Overview

Comprehensive Description

Description

Males 32-51 mm, females 33-60 mm (Wright and Wright 1949). In general, these frogs have warty skin and prominent adhesive pads on their fingers and toes (Johnson 1987). Their color can vary from green to light green-gray, gray, brown or dark brown (Johnson 1987). Usually, a large irregular star or spot appears on the back (Wright and Wright 1949) A large white spot is always present below each eye (Johnson 1987), although it is less visible and more of an olive color in females (Wright and Wright 1949). The belly is white (Johnson 1987). Males have pale flesh-colored vocal sacs (Wright and Wright 1949). In males, the chin is similar to the belly, with blackish spots (Wright and Wright 1949). In males, the legs are yellow or orange-yellow ventrally. (Johnson 1987), whereas in females, the back of the forelegs, hindlegs and sides are a pale olive gray (Wright and Wright 1949).

The tadpole is approximately 50 mm long, with a long tail. The coloration is scarlet or orange vermilion with black blotches around the edge of the crests (Wright and Wright 1949).

Hyla versicolor is the sibling species of Hyla chrysoscelis (Cope's Gray Treefrog). These two species are indistinguishable based on external morphology (Conant and Collins 1991). Distinction can be made on the basis of the calls, erythrocyte (red blood cell) size (Matson 1990), and chromosomal complement (Conant and Collins 1991). H. versicolor is a genetic tetraploid, whereas H. chrysoscelis is diploid. The precise distribution of each species is not well established (Conant and Collins 1991). In many areas, these two species live sympatrically (occuring together), and if they do, these species may interbreed (Bartlett and Bartlett 1999).

Perhaps the most striking feature of this frog is its ability to change color to match its environment (metachrosis) - a process which usually requires about half an hour (Logier 1952).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Wright, A. H. and Wright, A. A. (1949). Handbook of Frogs and Toads of the United States and Canada. Comstock Publishing Company, Inc., Ithaca, New York.
  • Johnson, T.R. (1977). The Amphibians of Missouri. University of Kansas Publications, Lawrence, KS.
  • Bartlett, R. D., and Bartlett, P. P. (1999). A Field Guide to Texas Reptiles and Amphibians. Gulf Publishing Company, Houston, Texas.
  • Cook, F. R. (1984). Introduction to Canadian Amphibians and Reptiles. National Museums of Canada, Ottawa, Canada.
  • Johnson, J. R., and Semlitsch, R. D. (2003). ''Defining core habitat of local populations of the Gray Treefrog (Hyla versicolor) based on choice of oviposition sites.'' Oecologica, 137, 205-210.
  • Johnson, P. T. J., and Hartson, R. B. (2008). ''All hosts are not equal: explaining differential patterns of malformations in an amphibian community.'' Journal of Animal Ecology, 78, 191-201.
  • Logier, E. B. S. (1952). The Frogs, Toads and Salamanders of Eastern Canada. Clarke, Irwin & Company Ltd., Canada.
  • Matson, T. O. (1990). ''Erythrocyte size as a taxonomic character in the identification of Ohio Hyla chrysoscelis and H. versicolor.'' Herpetologica, 46, 457-462.
  • Oldfield, B. and Moriarty, J. J. (1994). Amphibians and Reptiles Native to Minnesota. University of Minnesota Press, Minneapolis.
  • Relyea, R. A., and Mills, N. (2001). ''Predator-induced stress makes the pesticide carbaryl more deadly to grey treefrog tadpoles (Hyla versicolor) .'' Proceedings of the National Academy of Sciences, 98, 2491-2496.
  • Schmid, W. D. (1982). ''Survival of frogs in low temperature.'' Science, 215, 697-698.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Both gray treefrog species, Hyla versicolor and Hyla chrysoscelis, inhabit a wide range from southern Ontario and Maine, westward to central Texas, northwest to Manitoba, and northern Florida. An isolated colony is also noted in New Brunswick. The two species appear physically identical, and consequently more studies are necessary to delineate where the species overlap.

Generally, the eastern gray treefrog (H. versicolor) is mostly found to the north and northeast of the range. However, the gray treefrog species are extremely variable in their distribution pattern. For instance, the eastern gray treefrog is common in the eastern Great Lakes region, including southern Michigan; however, both species: H. versicolor and H. chrysoscelis share the same breeding ponds in Wisconsin and northern Michigan.

