Overview

Comprehensive Description

Description

Ambystoma laterale is a slender salamader that resembles the species A. jeffersonianum, although the former exhibits a smaller size (7.6-12.9 cm in length), narrower snout and darker color. A. laterale typically possesses a dorsal coloring of grayish-black to bluish black. The lower sides of this species may also display large bluish-white flecks. The stomach is usually fleckled and lighter in color, with the ventral mostly black.
 
This species account was based off the information in the National Audubon Society Field Guide to North American Reptiles and Amphibians (1996) .
  • Behler, J.L. and King, F.W. (1996). National Audubon Society Field Guide to North American Reptiles and Amphibians. Knopf, New York, NY.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in North America from southeastern Quebec to Lake Winnipeg, south through Great Lakes region and New England to northern Indiana and New Jersey. Several apparently disjunctive populations occur around the periphery of the range (e.g., see Brownlie [1988] for Nova Scotia record). Hybridises with A. jeffersonianum over a large area south of this range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Blue-spotted salamanders are found from eastern central North America and stretch in a broad band across to the Atlantic Provinces and northern New England. They are found around the Great Lakes and west as far as central Manitoba. They reach as far north as James Bay, Ontario (Collicutt 1999).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Southeastern Quebec to Lake Winnipeg, south through Great Lakes region and New England to northern Indiana and New Jersey. Several apparently disjunct populations occur around the periphery of the range (e.g., see Brownlie [1988] for Nova Scotia record). Hybridizes with A. JEFFERSONIANUM over a large area south of this range. See Nyman et al. (1988) for distribution in New Jersey.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

The species is concentrated near the Great Lakes, and ranges along the Atlantic from New Jersey to Quebec, Canada. The deciduous forests are ideal locations for observing A. laterale in its natural habitat.
  • Behler, J.L. and King, F.W. (1996). National Audubon Society Field Guide to North American Reptiles and Amphibians. Knopf, New York, NY.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Length: 10-14cm.

Blue-spotted salamanders have a long tail that is approximately 40% of its body length (Collicutt 1999). The salamander's tail is broadly oval at the base and compressed towards the tip. It is fleshier than A. jeffersonianum (Minton 1972). They also have a slimmer body than the tiger salamander A. tigrinum (Collicut 1999). Their feet have relatively long toes (Conant and Collins 1998). They are given their name for the bluish-white spots and flecks on the tides of the trunk and tail and also sometimes on the back. Their skin is bluish-black (Conant and Collins 1998). The spots are also on their limbs and belly (Harding 1997). The belly may be either black or a lighter shade than the dorsum, but the vent is usually black (Harding 1997). There is some slight size difference between the males and the females. The males tend to be slightly smaller than the females, the males also have a longer more flattened tail (Harding 1997). The larvae of blue-spotted salamanders vary in appearance. When the larvae are small and relatively young they have broad tail fins and external gills for living in the water (Collicutt 1999). But once they have developed all four legs they appear to be dark brown, olive or gray on the upper surface with dark mottling on the fail fins. They also may have dull yellow blotches on the dorsum or yellowish stripes down each side of the back. The belly is lighter and unmarked (Harding 1997).

