Overview

Comprehensive Description

Description

Tympanic membrane absent. Transversal processes of the vertebra sacralis notably widened. Pupil of the eye triangular. Skin tuberculate. Dorsal tubercles rounded rather than coming to a point. Dorsal surface dark-grayish to almost black, with large dark spots. In pools with opaque water, a sandy bottom and scarce riparian vegetation, the toads sometimes possess a bright-green dorsal coloration with scarce dark-green spots. Belly red or orange, with large bluish-black spots and numerous white points. On the belly, the bright coloration does not exceed the dark coloration in area. The inner surface of the leg is covered with small bright spots, which are not fused. In contrast to the female, the male has internal resonators, a slightly larger head and, during the breeding season, black nuptial pads on the 1st and 2nd fingers and on the inner surface of his forearm.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Basoglu, M. and Ozeti, N. (1973). Turkiye Amphibileri. Ege Univ, Bornova-Izmir.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Krone, A. and Kuhnel, K.-D. (1996). Die Rotbauchunke (Bombina bombina): Okologie und Bestandssituation. Rana. Rangsdorf, Sonderheit.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in central and eastern Europe ranging from Denmark, southern Sweden and northern Germany eastwards to the Ural Mountains of Russia, southwards to the Danube floodplain, Turkey (Thrace and the vicinity of Adapazari B. b. arifiyensis in north-western Anatolia), and the northern slopes of the Caucasus Mountains. It has been introduced to the United Kingdom (one colony in Surrey). It is a lowland species that occurs from sea level up to a maximum of 730m asl (in western Bohemia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

The species inhabits Central and Eastern Europe. The Central European part of the range is divided by the Carpathian Mountains. The glacial refugia of B. bombina are supposed to be in the steppes bordering the Black and Caspian seas. The western margin of the range runs approximately by Germany (Schlezwig-Holstein, Lower Saxony, Sachsen-Anhalt, Dresden and Gorlitz), Czech Republic, Northeast Austria, Eastern Yugoslavia, Greece, Bulgaria, Romania and Western Turkey. The northern margin of the range runs from the area southwest to the Swedish province of Skane through Denmark to the Baltic Sea through Byelorussia and Central European Russia to Preuralia (Bashkiria) and Urals (Chelyabinsk Province). The southern margin of the range seems to be limited with the mountains of Balkan Peninsula; however, it occurs in Western Turkey (Anatolia: Sakarya River). The toad is known from the Northern Crimea. In the south of the European part of the former Soviet Union it occurs mainly in river valleys, including those in Precaucasia and Precaspian region. Then the range extends through the Southern Urals to the Northern Kazakhstan.

The toad inhabits zones of steppe, forest steppe, broad-leaved and mixed forests consisting of different species of trees. In the forest steppe and steppe zones, B. bombina inhabits bushlands, forests and wetlands in floodplains, covered with dense vegetation. It inhabits also open landscapes, using drainage channels as pathways for dispersal. At the southeastern margin of its range, the species lives in permanent freshwater bodies in river valleys surrounded by an arid saline landscape. It is primarily an aquatic animal living in shallow stagnant lakes, ponds, swamps, peatbogs, ditches, flooded rice fields and quarries. Sometimes the toad inhabits semi-flowing waters: springs, irrigation channels, rivers and stream pools. In some areas, however, it seems to live almost entirely in stagnant water bodies. As a rule, the water must be clear. In the Carpathian region, B. bombina lives in wetlands with clearer water than the congeneric B. variegata. However, near the southern margin of the range, in Southeastern Ukraine and Krasnodar Region of Russia, the toad often occurs in chemically polluted waters: settling and sedimentation reservoirs, rice fields, polluted ponds in settlements and cities etc.

  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Basoglu, M. and Ozeti, N. (1973). Turkiye Amphibileri. Ege Univ, Bornova-Izmir.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Krone, A. and Kuhnel, K.-D. (1996). Die Rotbauchunke (Bombina bombina): Okologie und Bestandssituation. Rana. Rangsdorf, Sonderheit.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Within Europe this species is associated with lowland areas of marshy or grassy wetlands, often along river valleys, with small, shallow, often-temporary lakes and ponds. In the former Soviet Union it has been reported from steppe, forest steppe, broad-leaved and mixed leafed coniferous forests, but it also inhabits open landscapes, using drainage channels as pathways for dispersal. At the southeastern margin of its distribution, the species lives in permanent freshwater bodies in river valleys surrounded by an arid saline landscape (solonetz-solonchak complex). It is primarily an aquatic animal living in shallow (less than 50-70cm depth) stagnant lakes, ponds, pools, swamps, peat bogs, ditches, flooded rice fields and quarries. It may occasionally be found in semi-flowing waters: springs, irrigation channels, rivers and stream pools and the water must generally be clear (for example in the Carpathian region, B. bombina lives in wetlands with clearer water than the congeneric Bombina variegata); however, near the southern margin of the range (such as southeastern Ukraine and the Krasnodar Region) the species often occurs in waters that have been polluted with industrial and agricultural chemicals such as settling and sedimentation reservoirs, rice fields, polluted ponds in rural and urban areas. The species breeds by larval development in pools with a good growth of sub-aquatic vegetation. Hybrid populations of this species with B. variegata have been recorded.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20 years (captivity) Observations: In the wild, these animals may live up to 11 years (Smirina 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombina bombina

