Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Comprehensive Description

Description

Medium-sized, smooth-skinned salamander with 12-13 costal grooves and a distinctive constriction at the base of the swollen tail. Adults range from 45-80 mm snout-vent length to 145 mm total length. Color varies widely and is the basis for subspecies recognition. E. e. oregonensis (Oregon Ensatina) is brown to nearly black above with white to pale yellow below; E. e. eschscholtzii (Monterey Ensatina) is reddish brown above, whitish below; E. e. xanthoptica (Yellow-eyed Ensatina) is orange-brown above, orange below; E. e. picta (Painted Ensatina) is brown above with fine black, yellow, and/or orange blotching, and mottled black and yellow tail; E. e. platensis (Sierra Nevada Ensatina) is gray to brown above, with prominent orange blotching; E. e. croceator (Yellow-blotched Ensatina) is blackish above, with prominent large green-yellow, yellow, or cream blotches; and E. e. klauberi (Large-blotched Ensatina) is blackish above with large orange or pale salmon blotches (all descriptions from Stebbins 1985).

The Ensatina complex has long been studied as a textbook case of speciation (Futuyma 1998). The complex exhibits a ring-like distribution around the inhospitable Central Valley of California, with intergradation at the north end of the Valley but sympatry at the southern meeting of Sierran and coastal subspecies (Stebbins 1949). This pattern has inspired numerous studies of genetic diversity within the complex (Wake and Yanev 1986; reviewed in Wake 2006).

See other accounts for subspecies at www.californiaherps.com: E. e. croceater, E. e. eschscholtzii, E. e. klauberi, E. e. oregonensis, E. e. picta, E. e. platensis, and E. e. xanthoptica.

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Corn, P. S. and Bury, R. B. (1991). ''Terrestrial amphibian communities in the Oregon Coast Range.'' Wildlife and Vegetation of Unmanaged Douglas-fir Forests. L. F. Ruggiero, K. B. Aubry, A. B. Carey, and M. H. Huff, eds., USDA Forest Service General Technical Report PNW-GTR-285, 304-317.
  • Stebbins, R. C. (1954). "Natural history of the salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 54(2), 47-124.
  • Storer, T. I. (1925). "A synopsis of the amphibia of California." University of California Publications in Zoology, 27, 1-342.
  • Arnold, S. J. (1982). ''A quantitative approach to antipredator performance: salamander defense against snake attack.'' Copeia, 1982, 247-253.
  • Fontana, M. F., Ask, K. A., Macdonald, R. J., Carnes, A. M., and Staub, N. L. (2005). ''Loss of traditional mucus glands and presence of a novel mucus-producing granular gland in the plethodontid salamander Ensatina eschscholtzii.'' Biological Journal of the Linnean Society, 87(3), 469-477.
  • Gneadinger, L. M., and Reed, C. A. (1948). ''Contribution to the natural history of the plethodontid salamander Ensatina eschscholtzii.'' Copeia, 1948, 187-196.
  • Kuchta, S. R. (2005). ''Experimental support for aposematic coloration in the salamander Ensatina eschscholtzii xanthoptica: implications for mimicry of Pacific newts.'' Copeia, 2005(2), 265-271.
  • Kuchta, S. R., Krakauer, A. H., and Sinervo, B. (2008). ''Why does the Yellow-eyed Ensatina have yellow eyes? Batesian mimicry of Pacific Newts (genus Taricha) by the salamander Ensatina eschscholtzii xanthoptica.'' Evolution, 62(4), 984-990.
  • Olson, D. H., Naumann, R. S., Ellenburg, L. L., Hansen, B. P., and Chan, S. S. (2006). ''Ensatina eschscholtzii nests at a managed forest site in Oregon.'' Northwestern Naturalist, 87, 203-208.
  • Rundio, D. E., and Olson, D. H. (2007). ''Influence of headwater site conditions and riparian buffers on terrestrial salamander response to forest thinning.'' Forest Science, 53(2), 320-330.
  • Staub, N. L., Brown, C. W., and Wake, D. B. (1995). ''Patterns of growth and movements in a population of Ensatina eschscholtzii platensis (Caudata: Plethodontidae) in the Sierra Nevada, California.'' Journal of Herpetology, 29, 593-599.
  • Stebbins, R. C. (1949). "Speciation in salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 48, 377-526.
  • Wake, D. B. (2006). ''Problems with species: patterns and processes of species formation in salamanders.'' Annals of the Missouri Botanical Gardens, 93, 8-23.
  • Wake, D. B. and Yanev, K. P. (1986). ''Geographic variation in allozymes in a 'ring species,' the plethodontid salamander Ensatina eschscholtzii of western North America.'' Evolution, 40(4), 702-715.
  • Welsh, H. H., Jr., Fellers, G. M., and Lind, A. J. (2007). ''Amphibian populations in the terrestrial environment: is there evidence of declines of terrestrial forest amphibians in northwestern California?'' Journal of Herpetology, 41(3), 469-482.
  • Wiltenmuth, E. B. and Nishikawa, K. C. (1998). ''Geographical variation in agonistic behaviour in a ring species of salamander, Ensatina eschscholtzii.'' Animal Behavior, 55, 1595-1606.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Southwestern British Columbia south along Coast Ranges to extreme northwestern Baja California and the Sierra San Pedro Martir, Baja California (Mahrdt et al. 1998); and along western slopes of Cascade Range and Sierra Nevada. Recently recorded east of the Cascade crest in Washington (Darda et al. 2001). Absent from Sacramento-San Joaquin valley, California. Occurs from sea level to elevations of about 8,000 ft (Stebbins 1985). See Moritz et al. (1992) for a general but up-to-date distribution map.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species ranges from southwestern British Columbia in Canada, south through the Coastal Ranges of the USA to extreme northwestern Baja California and the Sierra San Pedro Martir, Baja California in Mexico (Mahrdt et al. 1998); and along the western slopes of Cascade Range and Sierra Nevada in California in the USA. It is absent from Sacramento-San Joaquin valley, California. It occurs as a large number of separate subspecies. The subspecies E. e. klauberi occurs in the Sierra San Pedro Martir, Baja California, Mexico, above 2,000m asl. It occurs from sea level up to elevations of about 2,350m asl (Stebbins 1985). See Moritz et al. (1992) for a general but up-to-date distribution map.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Pacific coast of North America, from extreme SW British Columbia, Canada to northern Baja California, Mexico. Includes Washington, Oregon, and California in the United States. Typical habitat includes coniferous forest, deciduous forest, oak woodland, coastal sage scrub, and chaparral (Stebbins 1954) in thermally buffered mesic microclimates, such as under logs, bark, moss, leaf litter, and talus (Corn and Bury 1991), or in animal burrows (Storer 1925). Notable ring-like distribution of subspecies around the Central Valley of California (Stebbins 1949).