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In New England and New Jersey, generally associated with lowland swamps and marshes and surrounding uplands with sandy or loamy soils (Nyman et al. 1988, Klemens 1993). Can occur in overgrown pastures. Adults usually under are objects or underground. Eggs are attached to submerged sticks or bottom of shallow forest ponds and pools. At Isle Royale, Michigan, breeds in splash pools on exposed rocky shorelines (Van Buskirk and Smith 1991). In northern Minnesota, successful reproduction in acidic bog water either does not occur or is a rare event (Karns 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The blue-spotted salamander lives in deciduous and coniferous forests. They are most abundant in moist woodlands with sandy soil. They differ from other salamanders in that they are found above ground throughout the warmer months (Harding 1997). During the day they stay undercover out of the direct sunlight. They spend the summer and fall in damp forests, searching for food at night (Nova Scotia 1999).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In New England and New Jersey, generally associated with lowland swamps and marshes and surrounding uplands with sandy or loamy soils (Nyman et al. 1988, Klemens 1993). in overgrown pastures. Adults usually under are objects or underground. Eggs are attached to submerged sticks or bottom of shallow forest ponds and pools. At Isle Royale, Michigan, breeds in splash pools on exposed rocky shorelines (Van Buskirk and Smith 1991). In northern Minnesota, successful reproduction in acidic bog water either does not occur or is a rare event (Karns 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates up to several hundred meters between breeding pools and summer range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Blue-spotted salamander is a carnivore. The adult eats worms, snails, slugs, insects, centipedes, spiders and other invertebrates. The larvae eat small aquatic invertebrates such as water fleas (cladocerans), copepods, insects and insect larvae, especially mosquito larvae (Harding 1997). The diet suggests that the feeding ground is beneath leaf litter in forests (Collicut 1999). In captivity, blue-spotted salamanders survive on 1 worm a week (Collicut 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Metamorphosed individuals eat snails, earthworms, beetles, beetle larvae, springtails, spiders, and other small invertebrates. Larvae eat small aquatic animals (zooplankton and benthic invertebrates).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Ambystoma laterale (Ambystoma laterale, A. maculatum A. tremblayi) preys on:
Daphnia pulex
Gastropoda
Bivalvia
Acilius
Chaoborus

Based on studies in:
USA: Michigan (Lake or pond)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Ambystoma laterale (Ambystoma laterale, A. maculatum A. tremblayi) is prey of:
Ambystoma tigrinum
Batracobdella picta

Based on studies in:
USA: Michigan (Lake or pond)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Number of occurrences of pure A. laterale is uncertain, but there are many.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but likely exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Van Buskirk and Smith (1991) for evidence of density-dependent population regulation in a population at Isle Royale, Michigan (increasing larval density in breeding pools resulted in reduced survival and growth, probably due to interference).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Inactive late fall through most of winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The life span of a blue-spotted salamander is unknown (Collicutt 1999). Both male and females reach maturity at about 2 years of age (Harding 1997). The salamander breeds in woodland ponds and ditches (Conant and Collins 1998). They breed in April in small ponds. The female lays as many as 500 eggs individually at bases of sticks, plants or rocks. The eggs take about 1 month to hatch, and when they hatch they have well-developed eyes, mouth, external gills, and broad tail fins. At two weeks old, the front legs form and at 3 weeks the hind limbs are formed. As they get older they look like tiny adult salamanders except they have broad tail fins and external gills. Between 3-5cm in length they transform into the adult form and leave the pond. When they transform they loose their external gills and tail fins and develop the adult coloration (Collicut 1999). They transform in late summer (CCIW 1999).

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians in the Eastern/Central North America. New York: Houghton Mifflin Company.
  • Minton, S. 1972. Amphibians and Reptiles of Indiana. Indiana: The Indiana Academy of Science.
  • Collicutt, D. 1999. "Nature North Zone" (On-line). Accessed November 6, 1999 at www.pangea.ca/nnz/spring/creature/bluespot/Fblspot.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In most areas, eggs are laid in March-April (early May at Isle Royale, Michigan), singly or in clusters of up to about 35; up to 500 eggs per female. Metamorphosis late June through August, or larvae may overwinter. Aggregates when breeding.

Hybrid offspring are the result of gynogenetic or hybridogenetic reproduction (Bogart and Klemens 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambystoma laterale

