001, p. 67
  76. ^ Lever 2001, pp. 73–74
  77. ^ Lever 2001, p. 71
  78. ^ Kennedy, Anthony quoted in Lever 2001, p. 72
  79. ^ Lever 2001, p. 81
  80. ^ Lever 2001, pp. 78–79
  81. ^ Easteal 1981, p. 98
  82. ^ Lever 2001, pp. 81–82
  83. ^ a b c Tyler 1989, p. 112
  84. ^ Van Volkenberg 1935, pp. 278–279. "After a completely successful method of killing white grubs by chemical means was found, the only opportunities for its use in Puerto Rico have been limited to small areas in pineapple plantations at elevations where the toad is even yet not present in sufficient abundance."
  85. ^ Freeland 1985, pp. 211–215
  86. ^ Tyler 1989, pp. 113–115
  87. ^ Lever 2001, pp. 72–73
  88. ^ "Killer Toad Found in New Providence". Tribute 242. Retrieved 2013-09-07. 
  89. ^ a b "kamprag". Binisaya.com. 
  90. ^ Ross Piper (2011). Pests: A Guide to the World's Most Maligned, Yet Misunderstood Creatures. ABC-CLIO. p. 236. ISBN 978-0-313-38426-4. 
  91. ^ Arvin C. Diesmos, Mae L. Diesmos, & Rafe M. Brown (2005). "Status and Distribution of Alien Invasive Frogs in the Philippines". Journal of Environmental Science and Management 9 (2): 41–53. ISSN 0119-1144. 
  92. ^ Ranell Martin M. Dedicatoria, Carmelita M. Rebancos, Leticia E. Afuang and Ma. Victoria O. Espaldon (2010). "Identifying Environmental Changes in Mt. Data Watershed, Bauko, Mt. Province, Northern Philippines: Implications to Sustainable Management". 4th Asian Rural Sociology Association (ARSA) International Conference. pp. 402–412. 
  93. ^ Lever 2001, pp. 128–129
  94. ^ Lever 2001, pp. 130–131
  95. ^ Easteal 1981, p. 103
  96. ^ a b Tyler, Wassersug & Smith 2007, pp. 6–7
  97. ^ a b Lever 2001, p. 118
  98. ^ a b Tyler 1976, pp. 83–84
  99. ^ Lever 2001, p. 119
  100. ^ Easteal 1981, pp. 100–102
  101. ^ Lever 2001, p. 57
  102. ^ a b Easteal 1981, p. 100
  103. ^ Lever 2001, p. 58
  104. ^ Lever 2001, p. 59
  105. ^ "Bufo Marinus @ Florida Wildlife Extension at UF/IFAS". Wec.ufl.edu. Retrieved 2010-04-26. 
  106. ^ "Poisonous Bufo May Have Toad Hold On Temple Terrace". .tbo.com. 2007-11-02. Retrieved 2010-04-26. 
  107. ^ "WEC 11/UW046: Marine Toads (Bufo marinus)". Edis.ifas.ufl.edu. Retrieved 2010-04-26. 
  108. ^ Lever 2001, p. 64
  109. ^ Easteal 1981, p. 101
  110. ^ a b c Lever 2001, p. 32
  111. ^ Terzon, Emilia (11 November 2014). "Eating cane toads a win-win solution for Australia's environment and stomachs, says academic". ABC. Retrieved 11 November 2014. 
  112. ^ http://www.abc.net.au/news/2014-09-17/cane-toad-venom-attacks-cancer-cells/5750114
  113. ^ Mattison 1987, p. 145
  114. ^ a b Tyler 1976, p. 85
  115. ^ Tyler 1976, pp. 88–89
  116. ^ McCarin 2008, p. 8
  117. ^ Hardie 2001, p. 3
  118. ^ Bateman 2008, p. 48
  119. ^ Australian Associated Press 2006
Sources
  • Alcala, A. C. (1957). "Philippine notes on the ecology of the giant marine toad". Silliman Journal 4 (2). 