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP782-09|EU115993|Bombina bombina| ACACGTTGACTTTTTTCGACAAATCACAAAGATATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCCGGAATGGTTGGAACTGCCCTC---AGCTTGTTGATTCGAGCTGAGCTGAGCCAGCCCGGAACCTTGCTTGGGGAT---GACCAGATCTACAATGTAATTGTCACTGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATGCCCATCATGATTGGGGGATTCGGTAACTGACTGATTCCTCTAATA---ATCGGAGCCCCAGACATGGCGTTCCCTCGAATGAATAACATGAGCTTTTGACTTCTTCCCCCATCATTCCTCTTACTCTTAGCATCCTCGGGTGTAGAGGCCGGGGCCGGAACCGGTTGAACTGTTTACCCGCCTTTAGCGGGAAACCTAGCCCATGCAGGAGCATCAGTAGACCTA---ACTATTTTTTCTTTACATCTTGCTGGGGTATCCTCAATCCTGGGCGCTATCAACTTTATTACAACAACAATTAACATGAAACCCCCAGCAATGTCACAGTATCAAACACCATTGTTTGTGTGATCTGTACTAATTACAGCTATTCTTCTACTCCTTTCACTTCCTGTTCTGGCCGCA---GGAATTACTATGCTTCTTACAGACCGTAATTTAAACACAACCTTTTTTGACCCTGCTGGAGGGGGAGATCCTGTACTATACCAACACCTATTCTGATTCTTTGGTCACCCAGAGGTATACATTCTTATTTTACCAGGATTTGGTATAATTTCACATATTGTTACTTACTATTCAGGTAAAAAA---GAGCCATTTGGTTACATAGGCATAGTCTGAGCCATGATGTCTATTGGCCTGCTGGGCTTTATCGTCTGAGCTCACCACATATTCACAGTAGACTTAA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombina bombina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Species: 14
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Aram Agasyan, Aziz Avisi, Boris Tuniyev, Jelka Crnobrnja Isailovic, Petros Lymberakis, Claes Andrén, Dan Cogalniceanu, John Wilkinson, Natalia Ananjeva, Nazan Üzüm, Nikolai Orlov, Richard Podloucky, Sako Tuniyev, Uğur Kaya

Reviewer/s
Cox, N. and Temple, H.J. (Global Amphibian Assessment)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2006
    Least Concern
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species remains fairly abundant over much of its range (for example it is extremely common to the north and west of the Danube floodplain where it has benefited from increased irrigation), although many northern populations have declined (e.g., in Poland and Germany). The populations of this species in both Denmark and Sweden are low. Individual populations of this species can show significant fluctuations in numbers. There are no recent records from Greece, but its range in this country has not been surveyed for many years. The species is common in parts of European Russia, Ukraine and Moldavia, and while it is unlikely to be declining on this territory in general, many local populations are declining.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

In the West Europe this species is significantly declining or extinct in many areas. There it largely depends on conservation of wetland habitats. However, over large areas of the European part of the f. USSR, the Fire-Bellied Toad is a common or numerous amphibian. For example, in Byelorussia its proportion averages 0.4-3.4% of all amphibians. At suitable sites in lowland Ukraine, the toad's abundance reaches 200 individuals per a hectare of pond surface. In central European Russia, the toad's density reaches 20000, and in Precaucasia varies within 0.6-26453 individuals per the same square.

The toads prefer relatively warm conditions: they are active at +10 - +30oC, usually +18 - +20oC. Active individuals are found in the daytime, but the maximum calling by males occurs at dusk, whereas during windy or cold weather toad activity decreases. Fire-Bellied Toads stay in the water or near the shore; terrestrial migrations occur mainly at high air humidity, as a rule at night. Hibernation occurs from the end of September or October (sometimes the beginning of November) to late March or April. The toad hibernates in the mud on the bottom of water bodies or on land. The breeding season extends from May to the end of summer. During this time, male vocalizes floating on the water surface, with body flattened. Sometimes he is able to call from under the water. Amplexus is pelvic. The clutch contains 80-300 eggs, sometimes more, deposited in portions. Embryonic and larval development takes 2-2.5 months. Metamorphosis extends from the second half of June to the end of September. As a rule, it peaks in July-August. Recently metamorphosed toadlets stay in the water and near the shore. Sexual maturity is attained in the 2nd-4th year of life, longevity in nature reaches at least 12 years.

