Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Comprehensive Description

Description

A relatively large, elongate aquatic salamander. All members of the Family Sirenidae (sirens and dwarf sirens) lack hind limbs and eyelids, have a horny beak on the upper and lower jaws, and retain gills throughout life (Martof 1974a b; Petranka 1998). Sirens have four toes on the forelimbs and three gill slits. There is a dorsal fin, restricted to the tail. Adult Siren intermedia attain lengths of 18-69 cm, total length (Petranka 1998). The tail is 28 - 40% of the total length in adults (Martof 1973). Males have enlarged jaw (masseter) muscles which cause the head, posterior to the eyes, to appear swollen. Males are also slightly longer than females. Hatchlings have large, bushy gills and a dorsal fin on the tail which extends onto the trunk region of the body (Martof 1973; Petranka 1998).. Hatchlings are 11 - 11.5 mm total length and the tail is about 19 - 25% of the total length (Martof 1973; Godley 1983). Limb buds are present at hatching (Godley 1983).

The dorsal ground color of adults is variable, ranging from olive green to grayish blue or black. Brown or black spots can be seen scattered on the dorsum of lighter colored individuals. The venter is lighter than the back and white or yellowish flecks may occur on the sides (Martof 1973; Petranka 1998). Hatchlings and juveniles are more brightly colored than adults, having light stripes along the body and yellow or red banding on the head (Martof 1973; Petranka 1998). The bright colors and stripes fade and the dorsal fin on the back is lost as animals age (Petranka 1998).

Two or three subspecies are recognized and can be distinguished based on distribution (see below), size, and coloration. Siren i. intermedia, the eastern lesser siren, is a dark colored form, sometimes having tiny black spots on the dark brown or black dorsum. The venter is also dark, without spots or mottling, and lighter than the dorsum. Maximum length is about 38 cm, and the modal number of costal grooves is 32-33. Siren i. nettingi, the western lesser siren, is olive green to gray with tiny black spots on the dorsum. The venter is also dark with numerous light flecks. Maximum length is 50 cm, with a modal number of 35 costal grooves. Siren i. texana, the Rio Grande siren, is the largest subspecies, reaching 69 cm total length, and having a modal costal groove count of 37. The dorsum is gray to brownish gray with tiny black spots and the venter is light gray. Descriptions from Petranka (1998)

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Martof, B. S. (1974). ''Sirenidae. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 151.1-151.2.
  • Sever, D. M., Rania, L. C. and Krenz, J. D. (1996). ''Reproduction of the salamander Siren intermedia Le Conte with especial reference to oviducal anatomy and mode of fertilization.'' Journal of Morphology, 227, 335-348.
  • Fauth, J. E. and Resetarits, W. J., Jr. (1999). ''Biting in the salamander Siren intermedia intermedia: Courtship component or agonistic behavior?'' Journal of Herpetology, 33, 493-496.
  • Flores-Villela, O., and Brandon, R.A. (1992). ''Siren lacertina (Amphibia: Caudata) in northeastern Mexico and southern Texas.'' Annals of Carnegie Museum, 61, 289-291.
  • Gehlbach, F. R., and Kennedy, S. E. (1978). ''Population ecology of a highly productive aquatic salamander (Siren intermedia).'' Southwestern Naturalist, 23, 423-430.
  • Godley, J. S. (1983). "Observations on the courtship, nests and young of Siren intermedia in southern Florida." American Midland Naturalist, 110, 215-219.
  • Martof, B. S. (1973). ''Siren intermedia Le Conte. Lesser Siren.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 127.1-127.3.
  • Martof, B. S. (1974). ''Siren Linnaeus. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 152.1-152.2.
  • Raymond, L. R. (1991). "Seasonal activity of Siren intermedia in northwestern Louisiana (Amphibia: Sirenidae)." Southwestern Naturalist, 36, 144-147.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in the coastal plain from Virginia to central Florida and eastern Texas in the USA, and adjacent Mexico in northern Tamaulipas and northern Veracruz, and northward in the Mississippi Valley to southern Michigan in the USA.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Siren intermedia, the Lesser Siren, ranges from the Coastal Plains of Virginia to Florida, then westward to southern Texas and northeastern Mexico. Populations extend northward in the Mississippi Valley to Illinois, Indiana, and southwestern Michigan. Geographic isolates occur in northern Indiana, southwest Michigan, northeastern North Carolina, and southeastern Virginia.(Petranka 1998) This range is occupied by three subspecies, they are S. i. intermedia, S. i. nettingi, and S. i. texana. All of these subspecies only vary slightly in physical characteristics such as length and color (Conant and Collins, 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This species occurs in the coastal plain from Virginia to central Florida and eastern Texas in the United States, and adjacent Mexico in northern Tamaulipas and northern Veracruz, and northward in the Mississippi Valley to southern Michigan in the United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Siren intermedia occurs on the Atlantic Coast Plain from Virginia to Florida and west to southern Texas and north eastern Mexico. The range also extends northward in the Mississippi Valley to Illinois, Indiana, and southwestern Michigan. Siren i. intermedia, the eastern lesser siren, ranges from central Alabama to sourtheastern Virginia. Siren i. nettingi, the western lesser siren, occurs from central Texas to Alabama, and northwards up the Mississippi Valley. Siren i. texana, the Rio Grande siren, occurs only in the lower Rio Grande Valley and adjacent areas of northern Mexico. Range information taken from Petranka (1998). Recent studies have suggesed that S. i. texana is not distinct from S. i. nettingi and that all populations from the western portion of the range should be treated as S. i. nettingi (Flores-Villela and Brandon 1992).

