Overview
Distribution
Aegean Sea, European waters (ERMS scope), Greek Exclusive Economic Zone, Israeli Exclusive Economic Zone, Levantine Sea, Mediterranean Sea, Western Mediterranean
-
Bergbauer, M.; Humberg, B. (2001). Gids flora en fauna van de Middellandse Zee [Guide to the flora and fauna of the Mediterranean Sea]. Tirion Natuur: Baarn, The Netherlands. ISBN 90-5210-423-9. 319 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9880
-
Topsent, E. 1929e. Faune et Flore de la Méditerranée. Porifera. 20 pp. Commission International pour l'Exploration Scientifique de la Mer Méditerrané, Paris.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=127080
-
Van Soest, R.W.M. 2001. Porifera, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 85-103
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=1421
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
Voultsiadou, E. 2005b. Sponge diversity in the Aegean Sea: Check list and new information. Italian Zoology 72 (1): 53-64.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=149735
-
Voultsiadou, E. 2005a. Demosponge distribution in the eastern Mediterranean: a NW-SE gradient. Helgoländer Marine Research 59: 237-251.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=149737
-
Lévi, C. 1957a. Spongiaires des côtes d'Israel. Bulletin of the Research Council of Israel 6 B(3-4): 201-212.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=7846
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
Depth range based on 84 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.
Environmental ranges
Depth range (m): 15 - 40
Temperature range (°C): 15.316 - 17.140
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 37.926 - 38.444
Oxygen (ml/l): 5.513 - 5.541
Phosphate (umol/l): 0.095 - 0.131
Silicate (umol/l): 1.247 - 1.434
Graphical representation
Depth range (m): 15 - 40
Temperature range (°C): 15.316 - 17.140
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 37.926 - 38.444
Oxygen (ml/l): 5.513 - 5.541
Phosphate (umol/l): 0.095 - 0.131
Silicate (umol/l): 1.247 - 1.434
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 63 samples.
Environmental ranges
Depth range (m): 15 - 40
Temperature range (°C): 15.316 - 17.140
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 37.926 - 38.444
Oxygen (ml/l): 5.513 - 5.541
Phosphate (umol/l): 0.095 - 0.131
Silicate (umol/l): 1.247 - 1.434
Graphical representation
Depth range (m): 15 - 40
Temperature range (°C): 15.316 - 17.140
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 37.926 - 38.444
Oxygen (ml/l): 5.513 - 5.541
Phosphate (umol/l): 0.095 - 0.131
Silicate (umol/l): 1.247 - 1.434
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Agelas oroides
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTATTATTAGGAGCCTTTAGCGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGGTTAGAATTATCGGCTCCGGGCTCAATGTTAGGTGATGATCAACTTTATAATGTTATAGTAACCGCTCATGCTTTTGTAATGATATTTTTTTTAGTTATGCCGGTCTTAATTGGGGGGTTTGGTAACTGATTTGTCCCTCTTTATATAGGGGCCCCCGATATGGCTTTCCCCCGGCTTAATAATATCAGTTTTTGATTATTGCCGCCTTCTTTAACTCTATTACTTGGTTCTGCTTTTGTAGAACAAGGGGCTGGGACCGGGTGAACTGTATATCCGCCCTTAGCAAGTATACAGGCTCACTCTGGTGGGTCTGTGGATATGGTGATTTTTAGTCTTCACTTACCTGGAATTTCCTCTATTCTAGGGGCAATGAATTTTATTACAACTATATTTAATATGCGAGCACCTGGGATAACATTAAATAGAATGCCCTTATTTGTATGATCTATTTTAGTTACGGTCTTTTTATTATTATTGTCTTTGCCTGTGTTGGCAGGGGCAATCACTATGCTTTTAACCGATAGAAATTTTAATACTACATTTTTTGACCCAGCCGGAGGGGGGGACCCTATTTTATACCAA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Agelas oroides
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