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0416-06|NC_006330|Ambystoma laterale| ACTCGATGACTATTTTCTACAAATCATAAAGATATTGGCACCCTTTACTTAGTGTTTGGTGCCTGAGCCGGAATAGTTGGCACTGCACTA---AGCCTTTTAATCCGAGCAGAACTAAGTCAACCCGGAGCTTTACTAGGTGAT---GACCAAATCTACAATGTTATTGTAACCGCACATGCATTTGTAATAATCTTTTTTATAGTTATGCCTGTAATAATCGGGGGATTCGGAAACTGACTGGTACCACTAATA---ATTGGTGCGCCAGATATGGCCTTTCCGCGTATGAATAATATAAGCTTTTGACTTTTACCTCCATCATTCCTCCTTTTATTAGCTTCCTCAGGAGTTGAGGCGGGCGCCGGAACAGGATGAACTGTCTATCCACCACTTGCTGGTAACTTAGCTCATGCTGGTGCTTCAGTTGACTTA---ACAATTTTTTCATTACATTTAGCAGGTGTCTCGTCTATTTTAGGTGCAATTAATTTTATTACGACTTCAATTAATATAAAACCAGCATCTATGTCTCAATATCAAACCCCATTATTTGTGTGATCAGTATTAATTACAGCAGTTTTACTACTACTTTCCCTCCCTGTATTAGCAGCA---GGAATTACAATACTTTTAACTGATCGAAACTTAAACACAACATTTTTTGATCCGGCTGGTGGGGGGGATCCAGTTCTTTACCAACATTTATTTTGATTTTTTGGACACCCAGAAGTATATATCTTAATTCTTCCCGGATTCGGAATAATTTCACATATTGTGACTTATTATTCTGCAAAAAAA---GAGCCATTTGGCTATATAGGAATAGTATGAGCTATAATATCTATTGGACTTCTAGGATTTATTGTATGAGCGCACCATATATTTACAGTAGATTTAA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ambystoma laterale

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 16
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Due to the loss of wetlands and the destruction of forests, the salamanders are threatened. However, there is no evidence of decline in the blue-spotted salamander as of yet (CCIW 1999). Blue-spotted salamanders are more tolerant to human disturbances than other salamanders. They still persist in fragmented forests (Harding 1997).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total adult population size is unknown, but it likely exceeds 100,000.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Global Long Term Trend: Increase of 10-25% to decline of 50%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The breeding season lasts from March to April of each year, where the females lay eggs in either masses of 6-10 at a time, or singly. The eggs are usually laid on debris located at the bottom of ponds.
  • Behler, J.L. and King, F.W. (1996). National Audubon Society Field Guide to North American Reptiles and Amphibians. Knopf, New York, NY.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The biggest threat is loss and degradation of habitat as a result of conversion to agricultural and urban use. Roads negatively impact salamander abundance in roadside habitat (deMaynadier and Hunter 2000). Increased acid deposition is a potential threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Biggest threat is loss and degradation of habitat as a result of coversion to agricultural and urban use. Roads negatively impact salamander abundance in roadside habitat (deMaynadier and Hunter 2000). Increased acid deposition is a potential threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species would benefit from increased protection of lowland forested wetlands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Several to very many (4 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Blue-spotted salamanders consume many mosquitoes each year (Harding 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue-spotted Salamander

IC Ambystoma laterale.JPG

The blue-spotted salamander, or Ambystoma laterale, is a mole salamander native to the Great Lakes states and northeastern United States, and parts of Ontario and Quebec in Canada. Their range is known to extend to James Bay to the north, and southeastern Manitoba to the west.

Contents

Description

These salamanders are between 8 and 14 cm in length, of which the tail comprises 40%. Their skin is bluish-black, with characteristic blue and white flecks on its back, and bluish-white spots on the sides of its body and tail. They have an elongated body, though they are not nearly as slender as the Jefferson salamander. The vent is typically black, which contrasts with the paler belly. Larvae which have transformed may have yellow splotches; these turn blue once the individual becomes terrestrial. Occasionally, a melanistic individual may be found in the wild.

They have long toes: four on the front feet, and five on the hind feet. Typically, specimens will have 12-14 costal grooves. Males tend to be smaller than females, though they have longer, flattened tails.

Habitat

Blue-spotted salamanders are primarily found in moist, deciduous hardwood forests and swampy woodlands, though they can be found in coniferous forests and fields too. They prefer vernal pools that retain water into mid-summer, to ensure access to a suitable breeding habitat. Underbrush, leaf litter, rocks and logs are commonly used for shelter.

