Physical Description

Type Information

Paratype for Stromatospongia vermicola Hartman, 1969
Catalog Number: USNM 24078
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): P. Chapman
Year Collected: 1966
Locality: Discovery Bay, Jamaica, Caribbean Sea, North Atlantic Ocean
Depth (m): 55 to 55
  • Paratype: Hartman. 1969. Peabody Mus. Postilla. 137: 2-7, f.1-3,13,17,21,25,29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stromatospongia vermicola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATTATTAGGAGCCTTTAGTGGAGTGATAGGAACAGCCTTTAGTGTGCTTATTAGATTAGAATTGTCGGCTCCGGGGTCTATGTTAGGTGATGACCAGTTATATAATGTTATAGTTACTGCCCATGCTTTTGTAATGATATTTTTCTTAGTTATGCCTGTCTTAATCGGGGGGTTTGGTAATTGATTTGTGCCCCTTTATATAGGGGCCCCCGACATGGCTTTCCCAAGGTTAAATAACATTAGTTTTTGATTGTTGCCGCCCTCGTTAACTTTATTACTTGGTTCGGCTTTTGTGGAACAAGGCGCGGGAACAGGGTGAACTGTTTATCCTCCCTTAGCTAGTATACAAGCCCATTCGGGGGGATCCGTAGATATGGTGATTTTTAGTCTTCATTTAGCGGGGATTTCTTCAATTTTAGGGGCCATGAACTTTATTACAACTATTTTTAATATGCGAGCTCCTGGGATCACTTTAGATAGAATGCCTCTATTTGTTTGGTCTATTTTAGTAACCGTTTTTTTATTGTTATTGTCTTTGCCTGTGTTGGCGGGTGCAATTACTATGCTTTTGACGGACAGGAATTTTAATACTACCTTTTTTGATCCTGCAGGGGGCGGGGACCCTATTTTATATCAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stromatospongia vermicola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!