Overview

Distribution

Range Description

This species is widespread on the western flank of the eastern Andes, and the eastern flank of the central Andes, in Colombia, between 350 and 1,200m elevation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It occurs in tropical humid, dry and very dry forests, on the lowest stratum of the forests, in the Caribbean and Andean region. The eggs are terrestrial and the adults then carry the tadpoles to temporary pools, where the tadpoles develop further. It is also known from disturbed habitats such as banana plantations, although it does require that the habitat be not entirely cleared.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrobates truncatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTCTATTTAGTGTTTGGGGCATGAGCCGGAATAGTCGGTACAGCCCTCAGCCTTTTAATTCGAGCAGAGTTAAGCCAGCCTGGCGCTCTTCTGGCCGAC---GATCAAATCTACAATGTAATCGTCACTGCTCATGCCTTTGTAATAATCTTTTTTATAGTAATACCCATTCTAATTGGGGGATTTGGAAACTGACTTGTCCCTCTAATAATTGGAGCCCCAGACATAGCCTTCCCTCGTATAAACAATATAAGCTTCTGACTACTCCCCCCGTCTTTTCTGCTACTCTTGGCTTCAGCCGGGGTCGAAGCCGGAGCTGGAACAGGCTGAACTGTTTATCCTCCCCTCGCAGGAAACTTAGCTCATGCTGGCCCATCTGTAGACTTAACCATTTTTTCCCTCCACTTAGCCGGAGTCTCATCTATTTTAGGGGCAATCAATTTTATTACTACAACCCTCAACATAAAACCCCCCTCTTTAACACAATACCAAACCCCCCTATTTGTCTGATCCGTATTAATTACAGCTGTACTACTCCTTCTCTCCTTGCCAGTTCTAGCTGCAGGCATCACTATACTCCTTACTGATCGAAACTTAAACACCACCTTTTTCGACCCTGCCGGAGGTGGCGACCCAGTTCTTTACCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrobates truncatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Fernando Castro, John Lynch

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a very common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species was popular in the pet trade but is now listed by CITES. It is very difficult to breed in captivity. There are no major threats to the species at present. It could be threatened by the pet trade if the CITES status was lifted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The range of the species includes at least two protected areas on the Atlantic Coast. It is listed on Appendix II of CITES. Maintaining the CITES listing of this species is necessary to ensure its survival.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow-striped poison frog

The yellow-striped poison frog (Dendrobates truncatus) is a species of frog in the Dendrobatidae family. It is endemic to Colombia. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, intermittent freshwater marshes, and plantations.

References[edit]

  1. ^ Castro, F. & Lynch, J. (2004). Dendrobates truncatus. 2006 IUCN Red List of Threatened Species. Downloaded on 21 July 2007.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!