Subspecies ranges are as follows (Stebbins 1985):

E. e. oregonensis, Coast Range and Cascade Mountains from SW British Columbia to San Francisco Bay;
E. e. eschscholtzii, Coast Range Mountains from San Francisco Bay to NW Baja California; occurs in woodlands in the northern part of the range, but in more open habitats including coastal sage scrub and chaparral in central and southern California;
E. e. xanthoptica, coastal hills east of San Francisco Bay and foothills of central Sierra;
E. e. picta, Coast Range Mountains near Oregon/California border;
E. e. platensis, Sierra of California, from north end of Central Valley to Transverse Ranges;
E. e. croceator, Transverse Ranges at south end of Sierra;
E. e. klauberi, Peninsular Ranges in Southern California.

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Corn, P. S. and Bury, R. B. (1991). ''Terrestrial amphibian communities in the Oregon Coast Range.'' Wildlife and Vegetation of Unmanaged Douglas-fir Forests. L. F. Ruggiero, K. B. Aubry, A. B. Carey, and M. H. Huff, eds., USDA Forest Service General Technical Report PNW-GTR-285, 304-317.
  • Stebbins, R. C. (1954). "Natural history of the salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 54(2), 47-124.
  • Storer, T. I. (1925). "A synopsis of the amphibia of California." University of California Publications in Zoology, 27, 1-342.
  • Arnold, S. J. (1982). ''A quantitative approach to antipredator performance: salamander defense against snake attack.'' Copeia, 1982, 247-253.
  • Fontana, M. F., Ask, K. A., Macdonald, R. J., Carnes, A. M., and Staub, N. L. (2005). ''Loss of traditional mucus glands and presence of a novel mucus-producing granular gland in the plethodontid salamander Ensatina eschscholtzii.'' Biological Journal of the Linnean Society, 87(3), 469-477.
  • Gneadinger, L. M., and Reed, C. A. (1948). ''Contribution to the natural history of the plethodontid salamander Ensatina eschscholtzii.'' Copeia, 1948, 187-196.
  • Kuchta, S. R. (2005). ''Experimental support for aposematic coloration in the salamander Ensatina eschscholtzii xanthoptica: implications for mimicry of Pacific newts.'' Copeia, 2005(2), 265-271.
  • Kuchta, S. R., Krakauer, A. H., and Sinervo, B. (2008). ''Why does the Yellow-eyed Ensatina have yellow eyes? Batesian mimicry of Pacific Newts (genus Taricha) by the salamander Ensatina eschscholtzii xanthoptica.'' Evolution, 62(4), 984-990.
  • Olson, D. H., Naumann, R. S., Ellenburg, L. L., Hansen, B. P., and Chan, S. S. (2006). ''Ensatina eschscholtzii nests at a managed forest site in Oregon.'' Northwestern Naturalist, 87, 203-208.
  • Rundio, D. E., and Olson, D. H. (2007). ''Influence of headwater site conditions and riparian buffers on terrestrial salamander response to forest thinning.'' Forest Science, 53(2), 320-330.
  • Staub, N. L., Brown, C. W., and Wake, D. B. (1995). ''Patterns of growth and movements in a population of Ensatina eschscholtzii platensis (Caudata: Plethodontidae) in the Sierra Nevada, California.'' Journal of Herpetology, 29, 593-599.
  • Stebbins, R. C. (1949). "Speciation in salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 48, 377-526.
  • Wake, D. B. (2006). ''Problems with species: patterns and processes of species formation in salamanders.'' Annals of the Missouri Botanical Gardens, 93, 8-23.
  • Wake, D. B. and Yanev, K. P. (1986). ''Geographic variation in allozymes in a 'ring species,' the plethodontid salamander Ensatina eschscholtzii of western North America.'' Evolution, 40(4), 702-715.
  • Welsh, H. H., Jr., Fellers, G. M., and Lind, A. J. (2007). ''Amphibian populations in the terrestrial environment: is there evidence of declines of terrestrial forest amphibians in northwestern California?'' Journal of Herpetology, 41(3), 469-482.
  • Wiltenmuth, E. B. and Nishikawa, K. C. (1998). ''Geographical variation in agonistic behaviour in a ring species of salamander, Ensatina eschscholtzii.'' Animal Behavior, 55, 1595-1606.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

California Montane Chaparral and Woodlands Habitat

This taxon can be found in the California montane chaparral and woodlands, a near coastal ecoregion in Central and Southern California, USA. This ecoregion is disjunctive, with a major element in Southern California and another along the Monterey County coast. The ecoregion encompasses most of the Transverse Range that includes the San Bernardino Mountains; San Gabriel Mountains; portions of the Santa Ynez and San Rafael Mountains; Topatopa Mountains; San Jacinto Mountains; the Tehachapi, Greenhorn, Piute, and Kiavah Mountains that extend roughly northeast-southwest from the southern Sierra Nevada; and the Santa Lucia Range that parallels the coast southward from Monterey Bay to Morro Bay.

