Physical Description

Type Information

Holotype for Ulosa ruetzleri Wiedenmayer, 1977
Catalog Number: USNM 24459
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
  • Holotype: Wiedenmayer. 1977. Shallow Water Sponges Of Western Bahamas, Experientia, Suppl.28. 145-147, f.149, pl.30, f.6,7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ulosa ruetzleri Wiedenmayer, 1977
Catalog Number: USNM 24461
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
  • Paratype: Wiedenmayer. 1977. Shallow Water Sponges Of Western Bahamas, Experientia, Suppl.28. 145-147, f.149, pl.30, f.6,7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ulosa ruetzleri Wiedenmayer, 1977
Catalog Number: USNM 24460
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
  • Paratype: Wiedenmayer. 1977. Shallow Water Sponges Of Western Bahamas, Experientia, Suppl.28. 145-147, f.149, pl.30, f.6,7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 4 - 50.2
  Temperature range (°C): 22.044 - 27.075
  Nitrate (umol/L): 0.143 - 1.589
  Salinity (PPS): 35.827 - 36.537
  Oxygen (ml/l): 4.480 - 4.938
  Phosphate (umol/l): 0.006 - 0.132
  Silicate (umol/l): 0.819 - 3.119

Graphical representation

Depth range (m): 4 - 50.2

Temperature range (°C): 22.044 - 27.075

Nitrate (umol/L): 0.143 - 1.589

Salinity (PPS): 35.827 - 36.537

Oxygen (ml/l): 4.480 - 4.938

Phosphate (umol/l): 0.006 - 0.132

Silicate (umol/l): 0.819 - 3.119
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scopalina ruetzleri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCAACAAATCATAAAGATATTGGAACATTATATTTAATATTTGGAGGATGAGCAGGAATAGTAGGGACAGGGTTTAGTATGTTGATAAGATTAGAATTATCGGGGCCAGGGTCAATGTTAGGGGAT---GATCAATTATATAATGTGATAGTAACAGCCCACGCATTTGTAATGATATTTTTCTTAGTAATGCCGGTGATGATAGGGGGGTTTGGGAATTGATTAGTACCATTATATATAGRAGCACCGGATATGGCATTTCCAAGATTAAATAATATAAGTTTTTGACTATTACCACCAGCATTAACATTATTATTAAGTTCAGCATTTGTAGAACAGGGGGCAGGAACAGGATGAACAGTATATCCACCATTGTCAGGGATACAGGCACATTCAGGAGGAGCAGTAGATATGGCGATATTTAGTTTACATTTAGCAGGGATATCATCAATATTAGGAGCAATGAATTTTATAACAACAATAATAAATATGAGAGCACCAGGGATAACAATGGATAGAATGCCATTATTTGTATGATCGATATTAGTAACAGCAGTGTTATTATTATTATCATTACCAGTATTAGCAGGAGGGATAACAATGTTATTAACAGATAGGAACTTTAATACAACATTTTTTGACCCAGCAGGAGGGGGAGACCCAGTACTATTTCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scopalina ruetzleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!