Biogeographic Regions: nearctic (Native )

  • Collins, J., R. Conant. 1998. A Field Guide to Reptiles and Amphibians of East Central North America. 3rd edition, expanded. New York: Houghton Mifflin Co.
  • Harding, . 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, Michigan: University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

This species' geographic range is not precisely determined, although it covers much of the eastern USA and southeastern Canada. It is sympatric with H. chrysoscelis in Wisconsin, south-central U.S., and probably many other areas. See Little et al. (1989) for distribution in West Virginia, southern Ohio, and southwestern Pennsylvania. See McAlpine et al. (1991) for information on distribution in eastern Maine and southwestern New Brunswick.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Eastern Gray Treefrogs are only native to the Nearctic region. They can be found throughout the eastern United States and southern Ontario, but are not present in southern Florida or Maine. Their range extends westward to Texas, Oklahoma, Kansas, Nebraska, and North and South Dakota.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Hyla versicolor can be found in Maine, southern Canada (west to Manitoba), Minnesota, South Dakota, southern Kansas, Oklahoma, the Gulf States and northern Florida. It can also be found in parts of Texas and Arkansas (Wright and Wright 1949).

In Canada, the frog occurs in southern Quebec, southern, central and northwestern Ontario and south-eastern and central Manitoba. There is also an isolated population in Fredericton, New Brunswick (Cook 1984).

This treefrog is found in small wood lots, in trees along prairie streams, in large tracks of mixed hardwood forest, and in the bottomland forests along rivers and swamps (Johnson 1987).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Wright, A. H. and Wright, A. A. (1949). Handbook of Frogs and Toads of the United States and Canada. Comstock Publishing Company, Inc., Ithaca, New York.
  • Johnson, T.R. (1977). The Amphibians of Missouri. University of Kansas Publications, Lawrence, KS.
  • Bartlett, R. D., and Bartlett, P. P. (1999). A Field Guide to Texas Reptiles and Amphibians. Gulf Publishing Company, Houston, Texas.
  • Cook, F. R. (1984). Introduction to Canadian Amphibians and Reptiles. National Museums of Canada, Ottawa, Canada.
  • Johnson, J. R., and Semlitsch, R. D. (2003). ''Defining core habitat of local populations of the Gray Treefrog (Hyla versicolor) based on choice of oviposition sites.'' Oecologica, 137, 205-210.
  • Johnson, P. T. J., and Hartson, R. B. (2008). ''All hosts are not equal: explaining differential patterns of malformations in an amphibian community.'' Journal of Animal Ecology, 78, 191-201.
  • Logier, E. B. S. (1952). The Frogs, Toads and Salamanders of Eastern Canada. Clarke, Irwin & Company Ltd., Canada.
  • Matson, T. O. (1990). ''Erythrocyte size as a taxonomic character in the identification of Ohio Hyla chrysoscelis and H. versicolor.'' Herpetologica, 46, 457-462.
  • Oldfield, B. and Moriarty, J. J. (1994). Amphibians and Reptiles Native to Minnesota. University of Minnesota Press, Minneapolis.
  • Relyea, R. A., and Mills, N. (2001). ''Predator-induced stress makes the pesticide carbaryl more deadly to grey treefrog tadpoles (Hyla versicolor) .'' Proceedings of the National Academy of Sciences, 98, 2491-2496.
  • Schmid, W. D. (1982). ''Survival of frogs in low temperature.'' Science, 215, 697-698.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Range includes southeastern Canada from southern Manitoba to New Brunswick (Weller 2002), and southward through the northeastern and south-central United States to North Carolina, West Virginia, Ohio, Indiana, Kentucky, Illinois, Tennessee, eastern Texas, and southwestern Louisiana, and west to North Dakota, Minnesota, Iowa, eastern Kansas, and eastern Oklahoma (Little et al. 1989, McAlpine et al. 1991, Holloway et al. 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average size of Eastern Gray Treefrogs is between 1 1/4 to 2 3/8 inches (3.18-5.22 cm). Eastern Gray Treefrogs have very warty, rough skin and rather large toe pads that are very sticky because of the slimy mucus they produce. They range in color from greenish or brownish to grey and adults have several large, dark blotches on their backs. Also, there is often a dark-edged light spot under their eyes. Eastern Gray Treefrogs also have a bright yellow or orange coloring on the inside of their thighs that they can flash at predators to confuse them when they are under atack. Male and female treefrogs look the same except that the underside of the males' chins is much darker. This is because they have sacs in their throats for calling during mating season and females do not.

Range length: 3.18 to 5.22 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 7.175 g.