The California montane chaparral and woodland ecoregion consists of a complex mosaic of coastal sage scrub, lower chaparral dominated by chamise, upper chaparral dominated by manzanita, desert chaparral, Piñon-juniper woodland, oak woodlands, closed-cone pine forests, yellow pine forests, sugar pine-white fir forests, lodgepole pine forests, and alpine habitats. The prevalence of drought-adapted scrub species in the flora of this ecoregion helps distinguish it from similar communities in the Sierras and other portions of northern California. Many of the shared Sierra Nevadan species typically are adapted to drier habitats in that ecoregion, Jeffrey Pine (Pinus jeffreyi) being a good example.

Oak species are an important component of many chaparral and forest communities throughout the ecoregion. Canyon Live Oak, Interior Live Oak, Tanbark Oak (not a true Quercus species), Engelmann Oak, Golden-cup Oak, and Scrub Oak are some examples. Mixed-conifer forests are found between 1371 to 2896 meters elevation with various combinations and dominance of incense cedar, sugar pine, and white fir, Jeffrey Pine, Ponderosa Pine, and mountain juniper. Subalpine forests consist of groves of Limber Pine (Pinus flexilis), Lodgepole Pine, and Jeffrey Pine. Very old individual trees are commonly observed in these relict subalpine forests. Within this zone are subalpine wet meadows, talus slope herbaceous communities, krumholz woodlands, and a few small aspen groves.

In addition to these general vegetation patterns, this ecoregion is noted for a variety of ecologic islands, communities with specialized conditions that are widely scattered and isolated and typically harbor endemic and relict species. Examples include two localities of Knobcone Pine (Pinus attenuata) on serpentine soils, scattered vernal pools with a number of endemic and relict species, and isolated populations of one of North America’s most diverse cypress floras, including the rare Gowen Cypress (Cupressus goveniana goveniana) restricted to two sites on acidic soils in the northern Santa Lucia Range, Monterey Cypress (Cupressus macrocarpa) found only at two coastal localities near Monterey Bay, and Sargent Cypress (Callitropsis sargentii LR/LC) restricted to serpentine outcrops. Monterey Pine (Pinus radiata) is also restricted to three coastal sites near Monterey Bay.

The ecoregion is also home to a few endemic or near-endemic mammalian vertebrates, such as the White-eared Pocket Mouse (Perognathus alticolus EN), a mammal known only to two disjunct mountain ranges in southern California: San Bernardino Mountains in San Bernardino County (ssp. alticolus), and the Tehachapi Mountains, in Kern, Ventura, and Los Angeles counties. The near-endemic fossorial Agile Kangaroo Rat (Dipodomys agilis) is found in the southern disjunctive unit of the ecoregion, and is known only to the Los Angeles Basin and foothills of San Gabriel and San Bernardino mountains in Ventura, Los Angeles, and Riverside counties north to Santa Barbara County and through the southern Sierra Nevada, including Mount Pinos, Tehachapi and San Gabriel mountains, and northern San Fernando Valley. Non-endemic mammals found in the ecoregion include Botta's Pocket Gopher (Thomomys bottae) and Trowbridge's Shrew (Sorex trowbridgii). Some larger vertebrate predators can be found in the ecoregion, including Puma (Puma concolor), Bobcat (Lynx rufus), Coyote (Canis latrans), and Ringtails (Bassariscus astutus).

The ecoregion boasts five endemic and near-endemic amphibians, largely Plethodontid salamanders. Some specific salamander taxa found here are the endemic Tehachapi Slender Salamander (Batrachoseps stebbinsi VU), known from isolated sites in the Caliente Creek drainage, Piute Mountains, and Kern County, California along with scattered populations in the Tehachapi Mountains to Fort Tejon, Kern County; the near-endemic Blackbelly Slender Salamander (Batrachoseps nigriventris); the Monterey Ensatina (Ensatina eschscholtzii); the Channel Islands Slender Salamander (Batrachoseps pacificus), endemic to a narrow range restricted solely on Anacapa, Santa Cruz, Santa Rosa, and San Miguel islands; and the Arboreal Salamander (Aneides lugubris), found only in California and Baja California. A newt found here is the Coast Range Newt (Taricha torosa). Anuran taxa in the ecoregion include the Foothill Yellow-legged Frog (Rana boylii NT); the Southern Mountain Yellow-legged Frog (Rana muscosa EN), a California endemic occurring in several disjunctive populations; and the Northern Red-legged Frog (Rana aurora).

The California montane chaparral and woodlands ecoregions contains a number of reptiles such as the Coast Horned Lizard (Phrynosoma coronatum), who ranges from Northern California to Baja California. Also found here is the Sagebrush Lizard (Sceloporus graciosus); the Western Fence Lizard (Sceloporus occidentalis); the Southern Alligator Lizard (Elgaria multicarinata); and the Side-blotched Lizard (Uta stansburiana). The Two-striped Garter Snake (Thamnophis hammondii) is a restricted range reptile found near-coastally from Monterey County, California southward to Baja California.

The California Condor once inhabited much of the ecoregion, with the western Transverse Range acting today as a refuge for some of the last wild populations, after considerable conservation efforts, especially in the Los Padres National Forest. The Heermann's Gull (Larus heermanni NT) is found in coastal areas of the ecoregion.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Central Pacific Coastal Forests Habitat

This taxon is found in the Central Pacific Coastal Forests ecoregion, as one of its North American ecoregions of occurrence. These mixed conifer rainforests stretch from stretch from southern Oregon in the USA to the northern tip of Vancouver Island, Canada. These forests are among the most productive in the world, characterized by large trees, substantial woody debris, luxuriant growths of mosses and lichens, and abundant ferns and herbs on the forest floor. The major forest complex consists of Douglas-fir (Pseudotsuga menziesii) and Western hemlock (Tsuga heterophylla), encompassing seral forests dominated by Douglas-fir and massive old-growth forests of Douglas-fir, Western hemlock, Western red cedar (Thuja plicata), and other species. These forests occur from sea level up to elevations of 700-1000 meters in the Coast Range and Olympic Mountains. Such forests occupy a gamut of environments with variable composition and structure and includes such other species as Grand fir (Abies grandis), Sitka spruce (Picea sitchensis), and Western white pine (Pinus monticola).