Lesser sirens are found in a diversity of permanent and semi-permanent aquatic habitats including swamps, marshes, ditches, canals, sloughs, farm ponds, temporary pools in floodplains, and shallow heavily vegetated ponds with deep sediments into which they burrow. See Petranka, (1998) and references therein.

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Martof, B. S. (1974). ''Sirenidae. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 151.1-151.2.
  • Sever, D. M., Rania, L. C. and Krenz, J. D. (1996). ''Reproduction of the salamander Siren intermedia Le Conte with especial reference to oviducal anatomy and mode of fertilization.'' Journal of Morphology, 227, 335-348.
  • Fauth, J. E. and Resetarits, W. J., Jr. (1999). ''Biting in the salamander Siren intermedia intermedia: Courtship component or agonistic behavior?'' Journal of Herpetology, 33, 493-496.
  • Flores-Villela, O., and Brandon, R.A. (1992). ''Siren lacertina (Amphibia: Caudata) in northeastern Mexico and southern Texas.'' Annals of Carnegie Museum, 61, 289-291.
  • Gehlbach, F. R., and Kennedy, S. E. (1978). ''Population ecology of a highly productive aquatic salamander (Siren intermedia).'' Southwestern Naturalist, 23, 423-430.
  • Godley, J. S. (1983). "Observations on the courtship, nests and young of Siren intermedia in southern Florida." American Midland Naturalist, 110, 215-219.
  • Martof, B. S. (1973). ''Siren intermedia Le Conte. Lesser Siren.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 127.1-127.3.
  • Martof, B. S. (1974). ''Siren Linnaeus. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 152.1-152.2.
  • Raymond, L. R. (1991). "Seasonal activity of Siren intermedia in northwestern Louisiana (Amphibia: Sirenidae)." Southwestern Naturalist, 36, 144-147.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Siren intermedia is an eel-like salamander with a long slender body (18-68 cm long) and a very small dorsal fin that runs from the vent to the tail tip. It has only a pair of front legs; each foot has four toes. The front legs are very reduced and the rear legs are completely absent. The head is rather flattened, and there are bushy external gills located on each side of the head. Siren intermedia varies in coloration from light grayish green to olive or black; there are also small irregular markings (dots) that are visible on lighter colored individuals.

Larvae and juveniles are more brightly marked, with a red band across the nose and along the side of the head.

Other Physical Features: endothermic ; ectothermic ; heterothermic ; bilateral symmetry

  • Petranka, J. 1998. Salamanders of the United States and Canada. Washington D.C.: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 69 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Subspecies INTERMEDIA differs from SIREN LACERTINA in having fewer costal grooves (31-35 vs. 36-40) and in lacking any pronounced light markings (Conant and Collins 1991). They differ also in that size at sexual maturity and egg diameter are larger in LACERTINA than in INTERMEDIA (Flores and Brandon 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits shallow, warm, quiet, sometimes turbid waters with abundant vegetation: swamps, sloughs, ponds, lakes, ditches, and to a lesser degree rivers and streams. It hides among plants and debris by day and burrows into bottom mud if water dries up. The eggs are laid in water in a small pocket or debris-covered cavity in bottom mud.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Siren intermedia will inhabit most any slow and sluggish body of water that is shallow and with plenty of aquatic vegetation, including marshes, ponds, ditches, and canals. In most circumstances they need a permanent or semi-permanent body of water but they are able to move short distances over land if factors are right or stay encased in a cocoon of slime if drought occurs.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds

Wetlands: marsh ; swamp ; bog

  • Conant, R., J. Collins. 1998 (Expanded 3rd Ed.). A Field Guide to Reptiles and Amphibians of Eastern and Central North America. New York, NY: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: It inhabits shallow, warm, quiet, sometimes turbid waters with abundant vegetation: swamps, sloughs, ponds, lakes, ditches, and to a lesser degree rivers and streams. It hides among plants and debris by day and burrows into bottom mud if water dries up. The eggs are laid in water in a small pocket or debris-covered cavity in bottom mud.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Eubanks et al. (2002) observed 15 Siren intermedia moving upstream in a rapid flow of water through a 40-m-long concrete culvert between two ponds. The forelimbs appeared to essential in the movement.

In southeastern Missouri, home ranges of adults overlapped considerably and were highly variable in size, ranging from 1 to 232 square meters (Frese et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Siren intermedia feeds primarily on aquatic invertebrates such as crustaceans, insect larvae, worms, and snails. They will also readily consume young amphibian larvae and their own eggs. Siren intermedia often feeds by gulping large quantities of material at a time, which is filtered through the bronchial openings. Vegetable matter sometimes found in their digestive tracts is probably eaten accidentally.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore , Vermivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats various aquatic invertebrates (crayfish, worms, mollusks) and some plant material. Sometimes eats amphibian eggs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

About 1200 were found frozen in an ice-covered pond in Arkansas (Sugg 1988). Density in southeastern Missouri was 1.35 to 2.17 sirens per square meter (Frese et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Apparently inactive during winter in the north. Active all year in the south except during periods of drought. May remain inactive (burrowed in substrate, in mucous cocoon) for extended periods during drought. Most active in fall and winter and least active in summer in a temporary pond in Louisiana (Raymond 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
6.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The courtship behavior of Siren intermedia has not yet been described. Fertilization has been presumed to be external, since the females lack cloacal sperm storage areas. There is thought to be a lot of aggression during mating due to the amount of scaring from bite marks on both the males and females. Eggs are laid in early spring they are deposited in shallow depressions in the soft bottom of the occupied water body, usually in highly vegetated areas. In these shallow depressions the female will lay from 12 to over 300 eggs; the female may lay multiple clutches through out the season. Freshly laid eggs are dark brown and 2.5-3 mm in diameter. The hatchling larvae are about 1.1 cm in length. (Petranka 1998; Harding 1997)

Average number of offspring: 200.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

  • Conant, R., J. Collins. 1998 (Expanded 3rd Ed.). A Field Guide to Reptiles and Amphibians of Eastern and Central North America. New York, NY: Houghton Mifflin Company.
  • Petranka, J. 1998. Salamanders of the United States and Canada. Washington D.C.: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In South Carolina, oviposition occurs during February-April; fertilization evidently is external (Sever et al. 1996, J. Morphol. 227:335-348). Lays clutch averaging about 200 eggs in winter (e.g., in Louisiana, Raymond 1991) or early spring. Female guards eggs. Sexually mature in 2 years. Paedomorphic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Skin secretion slows desiccation: lesser siren
 

The skin of the lesser siren protects from desiccation by secreting a mucus cocooon.

   
  "The skin of Siren intermedia is fully metamorphosed, amphibian-like, and specialized in its cocoon-producing function. During aestivation in burrows in the bottoms of dry ponds, epidermal and dermal skin glands secrete a cocoon which covers the entire body except the mouth. This structure, remarkably like the cocoons of African lungfishes, retards desiccation and permits sirens to remain in periodically dry, aquatic environments. This adaptive strategy may be alternative to that of avoiding drought by overland movement to nearby water." (Reno et al. 1972:625)
  Learn more about this functional adaptation.
  • Reno, H. W.; Gehlbach, F. R.; Turner, R. A. 1972. Skin and Aestivational Cocoon of the Aquatic Amphibian, Siren intermedia Le Conte. Copeia. 1972(4): 625-631.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Siren intermedia