Average basal metabolic rate: 0.00433 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The eastern gray treefrog measures 1.25 to 2 inches (3-5cm) in length. The record length is 2.25 in. (6 cm). There is no sexual dimorphism. The dorsal surface of the gray treefrog species is rough and lightly sprinkled with warts,more than most frogs but less than the average toad. The large toepads produce mucous to adhere to smooth bark or man-made structures near light sources, and are characteristic of the family Hylidae. The colors of a gray treefrog vary with the colors of its background and environmental factors such as season and humidity, but shades of gray are most common with black blotches on the back. Variations of brown, green, and pearl-gray colors have been noted. Green colors are more prominent during the breeding season and in yearling frogs. Usually, there is a white mark beneath the eye. The ventral skin on the hind legs, in the groin region, may appear orange to golden yellow with black speckles and the belly is white.

If the coloration is in question, place the treefrog in a box, allow it to sit quietly, and later re-examine the specimen. The yearling frogs are about half the size of the older H. versicolor population, but retain the same characteristics. Gray treefrogs continue to grow each year until they achieve the physical limit of the species.

Both gray treefrog species possess the same larval traits, but H. versicolor was used to exemplify the tadpole stage in Conant and Collins' "A Field Guide to Reptiles and Amphibians of East Central North America". The tadpoles are small, but colorful, 1.25 in. to 1.5 in. (3.2 cm. to 3.8 cm.) long. The tip of the tail is well-defined with a 5 mm narrow tip. The oral disc is comprised of 2 upper labial tooth rows and 3 lower, serrated jaws, and an overhanging upper jaw. The intestinal coil is also visible. The background color is light green to yellow. The tallest section of the tail fin is the middle and heavy black dots are scattered along the margin on a red or orange background across the tail.

Range length: 3 to 5 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 7.175 g.

Average basal metabolic rate: 0.00433 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Hyla versicolor
Catalog Number: USNM 12074
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Mt. Carmel, Wabash, Illinois, United States, North America
  • Holotype: Cope, E. D. 1889. United States National Museum Bulletin. (34): 375.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits various kinds of wooded and forested habitats. It is both arboreal and terrestrial. It hides in tree holes, under bark, in rotten logs, under leaves, and under tree roots when inactive. Eggs and larvae develop in shallow woodland ponds and marshes, puddles, ponds in forest clearings, swamps, bogs, and many other kinds of permanent or temporary waters lacking a significant current, including ponds created through excavation by humans. In northern Minnesota, successful reproduction in acidic bog water either does not occur or is a rare event (Karns 1992). In central Ontario, embryos and larvae exhibited high degree of acid tolerance (J. Herpetol. 26:1-6).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Because Eastern Gray Treefrogs need temporary pools or permanent water for breeding, they live in forested areas that are in or near permanent water. During the summer months they tend to live in moist areas in hollow trees or rotted logs. In winter they hibernate under tree roots and leaves.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern gray Treefrogs inhabit all elevations of wooded areas near temporary and permanent waters in such diverse surroundings such as swamps, ponds, lakes, old fields, thickly wooded suburban neighborhoods, farm woodlots, and mixed or deciduous forests. During the summer months, they are most often found in damp rotten logs or hollow trees. In winter, gray treefrogs hibernate on land under woody debris such as logs, roots and leaf litter.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; temporary pools

Wetlands: swamp

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Gray treefrogs inhabit various kinds of wooded and forested habitats and may occur on the ground or more often in shrubs or trees. Inactive individuals may be in tree holes, under bark, in rotten logs, under leaves, and under tree roots.Breeding sites include shallow woodland ponds and marshes, puddles, ponds in forest clearings, swamps, bogs, and many other kinds of permanent or temporary, natural or human-created waters lacking a significant current. In northern Minnesota, successful reproduction in acidic bog water either does not occur or is a rare event (Karns 1992). In central Ontario, embryos and larvae exhibited high degree of acid tolerance (J. Herpetol. 26:1-6). The presence of snails (which may harbor trematodes that infect frogs) may influence choice of oviposition site by H. versicolor (Kiesecker and Skelly 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonally these frogs migrate up to several hundred meters between nonbreeding terrestrial habitats and breeding pools.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Eastern gray treefrogs forage on the ground and in vegetation for small Insecta, Araneae, Acari, and Gastropoda.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

As tadpoles, eastern gray treefrogs begin life by grazing on algae and detritus in their pond.

