Overview

Comprehensive Description

Description

Pipa pipa can be identified by its large triangualr head, small eyes with rounded pupils, and nostrils found at the end of two narrow tubes on the snout. The body is flat, brown or olive-colored, and covered by many tubercles. The front limbs are short and weak and the hind limbs are long, strong and webbed.
  • Capula, M. (1989). Simon & Schulter's Guide to Reptiles and Amphibians of the World. Simon & Schulter Inc., New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Amazon basin of South America in Colombia, Venezuela, Guyana, Suriname, French Guiana, Ecuador, Peru, Bolivia, and Brazil. It is also present at scattered localities in southern and eastern Trinidad Island (in Trinidad and Tobago). It is a lowland species found below 400m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Pipa pipa inhabits the eastern region of South America, and Trinidad.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Found in sluggish rivers and canals with muddy bottoms throughout South America from Ecuador to Guianas and southward to Peru, Bolivia, and Brazil (Capula 1989)
  • Capula, M. (1989). Simon & Schulter's Guide to Reptiles and Amphibians of the World. Simon & Schulter Inc., New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

females: 105-171 mm males: 106-154 mm Pipa pipa are wide and greatly flattened with triangular-shaped heads. They are generally light brown, with darker brown spots on the back.

Females can be distinguished from males by a ring-shaped swelling at the cloaca, visible only when the animals are ready to breed.

The animals have very small black eyes which are lidless and beadlike.

These frogs have large, flipper-like hind feet. Their forelimbs are short with webless digits that each end in a star-shaped organ. These quadripartite fingertips are one of the characteristics that distinguish Pipa pipa from other species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Aquatic species that lives in slow flowing watercourses, backwater of streams, and ponds and pools in tropical rainforest, hiding under submerged leaf-litter. They also occur in flooded forest. They seldom venture onto land, where they move clumsily. Direct development takes place on the dorsum of the adult.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Pipa pipa are highly aquatic, living in murky ponds and swamps.

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Pipa pipa are aquatic omnivores. They eat worms, insects, crustaceans, and small fishes. They lack tongues and use the long, sensitive fingers of their forelimbs to search for food on the bottoms of ponds. Their forelimbs also serve to stuff the food into their mouths. Immature Pipa eat invertebrates such as Daphnia and Tubifex worms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
6.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Reproduction in Pipa pipa includes direct development of the young; there is no larval stage. The female carries the eggs in a honeycomb structure on her back until they complete development and emerge as miniature adults. Mating begins when males make a tickling call while in the water. Males grasps the female from above and around the waist in inguinal amplexus. The female initiates vertical circular turnovers while they're together. The male clasps the female with his forelimbs wrapped in front of her hindlimbs, and they raise off the floor of the stream or pond and swim to the surface of the water to get air. At the top of the arc, they flip, now floating on their backs, and the female releases 3-10 eggs which fall onto the male's belly. Completing their arc, they flip to their original position, bellies to the ground. The male now loosens his grip and permits the eggs to roll onto her back while he simultaneously fertilizes them. This spawning ritual is repeated 15-18 times. Roughly 100 eggs are laid and fertilized.

The eggs adhere only to the female's back, possibly due to a cloacal secretion. They do not stick to the male's belly nor to other eggs already on the female's back. In the hours after fertilization, the eggs sink into the female's skin. Skin grows around the eggs, which become enclosed in a cyst with a horny lid. During development, the young grow temporary tails, which are apparently used in the uptake of oxygen. After 12-20 weeks, the young emerge as tailless flat frogs shaped like their mothers, except that they are only 2 cm in length. They are, however, fully developed except for bifurcation of the lobes on the fingertips.

The young usually emerge from the female's back at the time of molting, that is, when the mother sheds her skin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pipa pipa

