Overview

Comprehensive Description

Description

Batrachuperus yenyuanensis total length ranges from 163-211 mm in males, 135-175 mm in females. Head is flat, longer than wide. Snout rounded and covered with thick labial folds. Vomerine teeth short, with 3-6 on each side, large gap in between the two rows of teeth. There is a groove running from the eye to the noticeable jugular fold. Adult has no or trace remnant of gills. Body is slender, dorsum and venter are relatively flat, and the skin is smooth. 11-12 costal grooves are present. Tips of forelimb and hindlimb toes overlap at the tip or are separated by 1 costal groove length when limbs are adpressed to the flank. There are four unwebbed toes on each forelimb and four unwebbed toes on each hindlimb. The tail is longer than SVL, with a thin, tall fold.

Batrachuperus yenyuanensis has either a dark brown, dirty yellow, or bluish-gray colored dorsum, overlaid with irregular, dark cloud-like patterns. The pattern fades going from the flanks towards the venter. The venter is grayish yellow.

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from south-western Sichuan Province (Yanyuan, Xichang, Mianning, and Puxiong counties) in China, from 2,900-4,400m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

This species is endemic to China, in the province of Sichuan. It is found in montane rivers and creeks at elevations from 2900 - 4400 m above sea level. Most Batrachuperus yenyuanensis spend their time near water and hiding under cover of river rocks, with a few choosing to shelter in dirt tunnels on the bank.

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Limited range in southwestern Sichuan (Yanyuan, Xichang, Mianning, Yuexi, Jiulong). Its distribution is nested within that of Batrachuperus pinchonii (Fu & Zeng, 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Batrachuperus yenyuanensis is a slender salamander, body dorso-ventrally depressed, with eleven to twelve costal grooves. Head greatly depressed; snout rounded; labial folds strongly developed; skin on throat very loose, with many longitudinal folds. Two short, slightly curved patches of vomerine teeth. Limbs well developed; longest digits meet when adpressed. Tips of fingers and toes covered with dark thickened horny epidermis; two darker cornified tubercles on palm and sole are very distinct. Digits much more flattened and pointed than in any other species of Batrachuperus. They exhibit abnormalities in number, shape and size. Tail longer than body, cylindrical at the base, flattened toward the tip; tail fin thin and high (Liu, 1950). The male has a transverse crescentic vent, with a light-colored papilla in the middle of the anterior edge. In the female the vent is a longitudinal slit with swollen lips. Color dark brown above, indistinctly stippled with black, light gray below, distinctly stippled with black (Liu, 1950). Fei & Ye (2001) specify: back either dark brown, dirty yellow, or bluish-gray, overlaid with irregular, dark cloud-like patterns; venter grayish yellow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

All measurements are from Fei et al. (2006).

Male (10 specimens). Total length: 163–211 mm; snout-vent length: 75.6–91.5 mm; Head length: 17.8–23 mm; Head width: 14–16.7 mm; forelimb length: 23–26.9 mm; hind-limb length: 24–28.4 mm; tail length: 89–120 mm.

Female (10 specimens). Total length: 135–175 mm; snout-vent length: 68.2–82.2 mm; Head length: 16.2–19 mm; Head width: 11.6–13.5 mm; forelimb length: 20.5–24 mm; hind-limb length: 21.8–27.4 mm; tail length: 67–95 mm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Batrachuperus yenyuanensis usually has two distinct small tubercles on each palm and sole and only shares this character with B. pinchonii, but differs from that species by having a longer and less muscular tail and a prominent tail fin fold starting from tail base (Liu, 1950; Fei et al., 2006). However, Fu & Zeng (2008) suggest that the long tail and high tail fins of B. yenyuanensis are possibly variable, habitat-specific characters and may form a local adaptation to a lentic environment.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Batrachuperus yenyuanensis
Catalog Number: USNM 124584
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Yen-Yuan, Sikang, China, Asia
  • Paratype: Liu, C. 1950. Fieldiana: Zoology Memoirs. 2: 99.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Batrachuperus yenyuanensis
Catalog Number: USNM 124583
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Yen-Yuan, Sikang, China, Asia
  • Paratype: Liu, C. 1950. Fieldiana: Zoology Memoirs. 2: 99.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives and breeds in streams and lakes surrounded by dense vegetation.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This salamander is abundant in mountains around Yanyuan county. They live in streams at elevations of 2,900–4,400 m, but mostly at 3,200–3,500 m. Streams are 1–2 m wide and less than 1/3 m deep. Coniferous forest covers the streams. Stream substrates include rocks, sand, twigs, leaves and algae (Liu, 1973). Adults like to hide under rocks or leaves underwater but can also be found in crevices along the bank, where they hibernate. They feed on aquatic insects. Batrachuperus yenyuanensis is mostly nocturnal (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Females lay eggs in late March. Embryos are embedded in two egg sacs, which are attached to the underside of rocks in water. Many egg sacs are found until late April at water temperatures of 4–10 °C. Hatchlings are found in late May and June (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Phylogenies derived from mitochondrial data suggest that Batrachuperus yenyuanensis could be the most basal or second-most basal species in this genus (Zhang et al., 2006; Fu & Zeng, 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Karyotype:

2n=68, 1M, 2M, 3ST, 4SM, 5ST, 6ST, 7ST, 8ST, 9ST, 10ST, 11ST, m (12–34), from Yang (1992).