Reproduction

Eggs are laid in small agglomerations attached to twigs, rocks or plants at the edge of a woodland pond or ditch. Clutches average a dozen eggs, and females may lay up to 500 eggs yearly. Males and females first mate when two years old. Breeding occurs in early spring near vernal pools.

Eggs take about one month to hatch. At hatching, larvae have a well-developed mouth and eyes. Front limbs form at two weeks, and hind limbs form at three weeks. It will fully transform to its terrestrial state by late summer.

Blue-spotted salamanders are known to be associated with unisexual (all-female) populations of ancient origin (Ki and Bogart, 2010). The unisexual females often look like blue-spotted salamanders but have hybrid genomes (Bogat et al., 2009) and require sperm from a co-occurring, related species to fertilize their eggs and initiate development. Usually the eggs (Bi et al., 2008) then discard the sperm genome and develop asexually (i.e., gynogenesis, with premeiotic doubling); however, they may incorporate the genome from the sperm into the resulting offspring (Bogart et al., 2007). Sperm incorporation commonly (Bi et al., 2008) takes the form of genome addition (resulting in ploidy elevation in the offspring), or genome replacement, wherein one of the maternal genomes is discarded. This unique mode of reproduction has been termed kleptogenesis by Bogart and his colleagues (Bogart et al., 2007).

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Silvery Salamander

The Silvery Salamander (Ambystoma platineum or JJL) is a member of the Mole salamander (Ambystomidae) genus. It is usually between 5.5 – 7.75 in (12 – 19.9 cm) long and is slender with many small silvery-blue spots on its back and sides. It is brownish gray and the area around its vent is grey. The silvery salamander a unisexual Ambystoma hybrid species, taking genetic material from both the Jefferson salamander (A. jeffersonianum) and the blue-spotted salamander (A. laterale), having two sets of chromosomes from the Jefferson salamander and one set from the blue-spotted. A similar unisexual Ambystomid, Tremblay's Salamander (Ambystoma tremblayi or JLL), also exists, having two sets from the blue-spotted and one from the Jefferson's.

While formally named, the silvery salamander is most often referred to by its genomic components (JJL) rather than as Ambystoma platineum in scientific literature.

Contents

Behaviour

Lacking its own males, the Silvery Salamander breeds with male Blue-Spotted or Jefferson Salamanders from March to April. The males' spermatophores only stimulate egg development; their genetic material does not contribute to the offspring's DNA. This mode of reproduction is called kleptogenesis.[1] The females lay cylindrical egg masses and attach them to underwater twigs. It is not often observed and its diet and lifestyle are unknown.

Habitat and range

These salamanders live almost anywhere between south-central Michigan to adjacent Indiana and Ohio to western Massachusetts south to northern New Jersey. They are commonly found in or near shallow rivers and ponds in deciduous forest. There is a extremely limited population of the salamanders in Vermilion County, Illinois with only one remaining natural population known. They are considered endangered within the state. Theory states that the population may have dropped due to the vernal pool in which they live not retaining water for a long enough period for their tadpoles to reach metamorphosis.[2]

Predators

The Silvery Salamander's predators range from birds, fish, raccoons, and dogs.

Diet

Their diet is mainly slugs, ants, spiders, soft insects, and worms.

See also

References

  1. ^ Unisexual Salamander Complexes
  2. ^ Illinois Natural History Survey
  • National Audubon Society Field Guide to Reptiles and Amphibians


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Ambystoma jeffersonianum and A. laterale comprise a complex that includes pure bisexual diploid populations and populations that may be represented by bisexual diploid individuals, female hybrids with several different combinations of parental chromosomes (including diploids, triploids, tetraploids, and pentaploids), and/or rare male hybrids. Up to at least five different chromosomal combinations have been found at a single site.