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBAP1155-10|GQ368661|Siren intermedia| ACCCGATGACTATTTTCAACAAATCATAAAGACATTGGCACCCTATATTTAATTTTCGGTGCATGAGCAGGAATGGTTGGAACAGCCTTA---AGTTTATTAATCCGAGCAGAATTAAGTCAACCAGGAGCACTAATAGGGGAT---GACCAGATCTATAATGTAATTGTAACTGCCCATGCTTTCGTAATAATCTTCTTTATAGTTATACCAATTATAATCGGTGGATTTGGAAATTGATTACTCCCTTTAATA---ATTGGAGCCCCTGATATAGCCTTCCCTCGTATAAATAATATAAGTTTTTGATTACTACCACCATCATTTTTACTACTTCTTGCTTCATCAGGAGTCGAAGCAGGAGCAGGAACCGGATGAACCGTATACCCCCCTCTAGCAGGTAATCTTGCCCATGCAGGAGCATCAGTTGATCTA---ACTATTTTTTCACTTCACTTAGCCGGAGTATCCTCAATTTTAGGTGCAATTAATTTTATTACAACCTCAATTAATATAAAACCTCCATCAATGACACAATATCAAACACCATTATTTGTTTGATCAGTATTAATTACGGCTATTTTATTATTATTATCCTTGCCTGTTCTAGCTGCA---GGAATTACAATGTTATTAACTGACCGAAACCTTAATACTACTTTCTTTGATCCTGCAGGTGGAGGCGATCCTGTGCTGTACCAACACCTATTTTGATTCTTCGGACATCCGGAAGTATATATCCTTATCTTACCCGGCTTTGGCATAATTTCTCATATTGTCACATATTATTCTTCTAAAAAA---GAACCTTTTGGGTATATAGGAATAGTCTGAGCCATAATATCTATTGGTTTATTAGGATTTATCGTATGGGCCCACCATATATTTACTGTAGACTTAA  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Siren intermedia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Gabriela Parra-Olea, David Wake, Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Siren intermedia is extremely rare and possibly extirpated in Michigan but this species is not threatened over most of its range. It could be harmed by chemicals such as Rotenone, which is used as a fisheries management tool and can be fatal to aquatic amphibians such as Siren intermedia. Another factor that may affect the vitality of this species is habitat destruction and the filling in of wetlands.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Field studies are needed to assess the status of this species in Mexico and confirm its existence in northern Veracruz, from where there have been only a few records. It is a common and secure species in many areas in the USA.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Likely relatively stable in extent of occurrence, unknown trend in population size, area of occurrence, and number/condition of occurrences.Field studies are needed to assess the status of this species in Mexico and confirm its existence in northern Veracruz, from where there have been only a few records. It is a common and secure species in many areas in the United States.

Global Long Term Trend: Increase of 10-25% to decline of 50%

Comments: Likely relatively stable in extent of occurrence, unknown trend in population size, area of occurrence, and number/condition of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Courship and mating have not been observed. Fertilization is presumed to be external (Martof 1974; Sever et al. 1996). Sirens are more active in the fall and winter (Raymond 1991), gravid females are found in late winter, and eggs are laid from late winter to early spring (January to March) (Gehlbach and Kennedy 1978; Raymond 1991). The precise timing of mating and egg deposition varies with locality (Raymond 1991). Females lay 151-362 eggs and have been found attending the developing eggs (Gehlbach and Kennedy 1978; Godley 1983). Nests have been found among the roots of water hyacinth, and grass (Spartina) (Godley 1983).

Biting of females by males apparently occurs during the mating season (Godley 1983; Fauth and Resetarits 1999), but bite marks have also been reported on males (Raymond 1991; Fauth and Resetarits 1999). This and the fact that biting also occurs outside of the mating season (on males and females) suggests that there is male-female and male-male aggression; females have not been found to bite other females (Fauth and Resetarits 1999).