Tadpoles consume mainly algae and higher plants, lower animals frequently are eaten. Newly metamorphosed toadlets prey mainly on insects (Coleoptera, Hymenoptera, Diptera), adults consume mainly various insects. More than half of their diet of adults may consist of aquatic invertebrates, but terrestrial animals are also numerous. Variation in the proportion of aquatic prey in different samples reflects the extent of terrestrialism the toad in different landscapes and seasons. During the breeding season, feeding is not stopped.

When faced with a potential predator, B. bombina exhibits a defensive posture called the unkenreflex. It turns over and curves its bright belly upward, covering the eyes with its palms. Otherwise, it may not turn over but instead curve its body downward, lift up the head, and curve the extremities showing the bright spots on its flanks and on the ventral surface of the extremities. Despite the venomous skin secretions in the Fire-Bellied Toad, many vertebrates regularly consume its adults and juveniles. For example, its proportion in the diet of Nycticorax nycticorax in Ukraine may reach 25%.

  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Basoglu, M. and Ozeti, N. (1973). Turkiye Amphibileri. Ege Univ, Bornova-Izmir.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Krone, A. and Kuhnel, K.-D. (1996). Die Rotbauchunke (Bombina bombina): Okologie und Bestandssituation. Rana. Rangsdorf, Sonderheit.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In western and northern Europe the species is threatened by the loss of habitat through modernisation of agricultural methods, most significantly the drainage and/or pollution of suitable wetland areas. Recent declines in northwestern Europe might also be related to climate change. In Turkey it is threatened by urban development and agricultural development. Within the former Soviet Union destruction of wetlands is also the most serious threat, although industrial pollution and recreational activities also impact populations. Additional localized threats to this species include mortality on roads, entrapment in open wells with vertical walls, hybridization and replacement by Bombina variegata and collection for the pet trade. However, at a global scale this species is not significantly threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Destruction of wetlands is the most serious threat to populations. This led to decline or extinction of this species from many areas of the West and Central Europe. Such phenomena are known from Sweden, Germany, Denmark and many other countries. In the f. USSR such phenomena were recorded locally, mainly in surroundings of cities, near enterprises, in agricultural landscapes where artificial fertilizers were used, etc. In this region the species is numerous or common and not threatened.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Basoglu, M. and Ozeti, N. (1973). Turkiye Amphibileri. Ege Univ, Bornova-Izmir.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Krone, A. and Kuhnel, K.-D. (1996). Die Rotbauchunke (Bombina bombina): Okologie und Bestandssituation. Rana. Rangsdorf, Sonderheit.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of the Bern Convention and on Annexes II and IV of the EU Natural Habitats Directive. It is protected by national legislation in many countries, occurs in many protected areas, and is listed in many national and sub-national Red Data books and lists. This species has been successfully reintroduced to some sites in Sweden (Arnold, 2002), as of 2008 there are 10,000 adults in 3,000 breeding ponds. In other parts of this species range, mitigation measures to reduce road kill have been established.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

As noted above, the destruction and pollution of habitats are main threats for the species populations. The Fire-Bellied Toad is rare in cities. Nevertheless, at the southern margin of the range (Precaucasia) the toad inhabits even polluted wetlands, such as sedimentation reservoirs, rice fields etc. Some kinds of human activity are profitable for the toad: it uses drainage channels as pathways for dispersal.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Basoglu, M. and Ozeti, N. (1973). Turkiye Amphibileri. Ege Univ, Bornova-Izmir.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Krone, A. and Kuhnel, K.-D. (1996). Die Rotbauchunke (Bombina bombina): Okologie und Bestandssituation. Rana. Rangsdorf, Sonderheit.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European Fire-bellied Toad

The European Fire-bellied Toad Bombina bombina is a fire-bellied toad native to mainland Europe.

When they shed their skin, they bloat themselves and make a coughing sound, then start to tear the old skin off with their mouth, and eat it for nutrition, to reveal newer, brighter skin.

Fire-Bellied toads have a bright lime green dorsal traversed by black spots, and orange to bright red bellies with black bars and stripes. The skin is mildly bumpy, the eyes set high to suit a semi-aquatic life style, and also well webbed back feet. Color and body variations will be described for each of the other 3 species commonly sold as or mistaken for Oriental Fire-Bellied Toads. They are the largest of the bombina family.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!