Overview

Distribution

Range Description

This species is present in Zhejiang Province (Zhenhai, Xiaoshan, Wenling, Yiwu, Beilun and Zhoushan [including Zhoushan Dao Island]), China. It is present at elevations of 50-200m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species occurs in central and western Zhejiang province of China (Yiwu, Wenling, Xiaoshan, Zhenhai). One population is found on Zhoushan Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

A relatively small salamander with a total length around 100–120 mm. Head oval-shaped with a V-shaped groove. Body cylindrical. Snout rounded with nostrils situated at the tip. Distance between nostrils is wider than that between eyes. Labial fold absent. Gular fold prominent. Interior line of the vomerine teeth very long, extending posteriorly to the posterior margin of eye. When limbs are pressed against body, fingers and toes do not meet in most specimens. Digits without web and horny covers. Tubercles present on palms and soles. Tail shorter than snout-vent length. Dorsal caudal fin continues from tail base to tail tip; ventral caudal fin is present at the posterior 2/3 of the tail. Typically 10 costal grooves, rarely 11. Dorsal color is dark grey and changes to greenish grey during breeding season. Ventral color is grayish white without speckles (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

All measurements are from Cai (1985).

Male (14 specimens). Total length: 83–136 mm; snout-vent length: 47–74 mm; Head length: 14–19 mm; Head width: 10–17 mm; forelimb length: 15–21 mm; hind-limb length: 17–22 mm.

Female (10 specimens). Total length: 87–117 mm; snout-vent length: 53–68 mm; Head length: 15–17 mm; Head width: 11–14 mm; forelimb length: 14–17 mm; hind-limb length: 15–18.5 mm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Vomerine teeth lined in “ɿɾ” shape; interior line extends posteriorly to the posterior margin of eye. When limbs are adpressed, fingers and toes do not meet in most specimens (Cai, 1985). Tubercles are present on palms and soles. 10 costal grooves. Caudal fin is present and prominent in males. Venter is grayish white without speckles (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

This salamander looks like Hynobius chinensis and differs from the latter species by the interior line of vomerine teeth extending to the posterior margin of eye, 10-11 costal grooves and presence of caudal fins. Hynobius chinensis has shorter vomerine teeth, 11-12 costal grooves and nearly absence of caudal fins.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits forests and arable fields in hilly areas. It breeds in pools and small streams where the larvae also develop.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This salamander lives terrestrially under earth, rocks or rotten leaves in hilly areas at elevations of 100–200 m. It is sometimes found under grass after heavy rains in the summer. Local people dig it out in tomato or soybean fields. In general, this species is hard to find. It feeds on earthworms, centipedes and millipedes. Cannibalism could occur. In the breeding season, it is easily found in small ponds (Cai, 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Descriptions of eggs and larvae are derived from descriptions originally given for H. chinensis from Fujian and Zhejiang. Salamanders from these provinces are now considered to belong to Hynobius yiwuensis (Pope, 1931; Chang, 1936; Zhang & Tang, 1987). Zhang & Tang described eggs, larvae and adult animals from Huantan, Xiaoshan County in Zhejiang Province, collected in February 1981: A pair of egg sacs is attached to stems of aquatic plants. An egg sac has a thick anterior part and a thinner caudal end, about 15–17 cm long, containing 33–64 eggs. Egg diameter 2.5-3 mm. On hatching, larvae measure about 15 mm and have a pair of balancers; they still have an amount of yolk and are almost translucent. The remnants of the yolk sac are used up after about ten days (Zhang & Tang, 1987; Fei et al., 2006). Zhang & Tang (1987) provide a table for the embryonic development. In mid-January, with water temperatures between 8–10°C, eggs take about 40 days to hatch, and metamorphosis is completed after 3.5 to 4 months (Fei et al., 2006). Pope described and depicted Hynobius larvae at an advanced stage of development from the Guadun region, Fujian Province: Dorsal fin extends forward past the middle of the back. Body and tail spotted with gray, the spots being most profuse on the tail fins where they often tend to run together. The head is uniformly gray and the external gills are sparsely speckled with the same color. Maximum size 62 mm. Larvae were found in May 1926 in pools in a bamboo grove. First metamorphosed juveniles can be found in July (Pope, 1931) or earlier, from May onward (Fei et al., 2006). The color of recently metamorphosed individuals is dark gray black, densely speckled with small bluish spots (MS pers. observ.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Mitochondrial data suggest that Hynobius yiwuensis is the most basal species in China except Hynobius leechii, which is grouped with Korean and Japanese species (Nishikawa et al. 2010). Fu et al. (2003) reveal the large divergence between the mainland population and the island population (Zhoushan islands) on the basis of mitochondrial and allozyme data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Karyotype:

2n=56, 1M, 2M/SM, 3M/SM, 4ST, 5SM, 6M, 7M, 8SM, 9M, 10SM, 11SM/ST, 12SM, 13M, 14M, 15M, 16M, 17M, 18M, m (19–28), from Ikebe et al. 1998 (misnamed as Hynobius chinensis).