In response to the nomenclatural difficulties presented by this complex, an informal system of indicating ploidy and chromosomal makeup has been recommended (Bogart and Klemens 1997). For example, the "LLLJ" designation (or "A. (3) laterale-jeffersonianum") indicates a tetraploid salamander with three sets of laterale chromosomes and one set of jeffersonianum chromosomes. For convenience, all populations including pure laterale (LL) and laterale-dominated genomes (e.g., LLJ) might be included in the species A. laterale (e.g., Klemens 1993).

However, biological complexities confound such a simple treatment. Polyploid hybrid individuals in the complex may produce offspring with diverse chromosomal makeup. For example, an LLJ female can produce offspring that do not have laterale-dominated genomes (e.g., LJJ). And single clutches have been documented with both diploid and triploid embryos. It is even possible for a triploid hybrid to produce pure diploid offspring (e.g., LL or JJ).

Truly intermediate hybrids with equal chromosomal representation (i.e., LJ, LLJJ) are uncommon and are but two of many possible outcomes of hybridization. In New England and New York, hybrids are more common than are the bisexual species, but bisexuals usually (or are presumed to) exist in low numbers in populations composed mostly of hybrids (Bogart and Klemens 1997). Thus, for example, a pond with triploid LLJ should also have at least some LL.

Hybrid populations are maintained by breeding between a hybrid female and a male of one of the diploid bisexual species, and the hybrid offspring are the result of gynogenetic or hybridogenetic reproduction (Bogart and Klemens 1997). In gynogenetic reproduction, male sperm stimulates egg development, but the male genome is not incorporated into the zygote. In hybridogenetic reproduction, the male genome is incorporated, "but upon maturity of the offspring, the paternal genome is eliminated in a meiotic or pre-meiotic event while the rest of the hybrid's genome is passed on to future generations, usually in an altered state" (Bogart and Klemens 1997).

Thus, recent work on hybrid phenomena in these salamanders indicates that the species names "A. platineum" (= LJJ) or "A. tremblayi" (= LLJ) formerly used for the A. jeffersonianum-A. laterale hybrids are inappropriate because LJJ and LLJ are not strictly gynogenetic triploid lineages. Consequently, a recent checklist (Crother et al. 2000) did not recognize either A. platineum or A. tremblayi as valid species.

To accommodate the genetic variation in these salamanders (and the often uncertain genetic composition of particular populations), we have established for this database the following elements: (1) Ambystoma jeffersonianum (JEFFERSON SALAMANDER), used for pure populations only; (2) Ambystoma laterale (BLUE-SPOTTED SALAMANDER), used for pure populations only; (3) Ambystoma HYBRID POP 1 (JEFFERSONIANUM X LATERALE; JEFFERSONIANUM GENOME DOMINATES), used for hybrid populations dominated by the jeffersonianum genome (e.g., populations that include mainly LJJ individuals); this element includes "Ambystoma platineum"; (4) Ambystoma HYBRID POP 2 (JEFFERSONIANUM X LATERALE; LATERALE GENOME DOMINATES), used for hybrid populations dominated by the laterale genome (e.g., populations that include mainly LLJ individuals); this element includes "Ambystoma tremblayi"; (5) AMBYSTOMA POP 3 (JEFFERSONIANUM/LATERALE COMPLEX - UNCERTAIN COMPOSITION), used for populations for which chromosomal representation is unknown. If needed we could establish additional elements for hybrid populations that involve A. laterale, A. texanum, and/or A. tigrinum.

See Kraus (1985), Bogart and Licht (1987), Bogart et al. (1987), Kraus et al. (1991), Lowcock et al. (1991), and Bogart and Klemens (1997) for information on the involvement of A. JEFFERSONIANUM in hybridization with A. TEXANUM, A. TIGRINUM, and/or A. LATERALE. See Lowcock et al. (1987) and Bogart and Klemens (1997) for discussions of nomenclatural treatment of hybrid populations.

See Kraus (1988), Shaffer et al. (1991), and Jones et al. (1993) for phylogenetic analyses of North American Ambystoma.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!