  • Angus, R. (1994). "Observation of a Papuan Frogmouth at Cape York [Queensland]". Australian Birds 28. 
  • Anstis, M. (2002). Tadpoles of South-Eastern Australia: A Guide with Keys. Reed New Holland. ISBN 1-876334-63-0. 
  • Australian Associated Press (January 25, 2006). "Toads to be juiced". Sydney Morning Herald. Retrieved July 7, 2009. 
  • Australian State of the Environment Committee (2002). Biodiversity. Australia: CSIRO Publishing. ISBN 0-643-06749-3. 
  • Barker, John; Grigg, Gordon; Tyler, Michael (1995). A Field Guide to Australian Frogs. Surrey Beatty & Sons. ISBN 0-949324-61-2. 
  • Bateman, Daniel (May 10, 2008). "Toad business the stuff of dreams". Townsville Bulletin. 
  • Beltz, Ellin (September 10, 2007). "Scientific and Common Names of the Reptiles and Amphibians of North America". Retrieved June 15, 2009. 
  • Brandt, Laura A.; Mazzotti, Frank J. (2005). "Marine Toads (Bufo marinus)". University of Florida. 
  • Cameron, Elizabeth (June 10, 2009). "Cane Toad". Wildlife of Sydney. Australian Museum. Retrieved June 18, 2009. 
  • Caughley, Graeme; Gunn, Anne (1996). Conservation biology in theory and practice. Wiley-Blackwell. ISBN 0-86542-431-4. 
  • Crossland, Michael R.; Alford, Ross A.; Shine, Richard (2009). "Impact of the invasive cane toad (Bufo marinus) on an Australian frog (Opisthodon ornatus) depends on minor variation in reproductive timing". Population Ecology 158 (4): 625. doi:10.1007/s00442-008-1167-y. 
  • Doody, J. S.; Green, B.; Rhind, D.; Castellano, C. M.; Sims, R.; Robinson, T. (2009). "Population-level declines in Australian predators caused by an invasive species". Animal Conservation 12 (1): 46. doi:10.1111/j.1469-1795.2008.00219.x. 
  • Easteal, Simon (1981). "The history of introductions of Bufo marinus (Amphibia : Anura); a natural experiment in evolution". Biological Journal of the Linnean Society 16 (16): 93. doi:10.1111/j.1095-8312.1981.tb01645.x. 
  • Easteal, Simon; van Beurden, Eric K.; Floyd, Robert B.; Sabath, Michael D. (June 1985). "Continuing Geographical Spread of Bufo marinus in Australia: Range Expansion between 1974 and 1980". Journal of Herpetology 19 (2). 
  • Ely, C. A. (1944). "Development of Bufo marinus larvae in dilute sea water". Copeia 56 (4): 256. doi:10.2307/1438692. JSTOR 1438692. 
  • Fawcett, Anne (August 4, 2004). "Really caning it". The Sydney Morning Herald. p. 9. 
  • Freeland, W. J. (1985). "The Need to Control Cane Toads". Search 16 (7–8): 211–215. 
  • Grenard, Steve (2007). Frogs and Toads. John Wiley and Sons. ISBN 0-470-16510-3. 
  • Hardie, Alan (January 22, 2001). "It's tough selling toads ...". Northern Territory News. 
  • Hinckley, A. D. (1963). "Diet of the giant toad, Budo marinus (L.) in Fiji". Herpetologica 18 (4). 
  • Invasive Species Specialist Group (June 1, 2006). "Ecology of Bufo marinus". Global Invasive Species Database. Retrieved July 2, 2009. 
  • Kenny, Julian (2008). The Biological Diversity of Trinidad and Tobago: A Naturalist's Notes. Prospect Press. ISBN 976-95082-3-3. 
  • Kidera, N.; Tandavanitj, N.; Oh, D.; Nakanishi, N.; Satoh, A.; Denda, T.; Izawa, M.; Ota, H. (2008). "Dietary habits of the introduced cane toad Bufo marinus (Amphibia : Bufonidae) on Ishigakijima, southern Ryukyus, Japan". Pacific Science 62 (3): 423. doi:10.2984/1534-6188(2008)62[423:DHOTIC]2.0.CO;2. 
