Overview

Distribution

Aegean Sea, European waters (ERMS scope), Greek Exclusive Economic Zone, Israeli Exclusive Economic Zone, Levantine Sea, Mediterranean Sea, Western Mediterranean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 84 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 15 - 40
  Temperature range (°C): 15.316 - 17.140
  Nitrate (umol/L): 0.211 - 0.535
  Salinity (PPS): 37.926 - 38.444
  Oxygen (ml/l): 5.513 - 5.541
  Phosphate (umol/l): 0.095 - 0.131
  Silicate (umol/l): 1.247 - 1.434

Graphical representation

Depth range (m): 15 - 40

Temperature range (°C): 15.316 - 17.140

Nitrate (umol/L): 0.211 - 0.535

Salinity (PPS): 37.926 - 38.444

Oxygen (ml/l): 5.513 - 5.541

Phosphate (umol/l): 0.095 - 0.131

Silicate (umol/l): 1.247 - 1.434
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agelas oroides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTATTAGGAGCCTTTAGCGGAATGATAGGAACAGCCTTTAGTGTGCTTATTAGGTTAGAATTATCGGCTCCGGGCTCAATGTTAGGTGATGATCAACTTTATAATGTTATAGTAACCGCTCATGCTTTTGTAATGATATTTTTTTTAGTTATGCCGGTCTTAATTGGGGGGTTTGGTAACTGATTTGTCCCTCTTTATATAGGGGCCCCCGATATGGCTTTCCCCCGGCTTAATAATATCAGTTTTTGATTATTGCCGCCTTCTTTAACTCTATTACTTGGTTCTGCTTTTGTAGAACAAGGGGCTGGGACCGGGTGAACTGTATATCCGCCCTTAGCAAGTATACAGGCTCACTCTGGTGGGTCTGTGGATATGGTGATTTTTAGTCTTCACTTACCTGGAATTTCCTCTATTCTAGGGGCAATGAATTTTATTACAACTATATTTAATATGCGAGCACCTGGGATAACATTAAATAGAATGCCCTTATTTGTATGATCTATTTTAGTTACGGTCTTTTTATTATTATTGTCTTTGCCTGTGTTGGCAGGGGCAATCACTATGCTTTTAACCGATAGAAATTTTAATACTACATTTTTTGACCCAGCCGGAGGGGGGGACCCTATTTTATACCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Agelas oroides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!