Characteristic mammalian fauna include Elk (Cervus elaphus), Black-tailed Deer (Odocoileus hemionus), Coyote (Canis latrans), Black Bear (Ursus americanus), Mink (Mustela vison), and Raccoon (Procyon lotor).

The following anuran species occur in the Central Pacific coastal forests: Coastal tailed frog (Ascaphus truei); Oregon spotted frog (Rana pretiosa VU); Northern red-legged frog (Rana pretiosa); Pacific chorus frog (Pseudacris regilla); Cascade frog (Rana cascadae NT), generally restricted to the Cascade Range from northern Washington to the California border; Foothill yellow-legged frog (Rana boylii) and the Western toad (Anaxyrus boreas NT).  A newt found in the ecoregion is the Rough skinned newt (Taricha granulosa).

Salamanders within the ecoregion are: Del Norte salamander (Plethodon elongatus NT);  Van Dyke's salamander (Plethodon vandykei); Western redback salamander (Plethodon vehiculum); Northwestern salamander (Ambystoma gracile);  Olympic torrent salamander (Rhyacotriton olympicus VU), whose preferred habitat is along richly leafed stream edges; Long-toed salamander (Ambystoma macrodactylum), whose adults are always subterranean except during the breeding season; Dunn's salamander (Plethodon dunni), usually found in seeps and stream splash zones; Clouded salamander (Aneides ferreus NT), an aggressive insectivore; Monterey ensatina (Ensatina eschscholtzii), usually found in thermally insulated micro-habitats such as under logs and rocks; Pacific giant salamander (Dicamptodon tenebrosus), found in damp, dense forests near streams; and Cope's giant salamander (Dicamptodon copei), usually found in rapidly flowing waters on the Olympic Peninsula and Cascade Range.

There are a small number of reptilian taxa that are observed within this forested ecoregion, including: Pacific pond turtle (Emys marmorata); Common garter snake (Thamnophis sirtalis), an adaptable snake most often found near water; Northern alligator lizard (Elgaria coerulea); and the Western fence lizard.

Numerous avian species are found in the ecoregion, both resident and migratory. Example taxa occurring here are the Belted kingfisher (Megaceryle alcyon); Wild turkey (Meleagris gallopavo); and the White-headed woodpecker (Picoides albolarvatus) and the Trumpeter swan (Cygnus buccinator), the largest of the North American waterfowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: North: Douglas-fir/maple forests, forest clearings. In coastal areas, redwood forest, chaparral, oak woodland, canyons. Sierra Nevada: pine-oak-incense cedar forests. In dry or cold weather: in caves, underground, in rotting logs. Eggs are laid undergound, or under the bark of or within rotting logs (Stebbins 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species can be found in the north: Douglas-fir/maple forests, forest clearings. In coastal areas, redwood forest, chaparral, oak woodland, canyons. Sierra Nevada: pine-oak-incense cedar forests. In dry or cold weather: in caves, underground, in rotting logs. Eggs are laid underground, or under the bark of or within rotting logs (Stebbins 1985), where they develop directly without a larval stage. E. e. klauberi lives in mixed conifer forest and lays its eggs on the ground.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on a variety of invertebrates including insects (e.g., beetles, springtails, crickets), spiders, and millipedes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: Represented by many and/or large occurrences throughout the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but likely exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Population densities of 283 salamanders/ha have been reported (Nussbaum et al. 1983). In the Sierra Nevada of California (subspecies PLATENSIS), in old-growth conifer forest, maximum distance moved in a multi-year study was 120 m for males and 61 m for females (Staub et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Inactive in cold temperatures and hot, dry weather. Emerges in fall with onset of rainly season and usually remains active until end of May or June (in the north and at high elevations) (Behler and King 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Observations: Very little is known about the longevity of these animals, but one specimen lived 6.9 years in captivity (http://www.pondturtle.com/). Some estimates suggest these animals may live up to 15 years (http://amphibiaweb.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs primarily in spring and fall (Stebbins 1985). Female broods a cluster of 7-25 eggs. Eggs hatch in fall or early winter. There is no aquatic larval stage. Reaches sexual maturity in 2.5-3.5 years (Stebbins 1954, Behler and King 1979). Maximum estimated age in the Sierra Nevada was 15 years (Staub et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ensatina eschscholtzii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATATTTACTCGATGATTTTTTTCAACAAATCATAAAGATATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCTGGTATAGTCGGCACAGCCCTAAGCCTCCTGATTCGAACAGAATTAAGTCAGCCTGGTACTTTCCTAGGAGATGACCAGATTTACAATGTGCTTGTAACCTCTCACGCTTTCGTAATAATTTTTTTTATAGTGATGCCAATTATAATTGGTGGATTTGGCAACTGATTGCTCCCAATAATAATTGGTGCCCCAGATATAGCATTTCCACGAATAAATAACATAAGCTTTTGACTCCTTCCTCCCTCTTTCCTTCTTCTCTTAGCTTCCTCTGGAGTAGAAGCAGGAGCCGGTACCGGCTGAACAGTTTACCCCCCTTTAGCAAGTAACATAGCACATGCCGGAGCCTCCGTAGACCTAACTATCTTCTCCCTTCATTTGGCTGGAGTATCTTCTATCCTAGGCGCCATTAACTTCATTACAACCTCTATTAATATAAAATCCCCAACAGTAACACAATATCAGACGCCATTATTCGTATGATCAGTTTTAATTACCGCTGTACTACTTCTACTATCATTACCAGTATTAGCAGCAGGTATTACTATACTTCTTACTGATCGCAACCTTAACACTACATTCTTCGATCCTGCAGGAGGCGGAGACCCTGTTCTTTACCAACACTTATTTTGATTCTTCGGCCACCCAGAAGTTTATATTCTTATTCTCCCAGGTTTTGGAATAATTTCTCATATTGTTACATATTACTCAACAAAAAAAGAACCATTCGGATATATGAGTATAGTTTGAGCAATAATATCAATCGGTCTTCTAGGTTTTATTGTCTGAGCCCACCATATATTTACAGTAGACCTAAATGTAGATACACGAGCATATTTCACCTCAGCTACAATAATTATTGCCATTCCAACTGGGGTAAAAGTGTTTAGCTGATTAGCAACAATACATGGAGGATCTATTAAATGAGACGCAGCCATACTCTGAGCCTTAGGATTTATTTTCCTTTTTACCATCGGAGGTCTCACCGGAATTGTACTAGCTAACTCCTCACTAGATATTGTCTTACACGACACTTACTACGTAGTAGCCCACTTCCACTATGTACTATCAATAGGCGCTGTATTTGCCATTATAAGCGGTTTTGTACACTGGTTCCCTTTATTTTCGGGATTTACACTCCACTCAACATGAACAAAAATTCAATTTGTTGTTATATTTTTAGGAGTCAATGTAACATTTTTTCCACAACACTTCTTAGGACTTGCAGGAATACCACGACGATATTCAGATTATCCGGACGCATATGCCCTTTGAAATACAATCTCATCAATCGGATCTCTCATCTCACTAATAGCAGTTATTATAGCTGTATTTATTATCTGAGAAGCCTTCTCAGCTAAACGAGAAATCCTTTACACAGAACTTTCCCAAACAAATATCGAGTGACTATATGGATGCCCTCCACCCCATCATACATTTGAAGAACCAACTTTAGTTCAAAATGATTCATGCAAGAAAAAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ensatina eschscholtzii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range along the coastal ranges and Sierra Nevada from southern British Columbia to northern Baja California; many stable populations; no major pervasive threats.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson, Gabriela Parra-Olea, David Wake