M: metacentric; SM: submetacentric; T: telocentric; ST: subtelocentric; m: micro-chromosome

The mitochondrial genome has been sequenced by Zhang et al. (2006). Allozyme data have been collected by Fu & Zeng (2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Batrachuperus yenyuanensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATAATCACTCGATGACTATTTTCAACTAATCATAAAGACATTGGCACTCTATACCTAGTATTTGGCGCTTGGGCCGGAATAGTGGGCACTGCCTTAAGCCTTTTAATTCGGGCTGAGTTAAGCCAGCCTGGAACACTTCTTGGAGATGATCAAATTTATAATGTAATTGTAACGGCCCATGCATTTGTAATAATTTTCTTTATAGTAATACCTGTAATAATTGGCGGGTTTGGAAATTGACTAGTACCATTAATAATTGGGGCCCCGGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTCTCCCCCCTTCATTCTTACTACTTCTAGCATCATCCGGGGTTGAAGCAGGGGCAGGAACAGGTTGGACCGTGTACCCTCCATTAGCCAGCAACCTTGCACATGCCGGAGCTTCAGTTGATTTAACAATTTTTTCACTTCACCTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACCACTTCTATTAATATAAAACCTCCATCTATAACACAATACCAAACACCTCTCTTTGTATGATCTGTATTGATTACTGCTATTCTCCTTTTACTCTCATTACCAGTTCTTGCTGCAGGAATTACAATGCTTTTAACAGATCGAAACTTAAATACAACATTTTTTGATCCGGCTGGTGGAGGGGATCCTGTTCTTTACCAACATTTATTCTGGTTCTTTGGTCACCCGGAGGTCTATATTCTTATTCTTCCAGGATTTGGAATAATTTCTCACATTGTTACATATTATTCAGCAAAAAAAGAGCCTTTTGGGTATATAGGAATAGTATGAGCTATAATATCAATTGGATTACTAGGATTTATCGTTTGGGCTCATCATATATTTACAGTAGATTTAAATGTAGATACTCGAGCTTACTTCACATCCGCCACAATAATTATTGCTATCCCAACCGGGGTAAAAGTATTTAGCTGGCTGGCAACAATGCATGGCGGGTCTATTAAATGAGATGCTGCAATACTATGGGCTCTTGGGTTTATTTTTTTATTTACTGTTGGCGGATTAACTGGCATTATTCTTGCTAATTCATCACTAGATATTGTTTTACATGATACTTATTATGTAGTAGCACATTTTCACTACGTATTGTCTATAGGAGCTGTATTTGCCATTATGGGCGGGTTTGTTCACTGATTCCCATTATTTTCAGGTTATACTTTACACCACACCTGATCAAAAATCCACTTTGGTGTAATATTTATTGGAGTTAATCTAACCTTTTTCCCTCAACATTTTTTAGGCCTAGCGGGTATACCACGACGCTATTCTGATTACCCAGACGCTTATACATTATGAAATTCGGTTTCATCCATCGGATCATTAATTTCTCTTGTTGCAGTAATTATAATAATATTTATCATTTGAGAAGCATTTTCATCAAAACGTGAAGTATTAACAACTGAATTAAACTCCACAAATATTGAATGACTTCACGGATGCCCTCCACCATATCACACATTTGAAGAACCTTCATATGTTCAAGCTCGAATTTATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Batrachuperus yenyuanensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(iii,v)+2ab(iii,v)

Version
3.1

Year Assessed
2004

Assessor/s
Wu Guanfu, Fei Liang

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Vulnerable, in view of its extent of occurrence of less than 20,000 km2 and area of occupancy of less than 2,000 km2, with all individuals in fewer than ten locations, and a continuing decline in the extent and quality of its habitat, and in the number of mature individuals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Listed as vulnerable in the IUCN Red List of Threatened Species (IUCN, 2010). The major threat is harvesting for traditional Chinese medicine; it is supposed to cure rheumatoid arthritis and promote stamina. The product of the salamander is also applied to livestock (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is uncommon and the population is believed to be small.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

During the cold weather of October to February, adult salamanders sometimes hibernate under the same rock. Oviposition begins at the end of March. The female lays a pair of egg sacs, one end attached onto the underside of river rocks, with 6-13 eggs in each egg sac, 12-25 eggs in total. Egg sacs are slightly curled and range from 70-125 mm in length and 8-15 mm in diameter. Eggs are white in coloration.

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Over-collecting for traditional Chinese medicine and food is a major threat to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

A major threat is the local collection for food and medicine. This species has a low reproductive rate and needs to be better protected.

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Part of the species' range is within Luojishan Nature Reserve. There is a need to implement measures to ensure that the offtake of this species from the wild is managed sustainably.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yenyuan stream salamander

The Yenyuan stream salamander (Batrachuperus yenyuanensis) is a species of salamander in the Hynobiidae family endemic to China. Its natural habitats are rivers, freshwater lakes, and freshwater marshes. It is threatened by habitat loss.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!