Overview

Brief Summary

Biology

Tomato frogs breed in February to March following heavy rainfall; the sounds of males calling to attract females can be heard around small water bodies in the dark Malagasy night (2). Following copulation, females will lay a clutch of 1,000 to 15,000 eggs on the surface of the water (2). Tadpoles hatch from these small black and white eggs about 36 hours later (2); they are only around six millimetres long and feed by filter-feeding (5). Tadpoles undergo metamorphosis into yellow juveniles and this stage is completed around 45 days after the eggs were laid (2). Ambushing potential prey, adult tomato frogs feed on small invertebrates (5). When threatened, these frogs can inflate themselves, giving the appearance of greater size (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Tomato frogs live up to their name by possessing a vibrant, orange-red colour (2). Females are much larger than males and have brighter tones of red or orange on their back, with a pale undersurface (4); some individuals also have black spots on the throat (2). It is thought that the brilliant colours act as a warning to potential predators that these frogs are toxic (5); a white substance secreted from the skin acts as a glue to deter predators (such as colubrid snakes) and can produce an allergic reaction in humans (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

A large conspicuously coloured frog. M 60-65 mm, F 85-105 mm. Morphology as D. guineti. Colour uniformly yellow-orange in males, orange-red in females, sometimes with dark colour below dorsolateral folds (Glaw and Vences 2007).

Similar species: Very similar and possibly conspecific to D. guineti which differs by colour pattern (Glaw and Vences 2007).

Taken with permission from Glaw and Vences (2007).

Featured in Amazing Amphibians on 7 October 2013

  • Raxworthy, C., Vences, M., Andreone, F., and Nussbaum, R. (2008). Dyscophus antongilii. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in north-eastern Madagascar, where it has a relatively wide, but poorly understood, distribution. Specific records come from Andivoranto (a historical record), around Antongila Bay, Fizoana, Iaraka, Maroantsetra, Rantabe and Voloina (Glaw and Vences 2007). Other reported localities for this species, especially the southernmost ones, might in fact refer to Dyscophus guineti. It occurs from sea level up to 600m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Located at Andevoranto, Antongil bay, Fizoana, Iaraka, Maroantsetra, Rantabe, Voloina (Glaw and Vences 2007) from sea level up to 600 m asl (Raxworthy et al. 2008).

  • Raxworthy, C., Vences, M., Andreone, F., and Nussbaum, R. (2008). Dyscophus antongilii. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Endemic to Madagascar, tomato frogs are found in the northeast of the island around Antongil Bay (from which they gain their specific name, antongilii) (5), and south to Andevoranto (4). The exact distribution of this species is unclear however, due to confusion with the closely related D. guineti (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives in primary rainforest, coastal forest, secondary vegetation, degraded scrub, and highly disturbed urban areas. It is a very adaptable species, but possible declines in Maroansetra indicate that there might be a limit to the extent that it can persist in urbanized habitats. It appears to be localized to sandy ground near the coast, and breeds in ditches, flooded areas, swamps, and temporary and permanent still or very slowly flowing water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding occurs in shallow pools, swamps and areas of slow-moving water. These frogs are found from sea level to elevations of around 200 metres (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dyscophus antongilii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GAC---GACCAAATTTACAACGTCATCGTCACTGCTCACGCCTTTGTAATAATCTTTTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAATTGACTAGTCCCACTAATAATTGGGGCCCCCGACATAGCATTTCCCCGAATAAACAATATAAGCTTTTGGCTTCTCCCCCCCTCTTTCCTCCTTCTTCTTGCCTCCTCTGCAGTAGAAGCCGGTGCAGGCACAGGTTGAACAGTTTATCCCCCTTTAGCCGGAAATCTTGCCCATGCAGGACCATCCGTTGATTTAACAATCTTCTCTTTGCACCTAGCAGGGGTTTCCTCTATTCTTGGNGCAATTAATTTCATCACAACCATTATTAATATAAAACCCCCATCAGGAACTCAATATCAAACCCCCTTATTTGNGNGATCCGTTCTTATTACAGCAGTACTACTTCTGCTTTCACTCCCTGTTCTTGCAGCTGGTATTACAATACTCCTTACTGACCGAAATCTTAATACCACCTTTTTCGATCCCGCAGGTGGAGGAGACCCGGTCTTATATCAACATCTTTTCTGATTCTTTGGCCACCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dyscophus antongilii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Christopher Raxworthy, Miguel Vences, Franco Andreone, Ronald Nussbaum

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Near Threatened because its Extent of Occurrence is probably less than 20,000 km2, but the species is adaptable and survives well in disturbed habitats.