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Recent trend likely is a slight decline.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Extent of occurrence has been relatively stable. Area of occupancy and population size surely have declined somewhat, but probably by less than 25%.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In the USA and Canada the total adult population size is unknown but probably exceeds 100,000. Its population appears to be stable. It is a rare species in Mexico, there have been only a few observations, but they are still found.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Ensatinas are terrestrial lungless salamanders with direct development (Stebbins 1954; Petranka 1998). Females lay and attend from 3-25 eggs (usually 9-16) in typical aestivation sites at the end of the rainy season (Stebbins 1954; Petranka 1998). Nest sites are often associated with logs (under or within a log, or underneath moss or loose bark on top of the log; summarized in Olson 2006), but may also include rock fissures in seepage areas (Stebbins 1954), animal burrows (Storer 1925) and cavities up to 0.8 m deep (Nussbaum et al. 1983). Juveniles hatch after 114-143 days and appear at the ground's surface at the beginning of winter rains (Stebbins 1954; Petranka 1998).

Ensatinas are usually common where present, with density estimates of 1730/ha for E. e. xanthoptica (Stebbins 1954) and 2833/ha for E. e. oregonensis (Gneadinger and Reed 1948).

Ensatinas are active during the winter rainy season on very local home ranges, 6-41 meters in width (Stebbins 1954; Staub et al. 1995). During the dry summer, they aestivate in underground retreats such as root cavities and rodent burrows (Stebbins 1954). This species has been shown to mark, recognize, and defend home areas in the laboratory outside the breeding season, suggesting territoriality (Wiltenmuth and Nishikawa 1998).

Coloration in Ensatina shows wide geographic variance, and distinguishes the seven subspecies, as delineated above (see Description). Coloration also serves to deter predators, via crypsis, aposematism (vivid warning colors, associated with toxicity), or mimicry of another species' warning colors. Crypsis via background matching is seen in three Ensatina subspecies: E. e. oregonensis, E. e. picta, and E. e. eschscholtzii (Stebbins 1949); crypsis by way of disruptive coloration is exhibited by another three Ensatina subspecies: E. e. platensis, E. e. croceater, and E. e. klauberi (Stebbins 1949); and Batesian mimicry of aposematic coloration in toxic newts (genus Taricha) is used by E. e. xanthoptica (Kuchta et al. 2008). Subspecies with disruptive coloration (blotching or spotting) are associated with forested areas, usually closed-canopy forest (Stebbins 1949).

Stebbins (1949) proposed that the vivid orange and yellow coloration of E. e. xanthoptica might be mimicry of the highly toxic newts Taricha torosa and Taricha granulosa, both of which are sympatric with E. e. xanthoptica. Kuchta et al. (2005) first tested this hypothesis, and showed that painted clay model salamanders with coloration matching that of E. e. xanthoptica were attacked significantly less often than brown morphs, despite both being equally visible on a white paper base. In experimental trials, Western Scrub-Jays presented first with a newt (Taricha torosa) were significantly less quick to attack and consume the presumed newt mimic E. e. xanthoptica than to attack and consume the cryptically colored E. e. oregonensis (Kuchta et al. 2008). Since jays were observed to eat E. e. xanthoptica tail and all, with relish and without ill effect, E. e. xanthoptica is apparently edible, making its resemblance to the highly toxic Taricha a case of Batesian mimicry rather than Müllerian (Kuchta et al. 2008).

Ensatinas lack traditional amphibian mucous glands as well as lacking typical, acidic mucus, instead secreting neutral mucus via specialized, derived granular glands (Fontana et al. 2006). The toxicity of E. e. xanthoptica has not been evaluated; high concentration of granular glands are found in Ensatina tails, and secretion under stress of a milky, sticky glutinous substance with an astringent taste has been observed (Kuchta et al. 2008). However, since Western Scrub-Jays are able to eat Ensatinas without any apparent ill effect, these salamanders appear not to be particularly toxic (Kuchta et al. 2008). The birds did spend considerable time scraping their beaks during and after consumption of E. e. xanthoptica (Kuchta et al. 2008). The stress-induced, sticky white mucous secretions may actually be an antipredator defense by virtue of being extremely adhesive, enabling Ensatinas to avoid being consumed by predators such as Western Terrestrial garter snakes (Thamnophis elegans; Arnold 1982).