When temporary water bodies dry, sirens burrow into soft mud and can aestivate for several months until the ponds fills again (Petranka 1998). Diet of sirens includes a variety of aquatic invertabrates both benthic and pelagic (Petranka 1998). Sirens are locally abundant and densities have been estimatied as 0.9-1.3 sirens/m2(Gehlbach and Kennedy 1978). Sirens are known to vocalize, and they emit barks, yelps, and clicks in intraspecific interactions and also when disturbed (Petranka and references therein 1998).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Martof, B. S. (1974). ''Sirenidae. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 151.1-151.2.
  • Sever, D. M., Rania, L. C. and Krenz, J. D. (1996). ''Reproduction of the salamander Siren intermedia Le Conte with especial reference to oviducal anatomy and mode of fertilization.'' Journal of Morphology, 227, 335-348.
  • Fauth, J. E. and Resetarits, W. J., Jr. (1999). ''Biting in the salamander Siren intermedia intermedia: Courtship component or agonistic behavior?'' Journal of Herpetology, 33, 493-496.
  • Flores-Villela, O., and Brandon, R.A. (1992). ''Siren lacertina (Amphibia: Caudata) in northeastern Mexico and southern Texas.'' Annals of Carnegie Museum, 61, 289-291.
  • Gehlbach, F. R., and Kennedy, S. E. (1978). ''Population ecology of a highly productive aquatic salamander (Siren intermedia).'' Southwestern Naturalist, 23, 423-430.
  • Godley, J. S. (1983). "Observations on the courtship, nests and young of Siren intermedia in southern Florida." American Midland Naturalist, 110, 215-219.
  • Martof, B. S. (1973). ''Siren intermedia Le Conte. Lesser Siren.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 127.1-127.3.
  • Martof, B. S. (1974). ''Siren Linnaeus. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 152.1-152.2.
  • Raymond, L. R. (1991). "Seasonal activity of Siren intermedia in northwestern Louisiana (Amphibia: Sirenidae)." Southwestern Naturalist, 36, 144-147.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
It is unthreatened overall, but many local populations have been reduced or extirpated by loss of wetlands (Petranka 1998). The extent to which flood control has reduced opportunities for dispersal among local populations is unknown (Petranka 1998). Disturbance and alteration of the original habitat is a consequence of the industrial activities and urbanization also a threat to local populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: It is unthreatened overall, but many local populations have been reduced or extirpated by loss of wetlands (Petranka 1998). The extent to which flood control has reduced opportunities for dispersal among local populations is unknown (Petranka 1998). Disturbance and alteration of the original habitat as a consequence of the industrial activities in the area is also a threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Continuing loss of wetlands is a threat to the habitat of lesser sirens (Petranka 1998).
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Martof, B. S. (1974). ''Sirenidae. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 151.1-151.2.
  • Sever, D. M., Rania, L. C. and Krenz, J. D. (1996). ''Reproduction of the salamander Siren intermedia Le Conte with especial reference to oviducal anatomy and mode of fertilization.'' Journal of Morphology, 227, 335-348.
  • Fauth, J. E. and Resetarits, W. J., Jr. (1999). ''Biting in the salamander Siren intermedia intermedia: Courtship component or agonistic behavior?'' Journal of Herpetology, 33, 493-496.
  • Flores-Villela, O., and Brandon, R.A. (1992). ''Siren lacertina (Amphibia: Caudata) in northeastern Mexico and southern Texas.'' Annals of Carnegie Museum, 61, 289-291.
  • Gehlbach, F. R., and Kennedy, S. E. (1978). ''Population ecology of a highly productive aquatic salamander (Siren intermedia).'' Southwestern Naturalist, 23, 423-430.
  • Godley, J. S. (1983). "Observations on the courtship, nests and young of Siren intermedia in southern Florida." American Midland Naturalist, 110, 215-219.
  • Martof, B. S. (1973). ''Siren intermedia Le Conte. Lesser Siren.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 127.1-127.3.
  • Martof, B. S. (1974). ''Siren Linnaeus. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 152.1-152.2.
  • Raymond, L. R. (1991). "Seasonal activity of Siren intermedia in northwestern Louisiana (Amphibia: Sirenidae)." Southwestern Naturalist, 36, 144-147.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in several protected areas. This species is protected by Mexican law under the "Special Protection" category (Pr).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Herbicides used to control aquatic vegetation should be avoided.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

On occasion a Siren might take a fisherman's baited hook, but this would be an uncommon and minor annoyance. These animals are properly considered harmless to human interests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sirens are occasionally used for fish bait, but this species normally attracts little attention from humans. They occupy a predatory niche in shallow freshwater habitats, and have ecological value in the environment.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Relation to Humans