After metamorphosis, H. versicolor prey upon most types of insects and their larvae. Mites, spiders, plant lice, harvestmen, and snails are also eaten. Gray treefrogs mostly hunt insects in the understory of wooded areas in small trees and shrubs, where they may rely upon their camouflage with less risk of predation. However, like most frogs, H. versicolor is opportunitistic and may also eat smaller frogs, including other tree frogs.

Animal Foods: amphibians; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Plant Foods: algae

Other Foods: detritus

Primary Diet: carnivore (Insectivore ); herbivore (Algivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Metamorphosed frogs eat various small invertebrates obtained on the ground and in vegetation. Larvae eat suspended matter, organic debris, algae, and plant tissue.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Eastern Gray Treefrogs, like most frogs, eat a huge amount of insects and therefore play a big role in controlling their populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Eastern gray treefrogs are a source of food for a wide variety of predators, such as Mephitis mephitis, Didelphis virginiana, Procyon lotor, and Squamata. These predators vary depending on where the frogs live.

Known Predators:

  • Mephitis mephitis
  • Didelphis virginiana
  • Procyon lotor
  • Squamata

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Eastern gray treefrogs can play a critical role in the foodweb of their ecosystems. As tadpoles they may graze enough algae to change the community of algal species in their ponds. Later, local pest populations of mosquito, gnats, and flies are reduced in the territory of a single gray treefrog. In turn, Cope's gray treefrogs are the prey of larger frogs, carnivorous birds, and small mammals. H. versicolor are a significant link to support the survival of other animals in the ecosystem.

Like just about all animals, this species is host to parasitic species. Among others, Polytoma nearcticum is a flatworm that lives in the gills of tadpoles and the bladder of adults. Nematodes in the genus Strongyloides are found in the digestive systems of these frogs.

Commensal/Parasitic Species:

  • Gastrointestinal nematode (Strongyloides)
  • a monogenean flatworm, Polytoma nearcticum 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many assorted species of birds, snakes, other frogs, and small mammals eat gray treefrogs. These frogs are arboreal to avoid predators, and exploit new food resources. They also avoid the attention of predators by calling after dusk and being most active in the evening and night. They use cryptic coloration and rarely leave the trees until the breeding season. Their skin is able to assume most natural colors in which it comes into contact.

Larger frogs, such as the bullfrog (Lithobates catesbeianus) and green frog (Lithobates clamitans clamitans, have been observed to consume gray treefrogs by stalking calling males. In the water, giant waterbugs (Belostomatidae) also attack Cope's gray treefrog.

In the larval state, gray treefrogs are subject to predation by fish and larger amphibian larvae, such as the tiger salamander (Ambystomma tigrinum). When aquatic predators are abundant, gray treefrog tadpoles reduce their activity and feeding. They grow more slowly, and metamorphose at a smaller size.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Represented by many and/or large occurrences throughout most of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but surely exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eastern Gray Treefrogs have a shrill, chirp-like call. It lasts for about a second and repeats on 3 or 4 second intervals. Male Eastern Gray Treefrogs call most often during mating season.

Cope's Gray Treefrogs and Eastern Gray Treefrogs have slightly different calls. This is in fact one of only two ways in which they can be told apart. Cope's Gray Treefrogs make roughly between 35-70 notes per second, while Eastern Gray Treefrogs only make about 17-35 notes per second.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

The male's advertisement call is the main trait to distinguish the eastern gray treefrog (H. versicolor) from Cope's gray treefrog (H. chrysoscelis). In general, the sound is comprised of a resonant musical trill. The eastern gray treefrog has a slower trill than Cope’s, which is faster and higher pitched. An increase in air temperature raises the rate of the trill and tape recordings may be necessary for positive identification, especially if only a single species is present.

In comparison to other frog species in the range, the gray treefrogs calls are shorter, only 0.5 to 3 seconds, yet similar to the call of the American toad (Anaxyrus americanus americanus). The spring peeper (Pseudacris crucifer) also uses a similar call, but several ‘peeps’ can be heard before and after the trill.

In the larval state, Hyla versicolor uses chemoreception as its primary method of communication and defense against predators. Predatory fish and salamander larvae are detected via chemoreception. Injured tadpoles also release an "alarm substance" to warn their conspecifics.