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Corn, P. S. and Bury, R. B. (1991). ''Terrestrial amphibian communities in the Oregon Coast Range.'' Wildlife and Vegetation of Unmanaged Douglas-fir Forests. L. F. Ruggiero, K. B. Aubry, A. B. Carey, and M. H. Huff, eds., USDA Forest Service General Technical Report PNW-GTR-285, 304-317.
  • Stebbins, R. C. (1954). "Natural history of the salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 54(2), 47-124.
  • Storer, T. I. (1925). "A synopsis of the amphibia of California." University of California Publications in Zoology, 27, 1-342.
  • Arnold, S. J. (1982). ''A quantitative approach to antipredator performance: salamander defense against snake attack.'' Copeia, 1982, 247-253.
  • Fontana, M. F., Ask, K. A., Macdonald, R. J., Carnes, A. M., and Staub, N. L. (2005). ''Loss of traditional mucus glands and presence of a novel mucus-producing granular gland in the plethodontid salamander Ensatina eschscholtzii.'' Biological Journal of the Linnean Society, 87(3), 469-477.
  • Gneadinger, L. M., and Reed, C. A. (1948). ''Contribution to the natural history of the plethodontid salamander Ensatina eschscholtzii.'' Copeia, 1948, 187-196.
  • Kuchta, S. R. (2005). ''Experimental support for aposematic coloration in the salamander Ensatina eschscholtzii xanthoptica: implications for mimicry of Pacific newts.'' Copeia, 2005(2), 265-271.
  • Kuchta, S. R., Krakauer, A. H., and Sinervo, B. (2008). ''Why does the Yellow-eyed Ensatina have yellow eyes? Batesian mimicry of Pacific Newts (genus Taricha) by the salamander Ensatina eschscholtzii xanthoptica.'' Evolution, 62(4), 984-990.
  • Olson, D. H., Naumann, R. S., Ellenburg, L. L., Hansen, B. P., and Chan, S. S. (2006). ''Ensatina eschscholtzii nests at a managed forest site in Oregon.'' Northwestern Naturalist, 87, 203-208.
  • Rundio, D. E., and Olson, D. H. (2007). ''Influence of headwater site conditions and riparian buffers on terrestrial salamander response to forest thinning.'' Forest Science, 53(2), 320-330.
  • Staub, N. L., Brown, C. W., and Wake, D. B. (1995). ''Patterns of growth and movements in a population of Ensatina eschscholtzii platensis (Caudata: Plethodontidae) in the Sierra Nevada, California.'' Journal of Herpetology, 29, 593-599.
  • Stebbins, R. C. (1949). "Speciation in salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 48, 377-526.
  • Wake, D. B. (2006). ''Problems with species: patterns and processes of species formation in salamanders.'' Annals of the Missouri Botanical Gardens, 93, 8-23.
  • Wake, D. B. and Yanev, K. P. (1986). ''Geographic variation in allozymes in a 'ring species,' the plethodontid salamander Ensatina eschscholtzii of western North America.'' Evolution, 40(4), 702-715.
  • Welsh, H. H., Jr., Fellers, G. M., and Lind, A. J. (2007). ''Amphibian populations in the terrestrial environment: is there evidence of declines of terrestrial forest amphibians in northwestern California?'' Journal of Herpetology, 41(3), 469-482.
  • Wiltenmuth, E. B. and Nishikawa, K. C. (1998). ''Geographical variation in agonistic behaviour in a ring species of salamander, Ensatina eschscholtzii.'' Animal Behavior, 55, 1595-1606.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: Habitat destruction and degradation likely are affecting a low percentage of existing populations. The nominate subspecies is probably heavily impacted by the loss of habitat as a result of the development and expansion of vineyards.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
In moist climates, ensatinas tolerate intensive forestry practices fairly well, but in drier climates recently logged areas have lower population densities than do old growth forests, presumably reflecting moisture differences (see Petranka 1998). In Mexico the nominate subspecies is probably heavily impacted by the loss of habitat as a result of the development and expansion of vineyards.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Probably because Ensatina has its highest abundance in edge habitats (Stebbins 1951), it remains fairly common throughout most of its range despite human development. Surveys in northwestern California forests, for example, show no evidence of population declines over the time period 1984-1995 (Welsh et al. 2007). The subspecies E. e. croceator and E. e. klauberi, however, inhabit more fragmented habitat in the drier part of Southern California, and are presumably more susceptible to localized extinction. Few threats are known for this species beyond habitat destruction.

Interestingly, while Storer (1925) found that E. e. xanthoptica was less common in central California than Aneides lugubris, the reverse is now true, presumably because Aneides is now less common (D. B. Wake, pers. comm.)

Direct development away from streams and the dispersed distribution of Ensatinas in a variety of common habitats likely make it less sensitive than other species with breeding aggregations or migrations or more specific aestivation or brooding sites. However, Olson et al. (2006) found that Ensatina nests in a managed forest in Oregon were preferentially associated (13 of 14) with downed wood, particularly large logs; they concluded that management of downed wood to provide cover and nesting sites may be necessary in young stands of forest. In addition, captures of adult Ensatinas decreased by 40% in thinned forests lacking downed wood, whereas captures in thinned forests remained the same where downed wood volume was high (Rundio and Olson 2007).