Sirens are sometimes seen in the pet trade.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Martof, B. S. (1974). ''Sirenidae. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 151.1-151.2.
  • Sever, D. M., Rania, L. C. and Krenz, J. D. (1996). ''Reproduction of the salamander Siren intermedia Le Conte with especial reference to oviducal anatomy and mode of fertilization.'' Journal of Morphology, 227, 335-348.
  • Fauth, J. E. and Resetarits, W. J., Jr. (1999). ''Biting in the salamander Siren intermedia intermedia: Courtship component or agonistic behavior?'' Journal of Herpetology, 33, 493-496.
  • Flores-Villela, O., and Brandon, R.A. (1992). ''Siren lacertina (Amphibia: Caudata) in northeastern Mexico and southern Texas.'' Annals of Carnegie Museum, 61, 289-291.
  • Gehlbach, F. R., and Kennedy, S. E. (1978). ''Population ecology of a highly productive aquatic salamander (Siren intermedia).'' Southwestern Naturalist, 23, 423-430.
  • Godley, J. S. (1983). "Observations on the courtship, nests and young of Siren intermedia in southern Florida." American Midland Naturalist, 110, 215-219.
  • Martof, B. S. (1973). ''Siren intermedia Le Conte. Lesser Siren.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 127.1-127.3.
  • Martof, B. S. (1974). ''Siren Linnaeus. Sirens.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 152.1-152.2.
  • Raymond, L. R. (1991). "Seasonal activity of Siren intermedia in northwestern Louisiana (Amphibia: Sirenidae)." Southwestern Naturalist, 36, 144-147.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lesser Siren

The Lesser Siren (Siren intermedia) is a species of aquatic salamander native to the eastern United States and northern Mexico. They are referred by numerous common names, including Two-legged Eel, Dwarf Siren, and Mud Eel. The epithet intermedia denotes their intermediate size, between the Greater Siren, Siren lacertina, and the Dwarf Siren, Pseudobranchus sp.

Contents

Behavior

The Lesser Siren is nocturnal, spending its days hidden in the debris and mud at the bottom of slow moving bodies of water. They feed primarily on aquatic invertebrates, including various kinds of worms, snails, and crustaceans. They will also eat the tadpoles and eggs of other amphibians.

Reproduction occurs in the spring months, with eggs being laid in a shallow depression at the bottom of a calm area of water. Usually surrounded by vegetation. Though little is known about their courtship, it is believed to be quite violent, as many specimens collected have scarring from healed bite marks from other sirens. 12-300 eggs are laid at a time, and several clutches may be laid over the course of the year. Hatchlings are only about 0.4 of an inch (1.1 cm) in length, but grow quickly. Maturity is reached in 3–4 years.

The Lesser Siren is vocal, unlike most salamanders, and will emit a series of clicks when they approach others of their species, or a short screeching sound if handled.

If the habitat dries up during the summer months, Lesser Sirens are capable of excreting a substance from their skin which protects them from dehydrating, and enables them to stay buried in dry mud for months until the water returns. Their small legs enable them to move on dry land for short periods of time.

Geographic distribution

The Lesser Siren is found in the United States, primarily from Virginia to Florida, and west to Texas (ranging into northeastern Mexico as far as Veracruz), and north to Illinois, Indiana and Michigan.

Taxonomy

Sources disagree on the number of subspecies are within Siren intermedia, most agree that there are at least two, an eastern and a western variety. Many sources also include a third subspecies, the Rio Grande Lesser Siren, Siren intermedia texana, but researchers disagree whether the Rio Grande variety belongs as a Lesser Siren, within Siren intermedia, or as a Greater Siren, within Siren lacertina, and some others even consider it to be its own species, as Siren texana.

  • Eastern Lesser Siren, Siren intermedia intermedia (Goin, 1942)
  • Western Lesser Siren, Siren intermedia nettingi (Goin, 1942)
  • Rio Grande Lesser Siren, Siren intermedia texana (Goin, 1957)

Conservation status

The Lesser Siren is quite common through most of its range, but rarely seen due to its secretive nature. Like almost all species of amphibian, it is believed that their numbers are declining due to general reductions in water quality, believed to be caused by agricultural pesticide and fertilizer runoff. They are frequently collected and used as bait for fishing. The species is believed to be extirpated from the state of Michigan, and the S. i. texana subspecies is listed as a threatened species in the state of Texas.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Sugg (1988) for an account of morphological variation in subspecies NETTINGI. Flores-Villela and Brandon (1992) noted the absence of characters that unequivocally diagnose SIREN INTERMEDIA TEXANA; they concluded that subspecies TEXANA is an invalid taxon and placed it in the synonymy of S. I. NETTINGI. However, subsequent studies indicate that the siren in extreme southern Texas that formerly was included in S. INTERMEDIA may be a distinct species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!