Adult gray treefrogs are very sensitive to ground vibrations and possess excellent hearing. Yet, during hibernation they are unresponsive to most external stimuli.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: choruses

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: These treefrogs are inactive during the colder months of fall through early spring. Most activity occurs at dusk and at night, especially in wet weather.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Eastern Gray Treefrogs follow the same developmental pattern that is found in most frogs. Eggs are laid in shallow pools and tadpoles emerge after a few days. The tadpoles are small and somewhat fishlike in appearance. After 2 to 2.5 months they transform, or metamorphose, into young frogs. Grey Treefrogs are almost always bright green right after metamorphosis and they stay this way for some time before taking on their adult coloration.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Tadpoles of the eastern gray treefrogs metamorphosize into froglets in six to eight weeks. The young frogs are approximately 0.6 in. (1.5 cm) snout to vent length. The larval and adult rate of growth is dependent on the availability of food and stress of predators. The sex deterimination of amphibians is genetic. However, if larvae are treated with estrogen, then hormonal sex reveral is possible after metamorphosis. Hyla versicolor follow the XX/XY pattern of heterogamety.

  • Skelly, D. 1992. Field evidence for a cost of behavioral antipredator response in a larval amphibian. Ecology, 73/2: 704-708.
  • Wallace, H., B. Badaway, B. Wallace. 1999. Amphibian sex determination and sex reversal. Cellular and Molecular Life Sciences, 55/6-7: 901-909.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Eastern Gray Treefrogs can live to be 7 to 9 years old.

Typical lifespan

Status: wild:
7.0 to 9.0 years.

Average lifespan

Status: captivity:
7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

One captive gray treefrog lived for over seven years in captivity. Unfotunately, it was not distinguished as H. chrysoscelis or H. versicolor. The potential lifespan in captivity and the wild is unknown. It is likely that few gray treefrogs die of old age, predators, disease and climactic extremes are more likely causes of death.

Range lifespan

Status: captivity:
7 (high) years.

Average lifespan

Status: captivity:
7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.8 years (captivity) Observations: One gray treefrog lived 7.8 years in captivity but it is not clear whether it was a specimen of this species or of the Cope's gray treefrog (*Hyla chrysoscelis*). Given the longevity of similar species, however, it is likely that maximum longevity of these animals is higher.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Eastern Gray Treefrogs reach sexual maturity when they are 3 years old. The breeding season is from early May through August.

Females lay their eggs on the surface of shallow water and loosely attach them to some type of vegetation so that they don't float away. They lay a total of 1800-2000 eggs, usually in bundles of 10-40. Eggs hatch in about 4 to 5 days.

Breeding season: Early May through August

Range number of offspring: 1800.0 to 2000.0.

Range time to hatching: 5.0 (high) days.

Average age at sexual or reproductive maturity (female): 3.0 years.

Average age at sexual or reproductive maturity (male): 3.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Eastern Gray Treefrogs have no parental involvement with their young.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The breeding choruses of gray treefrogs begin in late April to early May after the evening air temperature rises above 15°C, which varies throughout the range. These frogs end their hibernation in the early months of spring, but do not have the energy reserves to call, yet. Warm, cloudy nights, from dusk to midnight, produce the most intense choruses. However, interludes of cold weather may temporarily end the male gray treefrog calls. Generally, the breeding chorus lasts for several weeks. Sometimes, the breeding calls are continued into late June or early July, depending on local temperatures and unusual weather phenomena.

Female choice dominates the mating scheme of gray treefrogs, since the female approaches the male with the most prolonged and frequent calls. If the male detects a nearby female he will also further entice her with a “courtship call” that is longer and more emphatic than the usual advertisement call. Successful calling results in amplexus as the female deposits eggs which are externally fertilized by the male. Almost immediately, the large egg mass breaks into small, loose egg clusters of 10 to 40 eggs attach to plants or other structures within the pond. Depending on the water temperature, the tadpoles hatch in three to seven days. Both gray treefrog sp. do not hybridize due to a mating barrier, the different pulse rate and pitch between the two calls.

Mating System: polygynous

Eastern gray treefrogs employ their unique call from the safety of vegetation next to the shallow breeding sites, preferably in tree branches that overhang the water. The males aggressively defend and use their voice to outline their territories with extended calls. Satellite males, often in their first breeding season or otherwise disadvantaged, do not call to save energy. Instead, they lie in wait near a calling male and intercept the female by claiming the caller’s position after he moves away. The female only visits the breeding site to lay her eggs. During the last weeks of the breeding season, occasional calls may still be heard as the males slowly retreat from the shoreline and disappear into the foliage. Rare calls may still be heard in the trees in late summer or fall, yet they are unrelated to mating, and occur more often during rain showers. Calling males are often attacked by predators, and this results in a female-biased population.