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Corn, P. S. and Bury, R. B. (1991). ''Terrestrial amphibian communities in the Oregon Coast Range.'' Wildlife and Vegetation of Unmanaged Douglas-fir Forests. L. F. Ruggiero, K. B. Aubry, A. B. Carey, and M. H. Huff, eds., USDA Forest Service General Technical Report PNW-GTR-285, 304-317.
  • Stebbins, R. C. (1954). "Natural history of the salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 54(2), 47-124.
  • Storer, T. I. (1925). "A synopsis of the amphibia of California." University of California Publications in Zoology, 27, 1-342.
  • Arnold, S. J. (1982). ''A quantitative approach to antipredator performance: salamander defense against snake attack.'' Copeia, 1982, 247-253.
  • Fontana, M. F., Ask, K. A., Macdonald, R. J., Carnes, A. M., and Staub, N. L. (2005). ''Loss of traditional mucus glands and presence of a novel mucus-producing granular gland in the plethodontid salamander Ensatina eschscholtzii.'' Biological Journal of the Linnean Society, 87(3), 469-477.
  • Gneadinger, L. M., and Reed, C. A. (1948). ''Contribution to the natural history of the plethodontid salamander Ensatina eschscholtzii.'' Copeia, 1948, 187-196.
  • Kuchta, S. R. (2005). ''Experimental support for aposematic coloration in the salamander Ensatina eschscholtzii xanthoptica: implications for mimicry of Pacific newts.'' Copeia, 2005(2), 265-271.
  • Kuchta, S. R., Krakauer, A. H., and Sinervo, B. (2008). ''Why does the Yellow-eyed Ensatina have yellow eyes? Batesian mimicry of Pacific Newts (genus Taricha) by the salamander Ensatina eschscholtzii xanthoptica.'' Evolution, 62(4), 984-990.
  • Olson, D. H., Naumann, R. S., Ellenburg, L. L., Hansen, B. P., and Chan, S. S. (2006). ''Ensatina eschscholtzii nests at a managed forest site in Oregon.'' Northwestern Naturalist, 87, 203-208.
  • Rundio, D. E., and Olson, D. H. (2007). ''Influence of headwater site conditions and riparian buffers on terrestrial salamander response to forest thinning.'' Forest Science, 53(2), 320-330.
  • Staub, N. L., Brown, C. W., and Wake, D. B. (1995). ''Patterns of growth and movements in a population of Ensatina eschscholtzii platensis (Caudata: Plethodontidae) in the Sierra Nevada, California.'' Journal of Herpetology, 29, 593-599.
  • Stebbins, R. C. (1949). "Speciation in salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 48, 377-526.
  • Wake, D. B. (2006). ''Problems with species: patterns and processes of species formation in salamanders.'' Annals of the Missouri Botanical Gardens, 93, 8-23.
  • Wake, D. B. and Yanev, K. P. (1986). ''Geographic variation in allozymes in a 'ring species,' the plethodontid salamander Ensatina eschscholtzii of western North America.'' Evolution, 40(4), 702-715.
  • Welsh, H. H., Jr., Fellers, G. M., and Lind, A. J. (2007). ''Amphibian populations in the terrestrial environment: is there evidence of declines of terrestrial forest amphibians in northwestern California?'' Journal of Herpetology, 41(3), 469-482.
  • Wiltenmuth, E. B. and Nishikawa, K. C. (1998). ''Geographical variation in agonistic behaviour in a ring species of salamander, Ensatina eschscholtzii.'' Animal Behavior, 55, 1595-1606.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None needed. It occurs in many protected areas. E. e. klauberi occurs in the Sierra San Pedro Martir National Park. This species is protected by Mexican law under the "Special Protection" category (Pr).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

Ensatinas are not commonly part of the pet trade, nor are they hunted or otherwise used by humans. They are often found on the edge of rural human development, however, and artificial debris from those developments (discarded boards, tires, etc.) is often used for cover in those habitats (D. Parks, pers. obs).

  • Stebbins, R. C. (1985). A Field Guide to Western Reptiles and Amphibians. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Nussbaum, R. A., Brodie, E. D., Jr., and Storm, R. M. (1983). Amphibians and Reptiles of the Pacific Northwest. University of Idaho Press, Moscow, Idaho.
  • Stebbins, R.C. (1951). Amphibians of Western North America. University of California Press, Berkeley.
  • Corn, P. S. and Bury, R. B. (1991). ''Terrestrial amphibian communities in the Oregon Coast Range.'' Wildlife and Vegetation of Unmanaged Douglas-fir Forests. L. F. Ruggiero, K. B. Aubry, A. B. Carey, and M. H. Huff, eds., USDA Forest Service General Technical Report PNW-GTR-285, 304-317.
  • Stebbins, R. C. (1954). "Natural history of the salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 54(2), 47-124.
  • Storer, T. I. (1925). "A synopsis of the amphibia of California." University of California Publications in Zoology, 27, 1-342.
  • Arnold, S. J. (1982). ''A quantitative approach to antipredator performance: salamander defense against snake attack.'' Copeia, 1982, 247-253.
  • Fontana, M. F., Ask, K. A., Macdonald, R. J., Carnes, A. M., and Staub, N. L. (2005). ''Loss of traditional mucus glands and presence of a novel mucus-producing granular gland in the plethodontid salamander Ensatina eschscholtzii.'' Biological Journal of the Linnean Society, 87(3), 469-477.
  • Gneadinger, L. M., and Reed, C. A. (1948). ''Contribution to the natural history of the plethodontid salamander Ensatina eschscholtzii.'' Copeia, 1948, 187-196.
  • Kuchta, S. R. (2005). ''Experimental support for aposematic coloration in the salamander Ensatina eschscholtzii xanthoptica: implications for mimicry of Pacific newts.'' Copeia, 2005(2), 265-271.
  • Kuchta, S. R., Krakauer, A. H., and Sinervo, B. (2008). ''Why does the Yellow-eyed Ensatina have yellow eyes? Batesian mimicry of Pacific Newts (genus Taricha) by the salamander Ensatina eschscholtzii xanthoptica.'' Evolution, 62(4), 984-990.
  • Olson, D. H., Naumann, R. S., Ellenburg, L. L., Hansen, B. P., and Chan, S. S. (2006). ''Ensatina eschscholtzii nests at a managed forest site in Oregon.'' Northwestern Naturalist, 87, 203-208.
  • Rundio, D. E., and Olson, D. H. (2007). ''Influence of headwater site conditions and riparian buffers on terrestrial salamander response to forest thinning.'' Forest Science, 53(2), 320-330.
  • Staub, N. L., Brown, C. W., and Wake, D. B. (1995). ''Patterns of growth and movements in a population of Ensatina eschscholtzii platensis (Caudata: Plethodontidae) in the Sierra Nevada, California.'' Journal of Herpetology, 29, 593-599.
  • Stebbins, R. C. (1949). "Speciation in salamanders of the Plethodontid genus Ensatina." University of California Publications in Zoology, 48, 377-526.
  • Wake, D. B. (2006). ''Problems with species: patterns and processes of species formation in salamanders.'' Annals of the Missouri Botanical Gardens, 93, 8-23.
  • Wake, D. B. and Yanev, K. P. (1986). ''Geographic variation in allozymes in a 'ring species,' the plethodontid salamander Ensatina eschscholtzii of western North America.'' Evolution, 40(4), 702-715.
  • Welsh, H. H., Jr., Fellers, G. M., and Lind, A. J. (2007). ''Amphibian populations in the terrestrial environment: is there evidence of declines of terrestrial forest amphibians in northwestern California?'' Journal of Herpetology, 41(3), 469-482.
  • Wiltenmuth, E. B. and Nishikawa, K. C. (1998). ''Geographical variation in agonistic behaviour in a ring species of salamander, Ensatina eschscholtzii.'' Animal Behavior, 55, 1595-1606.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ensatina

