Overview

Comprehensive Description

Description

The following is a general description of specimens assigned to M. femoralis. M 31-37 mm, F 45-55 mm in the types. Tibiotarsal articulation reaching between eye and nostril. Terminal discs of fingers and toes moderately enlarged. Dorsal skin granular. Populations that we preferably assign to M. femoralis are characterized by a rather distinct and large yellow patch in the inguinal region, with the yellow colour sometimes also extending onto the ventral side which otherwise is often rather dark-coloured (Glaw and Vences 2007).

Taken with permission from Glaw and Vences (2007) and Nussbam et. al (2008).

  • Nussbaum, R., Raxworthy, C. and Vallan, D. (2008). Mantidactylus femoralis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed at numerous localities in northern and eastern Madagascar, and also occurs at Isalo in western Madagascar. The distribution map is not very meaningful since this is an unresolved complex. It ranges from sea level to 2,500m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

This species is widely distributed at numerous localities in northern and eastern Madagascar, and also occurs at Isalo in western Madagascar. It ranges from sea level to 2500 m asl (Nussbaum et al. 2008).

  • Nussbaum, R., Raxworthy, C. and Vallan, D. (2008). Mantidactylus femoralis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is usually closely associated with streams in primary and degraded rainforest. It needs some tree cover at lower altitudes. It is also found in montane heathland, but not in agricultural areas. It lives on the ground, on rocks, and in low vegetation. It breeds in streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mantidactylus femoralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGAGCCCTTCTCGGCGAC---GACCAGATTTATAATGTTGTTGTAACCGCCCATGCATTTGTCATAATTTTCTTTATAGTCATGCCCATCCTAATCGGAGGATTCGGAAATTGACTTGTCCCATTAATAATTGGGGCCCCGGATATAGCCTTCCCTCGAATAAACAATATAAGCTTCTGACTCCTCCCACCATCCTTTTTTCTTCTCCTCGCCTCATCTATAGTGGAAGCTGGGGCCGGAACCGGCTGAACAGTATACCCCCCCCTAGCCAGCAATCTAGCTCACGCAGGCCCATCAGTAGACCTTACTATCTTTTCTCTCCACCTCGCAGGCGTGTCCTCAATTCTCGGAGCCATTAACTTTATTACAACTATTTTAAATATAAAACCACCGTCAATAACTCAGTACCAAACCCCCTTATTTGTTTGATCCGTCCTAATTACAGCGGTTCTCCTTCTTCTTTCGCTCCCAGTATTAGCTGCGGGTATTACTATACTTCTCACAGAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mantidactylus femoralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Nussbaum, R., Raxworthy, C.J. & Vallan, D.

Reviewer/s
Stuart, S.N., Chanson, J.S. & Cox, N.A.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a very common species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habits: Typically found along streams in rainforest, usually relatively near to the stream banks and not far from the water, although they usually are not found in the water (Glaw and Vences 2007).

Calls: Not reliably known (Glaw and Vences 2007).

  • Nussbaum, R., Raxworthy, C. and Vallan, D. (2008). Mantidactylus femoralis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is probably not threatened, except perhaps by extreme deforestation. However, some of the constituent species in the unresolved complex are possibly threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species is listed as least concern because its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category. It occurs in many protected areas and is probably not threatened, except perhaps by extreme deforestation. However, some of the constituent species in the unresolved complex are possibly threatened (Nussbaum et al. 2008).

  • Nussbaum, R., Raxworthy, C. and Vallan, D. (2008). Mantidactylus femoralis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in numerous protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mantidactylus femoralis

Mantidactylus femoralis is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, subtropical or tropical high-altitude shrubland, rivers, and heavily degraded former forest. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!