  • Lampo, Margarita; De Leo, Giulio A. (1998). "The Invasion Ecology of the Toad Bufo marinus: from South America to Australia". Ecological Applications 8 (2). 
  • Lannoo, Michael J. (2005). Amphibian Declines: The Conservation Status of United States Species. University of California Press. ISBN 0-520-23592-4. 
  • Lee, Julian C. (2001). Price, A. H, ed. "Evolution of a Secondary Sexual Dimorphism in the Toad, Bufo marinus". Copeia 2001 (4): 928–935. doi:10.1643/0045-8511(2001)001[0928:EOASSD]2.0.CO;2. ISSN 0045-8511. 
  • Lever, Christopher (2001). The Cane Toad. The history and ecology of a successful colonist. Westbury Publishing. ISBN 1-84103-006-6. 
  • (Latin) Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). 
  • Mattison, Chris (1987). Frogs & Toads of the World. Blandford Press. ISBN 0-7137-1825-0. 
  • McCarin, Julie (April 29, 2008). "Kisses for a toad". The Leader. 
  • Oliver, J. A.; Shaw, C. E. (1953). "The amphibians and reptiles of the Hawaiian Islands". Zoologica (New York) 38 (5). 
  • Robinson, Martyn (1998). A field guide to frogs of Australia: from Port Augusta to Fraser Island including Tasmania. Reed New Holland. ISBN 1-876334-83-5. 
  • Shine, Rick (July 2009). "Controlling Cane Toads Ecologically". Australasian Science 30 (6): 20–23. 
  • Smith, K. G. (2005). "Effects of nonindigenous tadpoles on native tadpoles in Florida: evidence of competition". Biological Conservation 123 (4): 433. doi:10.1016/j.biocon.2005.01.005. 
  • Solis, Frank; Ibáñez, Roberto; Hammerson, Geoffrey; Hedges, Blair; Diesmos, Arvin; Matsui, Masafumi; Hero, Jean-Marc; Richards, Stephen; Coloma, Luis A.; Ron, Santiago; La Marca, Enrique; Hardy, Jerry; Powell, Robert; Bolaños, Federico; Chaves, Gerardo (2008). "Rhinella marina". IUCN Red List of Threatened Species. 2009.1. Retrieved June 15, 2009. 
  • Tyler, Michael J. (1976). Frogs. William Collins (Australia). ISBN 0-00-211442-9. 
  • Tyler, Michael J. (1989). Australian Frogs. Penguin Books. ISBN 0-670-90123-7. 
  • Tyler, Michael J.; Wassersug, Richard; Smith, Benjamin (2007). "How frogs and humans interact: Influences beyond habitat destruction, epidemics and global warming". Applied Herpetology 4 (1): 1. doi:10.1163/157075407779766741. 
  • Vanderduys, Eric; Wilson, Steve (2000). "Cane Toads (Fact Sheet)". Queensland Museum. 
  • Van Volkenberg, H. L. (1935). "Biological Control of an Insect Pest by a Toad". Science 82 (2125): 278–9. doi:10.1126/science.82.2125.278. PMID 17792964. 
  • Weil, A. T.; Davis, W. (1994). "Bufo alvarius: a potent hallucinogen of animal origin". Journal of Ethnopharmacology 41 (1–2): 1–8. doi:10.1016/0378-8741(94)90051-5. PMID 8170151. 
  • Wyse, E. (editor) (1997). Guinness Book of Records 1998. Guinness Publishing. ISBN 0-85112-044-X. 
  • Zug, G. R.; Lindgrem, E.; Pippet, J. R. (1975). "Distribution and ecology of marine toad, Bufo marinus, in Papua New Guinea". Pacific Science 29 (1). 
  • Zug, G. R.; Zug, P. B. (1979). "The Marine Toad, Bufo marinus: A natural history resumé of native populations". Smithsonian Contributions to Zoology 284. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!