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBAP1158-10|GQ244477|Pipa pipa| ACTCGCTGACTCTTTTCAACCAACCACAAAGACATTGGCACTCTATACCTCGTATTCGGCGCCTGAGCTGGAATAGTAGGAACAGCCCTC---AGCCTACTGATCCGAGCGGAACTAAGTCAACCAGGGTCCCTCCTTGGCGAC---GACCAAATCTACAACGTTATTGTTACTGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCAGTCATAATCGGGGGCTTTGGAAACTGACTCGTACCATTAATG---ATCGGGGCCCCAGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGATTACTGCCCCCCTCTTTTCTACTTCTACTAGCCTCATCAGGTGTAGAAGCTGGGGCTGGCACCGGATGAACAGTCTACCCGCCGCTGGCAGGCAACCTAGCGCATGCTGGGGCCTCTGTGGACCTA---ACCATCTTCTCCTTACACTTGGCCGGAGTCTCTTCAATCCTTGGAGCAATTAACTTCATTACAACAACGATCAACATAAAACCACCAACCGTGACCCAATACCAAACCCCTCTGTTTGTATGATCGGTCTTAATCACAGCCGTACTACTTCTATTATCACTACCCGTTCTAGCAGCG---GGAATCACCATACTACTCACTGACCGAAATCTTAACACAACATTCTTTGACCCGGCAGGCGGCGGTGACCCAGTTCTTTACCAACACCTATTCTGATTCTTTGGGCACCCTGAAGTATACATCCTGATTCTACCAGGATTCGGAATAATTTCACACATCGTAACATATTACTCAGGTAAAAAG---GAACCATTTGGGTATATGGGTATGGTTTGGGCCATAATATCAATTGGCCTTTTAGGCTTTATCGTGTGAGCACACCATATGTTCACAGTAGACCTAA  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pipa pipa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Enrique La Marca, Claudia Azevedo-Ramos, Débora Silvano, Luis A. Coloma, Santiago Ron, Jerry Hardy, Manfred Beier

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is common throughout its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Pipa pipa is entirely aquatic living on the muddy bottom of tropical rivers. Using star-shaped tactile organs on its fingertips to detect food, the tongueless Pipa pipa lunges at its prey, consisting mostly of invertebrates. During the process of mating the male fertilizes the eggs and then attaches them to the female's back. The skin of the female then encloses the fertilized eggs. Larval development occurs within the egg and fully metamorphosed individuals approximately 2cm in length emerge from incubation after 3 to 4 months.
  • Capula, M. (1989). Simon & Schulter's Guide to Reptiles and Amphibians of the World. Simon & Schulter Inc., New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
It is not seriously threatened, but local populations are probably impacted by habitat loss and degradation due to logging, agricultural expansion, and human settlement.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

There are no ecomonic benefits other than that they sometimes consume harmful insects.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Surinam toad

The Surinam toad or star-fingered toad (Spanish: aparo, rana comun de celdillas, rana tablacha, sapo chinelo, sapo chola, or sapo de celdas) (Pipa pipa) is a species of frog in the Pipidae family.

It is found in Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Peru, Suriname, Trinidad and Tobago, and Venezuela. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical swamps, swamps, freshwater marshes, and intermittent freshwater marches. It is threatened by habitat loss.

Contents

Description

The appearance of the toad is somewhat like a leaf. It is almost completely flat, and colored in a mottled brown. Feet are broadly webbed with the front toes having small, star-like appendages. Sizes of close to 20 cm (8 in), are recorded, though 10-13 cm (4-5 in) is more typical. The Surinam toad has minute eyes, no teeth and no tongue.

Reproduction

Surinam toads are best known for their remarkable reproductive habits. Unlike the majority of toads, the males of this species don't attract mates with croaks and other sounds often associated with these aquatic animals. Instead they produce a sharp clicking sound by snapping the hyoid bone in their throat.[1] The partners rise from the floor while in amplexus and flip through the water in arcs. During each arc, the female releases 3-10 eggs, which get embedded in the skin on her back by the male's movements. After implantation the eggs sink into the skin and form pockets over a period of several days, eventually taking on the appearance of an irregular honeycomb. The larvae develop through to the tadpole stage inside these pockets, eventually emerging from the mother's back as fully developed toads, though they are less than an inch long (2 cm). Once they have emerged from their mother's back, the toads begin a largely solitary life.

Gallery

Whole body view
Whole body view
Close-up view
Close-up view
Museum samples of a female Surinam toad with embedded, fully formed froglets on the back

References

  1. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Suriname Toad

  1. REDIRECT Surinam toad  

This page was kept as a redirect to the corresponding main article on the topic it names, in order to preserve the page's edit history after its content was merged into the other article's content. Please do not remove the tag that generates this text (unless the need to recreate an article on this page has been demonstrated), nor delete this page. For more information, follow the first category link.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!