Physical Description

Type Information

Holotype for Tethya aurantia californiana de Laubenfels, 1930
Catalog Number: USNM 21495
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): M. de Laubenfels
Year Collected: 1926
Locality: Santa Monica Bay, Carmel, Pescadero Point, California, United States, North Pacific Ocean
  • Holotype: de Laubenfels. Proc. U.S. Natl. Mus. 81(4): 44-45.; de Laubenfels. Proc. U.S. Natl. Mus. 81(4): 44-45, f.20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Tethya aurantia californiana de Laubenfels, 1930
Catalog Number: USNM 21411
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): M. de Laubenfels
Year Collected: 1924
Locality: South Of Breakwater, California, United States, North Pacific Ocean
Depth (m): 53 to 53
  • Paratype: de Laubenfels. Proc. U.S. Natl. Mus. 81(4): 44-45.; de Laubenfels. Proc. U.S. Natl. Mus. 81(4): 44-45, f.20.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 1.25 - 1.25
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 49.65
  Temperature range (°C): 9.967 - 10.151
  Nitrate (umol/L): 6.725 - 7.622
  Salinity (PPS): 31.893 - 32.083
  Oxygen (ml/l): 6.534 - 6.561
  Phosphate (umol/l): 0.943 - 0.968
  Silicate (umol/l): 13.303 - 15.658

Graphical representation

Depth range (m): 0 - 49.65

Temperature range (°C): 9.967 - 10.151

Nitrate (umol/L): 6.725 - 7.622

Salinity (PPS): 31.893 - 32.083

Oxygen (ml/l): 6.534 - 6.561

Phosphate (umol/l): 0.943 - 0.968

Silicate (umol/l): 13.303 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tethya californiana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCAACAAATCATAAAGATATTGGGACTCTTTATTTATTATTTGGGGCATTTGCAGGAATGATAGGAACAGGATTTAGTATGTTAATTAGGCTTGAATTATCTGCTCCTGGCTCAATGTTGGGAGAT---GACCATTTGTATAATGTAATTGTGACAGCTCATGCCTTTGTAATGATATTTTTTTTAGTAATGCCAGTAATGATTGGGGGGTTTGGAAATTGATTTGTGCCATTATATATTGGTGCACCAGATATGGCATTTCCTAGATTAAATAATATAAGTTTTTGGTTATTGCCTCCTTCGTTAACTTTATTATTGGGTTCTGCTTTTGTGGAACAAGGAGCTGGAACTGGGTGGACAGTTTATCCACCTTTAGCAAGTATACAGGCTCATTCAGGAGGATCAGTAGATATGGCAATATTTAGTTTACATTTAGCCGGGATTTCTTCAATTTTAAGTACAATAAATTTTATAACAACAATTTTAAATATGAGGGCACCGGGTATAACAATGGATAGAATGCCACTATTTGTTTGATCAATTTTAGTTACAGTAGTTTTATTATTATTATCTTTACCTGTTTTAGCGGGTGCTATTACAATGCTTCTTACAGACAGAAATTTTAATACAGCATTTTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tethya californiana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!