Ensatina eschscholtzii (commonly known by its genus name, Ensatina) is a complex of plethodontid (lungless) salamanders[2] found in coniferous forests, oak woodland and chaparral[3] from British Columbia, through Washington, Oregon, across California (where all seven subspecies variations are located), all the way down to Baja California in Mexico.

Habitat and description[edit]

Ensatina eschscholtzii klauberi, the Large-blotched Salamander
Monterey Ensatina

The Ensatina subspecies E. e. eschscholtzii, or Monterey Ensatina, can be found in Santa Cruz, Monterey, and the California coastal mountains. They reach a total length of three to five inches, and can be identified primarily by the structure of the tail, and how it is narrower at the base. This salamander is the only type that has this tail structure and five toes on the back feet.

Males often have longer tails than the females, and many of the salamanders have lighter colored limbs in comparison to the rest of the body. The salamanders lay their eggs underground, often in threes, which then hatch directly into salamanders, skipping the usual aquatic phase.

As a ring species[edit]

The Ensatina salamander has been described as a ring species in the mountains surrounding the Californian Central Valley.[2] The complex forms a horseshoe shape around the mountains, and though interbreeding can happen between each of the 19 populations around the horseshoe, the Ensatina eschscholtzii subspecies on the western end of the horseshoe cannot interbreed with the Ensatina klauberi on the eastern end.[4] As such it is thought to be an example of incipient speciation, and provides an illustration of "nearly all stages in a speciation process" (Dobzhansky,1958).[2][5] Richard Highton argued Ensatina is a case of multiple species and not a continuum of one species (meaning, by traditional definitions it is not a ring species)[6]

Human contact[edit]

The ensatina can usually be found under logs, brush, by or in streams and lakes, and in other moist places. Because they breathe through their pores, distress in the animal can be caused by improper handling by human hands. They may exude a toxic milky secretion from the tail.[3]

Subspecies[edit]

E. e. platensis from Fresno County, California
  • Yellow Blotched EnsatinaE. e. croceater (Cope, 1868)
  • Monterey EnsatinaE. e. eschscholtzii Gray, 1850
  • Large Blotched EnsatinaE. e. klauberi Dunn, 1929
  • Oregon EnsatinaE. e. oregonensis (Girard, 1856)
  • Painted EnsatinaE. e. picta Wood, 1940
  • Sierra Nevada EnsatinaE. e. platensis (Jiménez de la Espada, 1875)
  • Yellow Eyed EnsatinaE. e. xanthoptica Stebbins, 1949

References[edit]

  1. ^ Hammerson et al. (2004). Ensatina eschscholtzii. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006.
  2. ^ a b c Wake, D. (1997) Incipient species formation in salamanders of the Ensatina complex Proceedings of the National Academy of Science USA 94:7761-7767
  3. ^ a b Monterey Ensatina San Diego Field Station, United States Geological Survey Viewed: April 24, 2005, Last updated: March 05, 2003
  4. ^ Dawkins, R. (2004) The Ancestor's Tale: A Pilgrimage to the Dawn of Life ISBN 0-618-00583-8, Ring Species (The Salamander's Tale)
  5. ^ Dobzhansky T. (1958) in A Century of Darwin, ed Barnett S A (Harvard Univ. Press, Cambridge, MA), pp 19–55.
  6. ^ Highton, Richard (June 1998). "Is Ensatina eschscholtzii a Ring-Species?". Herpetologica 54 (2): 254-278. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Citing sympatry with only rare interbreeding between subspecies ESCHSCHOLTZII and KLAUBERI, Frost and Hillis (1990) argued that subspecies KLAUBERI (and probably other subspecies) should be regarded as a distinct species. Moritz et al. (1992) used mtDNA analyses to substantiate the hypothesis that ENSATINA is a "ring species" and that subspecies ESCHSCHOLTZII and KLAUBERI are the end points of two independently evolving lineages that are now genetically and in some places reproductively isolated. Moritz et al. (1992) cautioned against using mtDNA data alone to determine species boundaries (e.g., "species" based on mtDNA may be united by nuclear gene flow); they continued to regard ENSATINA as comprising one polytypic species. The geographically distant populations of subspecies ESCHSCHOLTZII exhibit a low level of genetic divergence; the same is true for the coastal and inland populations of subspecies XANTHOPTICA; apparently the spread of these subspecies has been relatively recent (Moritz et al. 1992). These and and other studies of ENSATINA systematics were reviewed by Highton (1998) and Wake and Schneider (1998).

Highton (1998) concluded that published data support the recognition of multiple species of ENSATINA, whereas Wake and Schneider (1998) disagreed, cited relevant data unavailable to Highton, and stated that a new taxonomy may be required when studies in progress are completed. For the present, Wake and Schneider (1998) recommended continued recognition of the ENSATINA complex as a single polytypic species. Wake and Jockusch (2000) provided further information supporting recognition of E. ESCHSCHOLTZII as a single ring species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!