History
  • 2002
    Near Threatened
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is locally abundant, especially in and around Maroansetra (the best known locality for this species). However, surveys undertaken around Maroansetra in 2006 suggest that the population here seems to be declining (Andreone et al. 2006). In Ambatovaky its population is stable and abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habits: This species is very common in the Antongil bay area, especially in the town of Maroantsetra where it inhabits most gardens and breeds in ponds and ditches. Here, locals are familiar with this frog and can quickly find them when required as tourist attraction. These frogs have very sticky skin secretions which can produce local swellings in humans. Specimens breed regularly after rainfalls (no particular explosive breeding behaviour) and can be observed all-year round after rains. 1000-1500 small black eggs are laid and hatch 36 hours later (Glaw and Vences 2007).

Calls: A series of short low-pitched notes which is repeated after some intervals. The Malagasy name for this frog "Sangongon" is based on these sounds (Glaw and Vences 2007).

  • Raxworthy, C., Vences, M., Andreone, F., and Nussbaum, R. (2008). Dyscophus antongilii. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Pollution of waterbodies is a potential threat, and in the past this species was subject to collection for international trade, although this is now largely under control and restricted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species has been listed as near threatened since 2002 because its extent of occurrence is probably less than 20,000 km2, but the species is adaptable and survives well in disturbed habitats (Raxworthy et al. 2008). Pollution of waterbodies is a potential threat, and in the past this species was subject to collection for international trade, although this is now largely under control and restricted (Raxworthy et al. 2008).

Conservation actions: It occurs in the Réserve Spéciale d’Ambatovaky and probably in Parc National de Masoala. This species is sometimes bred for commercial purposes outside Madagascar, and many specimens exchanged in the pet trade are captive bred. Captive breeding programmes and the CITES Appendix I status of this species have effectively halted commercial exploitation of it in Madagascar (if indeed this was ever a major threat), and any future trade in it needs to be well regulated. There is a well-managed captive breeding programme involving many US zoos, and it is now also kept in a zoo in Madagascar. Further taxonomic work is required to resolve confusion between this species and D. guineti (Raxworthy et al. 2008).

  • Raxworthy, C., Vences, M., Andreone, F., and Nussbaum, R. (2008). Dyscophus antongilii. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Numbers of the tomato frog have been declining as a result of habitat degradation and pollution and the over-collection of these brightly coloured amphibians for the pet trade (4). Collecting activity, and the associated decline in population, was predominately focused near to the town of Maroantsetra (6). The tomato frog was rapidly included on Appendix I of the Convention on International Trade in Endangered Species (CITES) in response to this pressure (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs at the boundary of the Réserve Spéciale d’Ambatovaky (but yet confirmed to be within this protected areas [Andreone et al. 2006]) and probably in Parc National de Masoala (the locality of Maroantsetra is located here [Andreone et al. 2006]). Andreone et al. (2006) recommend that some known "urban" populations (such as the population within Maroantsetra) should be managed and protected. Additionally survey work is needed over much of the species range. This species is sometimes bred for commercial purposes outside Madagascar, and many specimens exchanged in the pet trade are captive bred. Captive breeding programmes and the CITES Appendix I status of this species have effectively halted commercial exploitation of it in Madagascar (if indeed this was ever a major threat), and any future trade in it needs to be well regulated. There is a well-managed captive breeding programme involving many US zoos, and it is now also kept in a zoo in Madagascar. Further taxonomic work is required to resolve confusion between this species and D. guineti.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Research into captive breeding techniques has been carried out by Baltimore Zoo in the United States in an effort to boost the currently small and genetically deprived captive population that exists in that country (4). A consortium of U.S. zoos that form the Madagascar Fauna Group (MFG) (8) have established an exhibit at the Parc Zoologique Ivoloina, Madagascar in an attempt to help educate local people about this attractive member of their natural heritage (4). Very little is known about the tomato frog and further research into its distribution, behaviour and potential threats is urgently needed before effective conservation measures can be put into place (6). It is currently listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), but this move has been criticised by some authors as an ineffective strategy and one that has undermined the status of the unlisted D. guineti (9). Furthermore, research is needed to determine if D. antongilii is in fact a separate species or merely a variant of D. guineti (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dyscophus antongilii

The Madagascar tomato frog or crapaud rouge de Madagascar (Dyscophus antongilii) is a species of frog in the family Microhylidae.