M: metacentric; SM: submetacentric; T: telocentric; ST: subtelocentric; m: micro-chromosome

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Hynobius yiwuensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGATAATCACTCGATGACTATTTTCAACTAATCATAAAGATATTGGCACCCTATATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACTGCCCTGAGTCTATTAATTCGAGCTGAATTAAGCCAGCCCGGGACTCTTCTCGGAGATGACCAAATTTATAATGTTATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATGGTAATACCCGTAATAATTGGGGGGTTTGGGAATTGATTAGTTCCATTAATAATTGGCGCCCCAGATATAGCATTTCCACGTATAAATAATATAAGTTTTTGATTACTACCCCCATCATTTCTTTTATTACTGGCATCATCCGGGGTTGAAGCCGGGGCAGGAACAGGCTGAACCGTTTATCCCCCTTTAGCAGGTAACCTGGCACATGCCGGGGCCTCAGTTGATCTAACAATTTTTTCACTACATTTAGCAGGTATCTCGTCAATTTTAGGGGCAATCAATTTTATTACAACTTCCATCAATATAAAACCACTATCAATATCACAATATCAAACACCTTTATTTGTCTGATCAGTACTGATCACTGCTATTCTTCTTTTGCTTTCTTTACCAGTCCTTGCCGCAGGAATTACAATACTCCTAACAGATCGAAATCTAAATACTACATTCTTTGACCCTGCAGGGGGAGGTGACCCTGTTCTCTACCAGCACTTGTTTTGATTTTTCGGCCACCCGGAGGTTTATATTCTTATTCTTCCTGGATTTGGAATAATTTCCCACATCGTTACATATTACTCAGCAAAAAAAGAGCCGTTTGGCTATATGGGAATAGTATGAGCTATAATATCAATTGGATTATTAGGATTTATTGTCTGAGCCCATCACATATTTACAGTTGATCTTAATGTTGACACACGGGCCTACTTTACATCAGCTACAATAATTATTGCCATCCCTACTGGGGTAAAAGTGTTTAGCTGATTAGCAACTATACATGGAGGATCAATTAAATGAGATGCTGCAATGTTGTGGGCCTTAGGTTTTATCTTCTTATTTACCGTTGGCGGACTAACTGGTATTGTTCTTGCTAATTCATCATTAGATATTGTGTTACATGATACTTATTATGTAGTAGCACATTTTCACTATGTATTATCTATGGGGGCTGTATTTGCCATTATAGGGGGGTTTGTACACTGATTTCCACTGTTCTCAGGGTATACTTTACACTCAACTTGATCAAAAATTCATTTTGGAGTAATATTTATTGGGGTTAATTTAACCTTTTTCCCACAACATTTTCTAGGTCTAGCAGGTATACCACGACGATATTCAGACTACCCTGATGCTTATACACTATGAAACACAGCCTCATCAATTGGGTCATTAATTTCCCTTGTCGCAGTAATTATAATAATATTCATTATCTGAGAAGCATTCTCATCAAAACGTGAAGTATTAACAACTGAATTGAGCTCTACAAATATTGAATGATTATATGGATGTCCCCCACCATACCACACATTTGAAGAGCCATCATATGTTCAAGCCCGAATTTATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hynobius yiwuensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B2ab(iii)

Version
3.1

Year Assessed
2004

Assessor/s
Xie Feng

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Vulnerable because its Area of Occupancy is less than 2,000 km2, its distribution is severely fragmented, and there is continuing decline in the extent and quality of its habitat in Zhejiang Province, China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Listed as vulnerable on the IUCN Red List of Threatened Species (IUCN, 2010). This salamander is common within its range. But population size is decreasing because the breeding and hibernating sites are near crop field, which is polluted by agricultural chemicals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is common in most of its localities.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is threatened by habitat loss, due to clear-cutting, and water pollution (presumably by agrochemicals).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no protected areas within the range of this species, and there is a need for improved protection and maintenance of existing forest habitat in its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yiwu salamander

The Yiwu salamander, Hynobius yiwuensis, is a species of salamander in the Hynobiidae family, endemic to Zhejiang, China. Its distribution area is central and eastern Zhejiang, and includes Yiwu that has given it its name. Its natural habitats are subtropical moist lowland forests, rivers, freshwater marshes, intermittent freshwater marshes, arable land, and rural gardens. The Yiwu salamander is threatened by habitat loss.[1]

Adult males have a total length of 83–136 mm (3.3–5.4 in) and females of about 87–117 mm (3.4–4.6 in).[2] The Yiwu salamander is similar to Chinese salamander (H. chinensis) and somewhat larger Amji's salamander (or Zhejiang salamander, H. amjiensis).[3]

References

  1. ^ a b Xie, Feng (2004). "Hynobius yiwuensis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 15 January 2013. 
  2. ^ Fei, L. (1999). Atlas of Amphibians of China (in Chinese). Zhengzhou: Henan Press of Science and Technology. p. 28. ISBN 7-5349-1835-9. 
  3. ^ Sparreboom, Max (2010). "Hynobius yiwuensis Cai, 1985". Salamanders of the Old World. Retrieved 15 January 2013. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!