Overview
Distribution
Bahamian, Belize, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Greater Antilles, Gulf of Mexico, Hispaniola, Jamaica, Mexico, Panama, Southern Caribbean, Venezuela, Western Caribbean
-
Wiedenmayer, F. 1977b. Shallow-water sponges of the western Bahamas. Experientia Supplementum 28: 1-287, pls 1-43.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=8586
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Rützler, K.; Díaz, M.C.; van Soest, R.W.M.; Zea, S.; Smith, K.P.; Alvarez, B.; Wulff, J. 2000. Diversity of sponge fauna in mangrove ponds, Pelican Cays, Belize. Atoll Research Bulletin 476: 230-248.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=133567
-
Van Soest, R.W.M. 1981. A checklist of the Curaçao sponges (Porifera Demospongiae) including a pictorial key to the more common reef-forms. Verslagen en Technische Gegevens Instituut voor Taxonomische Zoölogie (Zoölogisch Museum) Universiteit van Amsterdam 31: 1-39.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=138936
-
Miloslavich P, Díaz JM, Klein E, Alvarado JJ, Díaz C, et al. (2010) Marine Biodiversity in the Caribbean: Regional Estimates and Distribution Patterns. PLoS ONE 5(8): e11916. doi:10.1371/journal.pone.0011916
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145466
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Type Information
Holotype for Ulosa ruetzleri Wiedenmayer, 1977
Catalog Number: USNM 24459
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
Catalog Number: USNM 24459
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
- Holotype: Wiedenmayer. 1977. Shallow Water Sponges Of Western Bahamas, Experientia, Suppl.28. 145-147, f.149, pl.30, f.6,7.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Paratype for Ulosa ruetzleri Wiedenmayer, 1977
Catalog Number: USNM 24461
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
Catalog Number: USNM 24461
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
- Paratype: Wiedenmayer. 1977. Shallow Water Sponges Of Western Bahamas, Experientia, Suppl.28. 145-147, f.149, pl.30, f.6,7.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Paratype for Ulosa ruetzleri Wiedenmayer, 1977
Catalog Number: USNM 24460
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
Catalog Number: USNM 24460
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): F. Wiedenmayer
Locality: Bimini Islands, Bahamas, North Atlantic Ocean
- Paratype: Wiedenmayer. 1977. Shallow Water Sponges Of Western Bahamas, Experientia, Suppl.28. 145-147, f.149, pl.30, f.6,7.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 4 - 50.2
Temperature range (°C): 22.044 - 27.075
Nitrate (umol/L): 0.143 - 1.589
Salinity (PPS): 35.827 - 36.537
Oxygen (ml/l): 4.480 - 4.938
Phosphate (umol/l): 0.006 - 0.132
Silicate (umol/l): 0.819 - 3.119
Graphical representation
Depth range (m): 4 - 50.2
Temperature range (°C): 22.044 - 27.075
Nitrate (umol/L): 0.143 - 1.589
Salinity (PPS): 35.827 - 36.537
Oxygen (ml/l): 4.480 - 4.938
Phosphate (umol/l): 0.006 - 0.132
Silicate (umol/l): 0.819 - 3.119
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 4 - 50.2
Temperature range (°C): 22.044 - 27.075
Nitrate (umol/L): 0.143 - 1.589
Salinity (PPS): 35.827 - 36.537
Oxygen (ml/l): 4.480 - 4.938
Phosphate (umol/l): 0.006 - 0.132
Silicate (umol/l): 0.819 - 3.119
Graphical representation
Depth range (m): 4 - 50.2
Temperature range (°C): 22.044 - 27.075
Nitrate (umol/L): 0.143 - 1.589
Salinity (PPS): 35.827 - 36.537
Oxygen (ml/l): 4.480 - 4.938
Phosphate (umol/l): 0.006 - 0.132
Silicate (umol/l): 0.819 - 3.119
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Scopalina ruetzleri
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TCAACAAATCATAAAGATATTGGAACATTATATTTAATATTTGGAGGATGAGCAGGAATAGTAGGGACAGGGTTTAGTATGTTGATAAGATTAGAATTATCGGGGCCAGGGTCAATGTTAGGGGAT---GATCAATTATATAATGTGATAGTAACAGCCCACGCATTTGTAATGATATTTTTCTTAGTAATGCCGGTGATGATAGGGGGGTTTGGGAATTGATTAGTACCATTATATATAGRAGCACCGGATATGGCATTTCCAAGATTAAATAATATAAGTTTTTGACTATTACCACCAGCATTAACATTATTATTAAGTTCAGCATTTGTAGAACAGGGGGCAGGAACAGGATGAACAGTATATCCACCATTGTCAGGGATACAGGCACATTCAGGAGGAGCAGTAGATATGGCGATATTTAGTTTACATTTAGCAGGGATATCATCAATATTAGGAGCAATGAATTTTATAACAACAATAATAAATATGAGAGCACCAGGGATAACAATGGATAGAATGCCATTATTTGTATGATCGATATTAGTAACAGCAGTGTTATTATTATTATCATTACCAGTATTAGCAGGAGGGATAACAATGTTATTAACAGATAGGAACTTTAATACAACATTTTTTGACCCAGCAGGAGGGGGAGACCCAGTACTATTTCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Scopalina ruetzleri
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