Description[edit]

Females are much larger than males, reaching up to 10.5 cm and 230 g in weight (6.5 cm and 41 g for males).[1] Tomato frogs live up to their name by possessing a vibrant, orange-red colour.[2] Females are much larger than males and have brighter tones of red or orange on their back, with a pale undersurface.[3] Some individuals also have black spots on the throat.[2] It is thought that the brilliant colours of the tomato frog act as a warning to potential predators that these frogs are toxic;[4] a white substance secreted from the skin acts as a glue to deter predators (such as colubrid snakes) and can produce an allergic reaction in humans.[2][3]

Habitat and distribution[edit]

Endemic to Madagascar, tomato frogs are found in the northeast of the island around Antongil Bay (from which they gain their specific name, antongilii),[4] and south to Andevoranto.[3] The exact distribution of this species is unclear however, due to confusion with the closely related D. guineti.[5]

The tomato frog breeds in shallow pools, swamps and areas of slow-moving water. These frogs are found from sea level to elevations of around 200 metres.[3] Its natural habitats are subtropical or tropical moist lowland forests, rivers, swamps, freshwater marshes, intermittent freshwater marshes, arable land, plantations, rural gardens, urban areas, heavily degraded former forest, ponds, and canals and ditches.[citation needed]

Life cycle and ecology[edit]

Tomato Frog at Dählhölzli Animal Park

Tomato frogs breed in February to March following heavy rainfall; the sounds of males calling to attract females can be heard around small water bodies in the dark Malagasy night.[2] Following copulation, females will lay a clutch of 1,000 to 15,000 eggs on the surface of the water.[2] Tadpoles hatch from these small black and white eggs about 36 hours later;[2] they are only around six millimetres long and feed by filter-feeding.[4] Tadpoles undergo metamorphosis into yellow juveniles and this stage is completed around 45 days after the eggs were laid.[2]

Ambushing potential prey, adult tomato frogs feed on small invertebrates,[4] such as beetles, mosquitoes, and flies. When threatened, these frogs can inflate themselves, giving the appearance of greater size.[6]

Threats and conservation[edit]

The tomato frog is classified as Near Threatened (NT) on the IUCN Red List,[7] and listed on Appendix I of CITES.[8] Numbers of the tomato frog have been declining as a result of habitat degradation and pollution and the over-collection of these brightly coloured amphibians for the pet trade.[3] Collecting activity, and the associated decline in population, was predominately focused near to the town of Maroantsetra.[5] The tomato frog was rapidly included on Appendix I of the Convention on International Trade in Endangered Species (CITES) in response to this pressure.[5]

Research into captive breeding techniques for the tomato frog has been carried out by Baltimore Zoo in the United States in an effort to boost the currently small and genetically deprived captive population that exists in that country.[3] A consortium of U.S. zoos that form the Madagascar Fauna Group (MFG) have established an exhibit at the Parc Zoologique Ivoloina, Madagascar in an attempt to help educate local people about this attractive member of their natural heritage.[3] Very little is known about the tomato frog and further research into its distribution, behaviour and potential threats is urgently needed before effective conservation measures can be put into place.[5] It is currently listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), but this move has been criticised by some authors as an ineffective strategy and one that has undermined the status of the unlisted D. guineti.[9] Furthermore, research is needed to determine if D. antongilii is in fact a separate species or merely a variant of D. guineti.[5]

References[edit]

  1. ^ http://www.arkive.org/tomato-frog/dyscophus-antongilii/
  2. ^ a b c d e f g "Dyscophus antongilii". AmphibiaWeb. 
  3. ^ a b c d e f g A. Wisnieski, V. Poole, and E. Anderson. "Conservation spotlight: Tomato Frogs". University of Michigan. [unreliable source?]
  4. ^ a b c d "Tomato Frog". Woodland Park Zoo. 
  5. ^ a b c d e Arkive profile.
  6. ^ Glaw, F. and Vences, M. (1992) A Field Guide to the Amphibians and Reptiles of Madagascar. M. Vences, Cologne.
  7. ^ Dyscophus antongilii 2006 IUCN Red List of Threatened Species. Downloaded on 14 January 2011.
  8. ^ CITES Appendices
  9. ^ Andreone, F. and Luiselli, L.M. (2003) Conservation priorities and potential threats influencing the hyper-diverse amphibians of Madagascar. Italian Journal of Zoology, 70: 53-63.

This article incorporates text from the ARKive fact-file "Dyscophus antongilii" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!