Breeding interval: Treefrogs breed once yearly.

Breeding season: Late April to May or until the temperature rises above 15°C

Range number of offspring: 1,000 to 2,000.

Range time to hatching: 3 to 7 days.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Female gray treefrogs invest in their offspring by providing yolk to the eggs, and choosing ponds that are relatively free of predators (they especially try to avoid fish). Males do not invest in the offspring, and female investment ends when she lays her eggs.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth

  • Hausfater, G., C. Gerhardt, G. Klump. 1990. Parasites and mate choice in Gray Treefrogs, Hyla versicolor. American Zoology, 30: 299-331.
  • Duellman, W., L. Trueb. 1986. Biology of Amphibians. New York: McGraw-Hill Book Company.
  • Skelly, D. 1992. Field evidence for a cost of behavioral antipredator response in a larval amphibian. Ecology, 73/2: 704-708.
  • Harding, . 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, Michigan: University of Michigan Press.
  • Stebbins, R., N. Cohen. 1995. A Natural History of Amphibians. Princeton, New Jersey: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding occurs in spring or summer, beginning as early as March in the southern part of the range and usually in May in the north Females deposit clutches of up to about 2,000 eggs, distributed among several small clusters. Aquatic larvae hatch in a few days and metamorphose within 2 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hyla versicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTATACCTTGTATTTGGGGCTTGAGCTGGAATGGTCGGCACTGCCCTAAGCCTTCTAATCCGAGCAGAGCTCAGCCAACCTGGCTCACTTTTAGGCGATGATCAAATTTATAATGTTATCGTCACAGCCCATGCCTTTGTCATAATCTTCTTCATAGTGATACCCATCTTAATCGGGGGGTTCGGTAATTGATTAGTCCCCTTAATAATTGGAGCACCTGATATAGCCTTCCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCCCCATCTTTTCTTCTCCTTTTAGCGTCAGCCGGGGTCGAAGCAGGAGCTGGAACAGGATGAACTGTATACCCTCCGCTTGCCGGAAATTTAGCCCACGCTGGACCATCAGTCGATTTGACTATCTTCTCACTTCACCTAGCAGGTGTTTCCTCAATTTTAGGGGCTATTAATTTTATTACTACGATTCTGAATATAAAACCCCCATCGATGACACAATACCAAACACCCCTATTTGTGTGATCTGTTCTCATTACTGCTGTCCTACTTCTCTTATCTCTTCCAGTCCTAGCAGCAGGAATTACCATACTACTTACTGATCGAAATCTAAACACAACATTTTTTGACCCGGCAGGGGGAGGAGACCCCGTTCTGTATCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hyla versicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Gray Treefrogs are not currently an endangered species. However, many frog and toad species are currently on a steady decline, often due to pollution and habitat loss. The best thing to do to ensure the survival of treefrog species is to monitor their populations and to protect their habitats.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hyla versicolor is not currently classified as endangered or of special concern. However, habitat destruction and human pollutants are contributing to the overall decline of amphibians, including frog and toad species. Public support of habitat areas in state parks, nature reserves, and private property continues to promote the survival of amphibian species. Ongoing scientific research also improves our understanding of this dynamic species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in eastern United States and southeastern Canada; abundant; many secure populations.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total adult population size is unknown but it is abundant and probably stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Relatively stable to decline of 50%

Comments: Likely relatively stable in extent of occurrence, unknown degree of decline in population size, area of occurrence, and number/condition of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The orange-yellow coloration on the back of the frog's legs is considered a "flash" coloration - it is only seen when the frog leaps, when it exposes the underside of the leg, and then is covered when it resumes a sitting position. The sudden flash of contrasting color is thought to confuse predators (Cook 1984).

Breeding season begins at the end of April and ends in August, with breeding events typically concentrated during spring rains in May and June (Oldfield and Moriarty 1994). The female lays approximately 30 to 40 eggs of a brown and cream or yellow color in small scattered masses or packets on the surface of quiet pools. The eggs, measuring about 1.1-1.2 mm, are attached to the vegetation. Hatching occurs at 4-5 days(Wright and Wright 1949).

This frog is freeze-tolerant (Schmid 1982; Storey and Storey 1985).

Hyla versicolor has been found to be significantly less prone to infection by the trematode parasite Ribeiroia ondatrae than the sympatric species Bufo americanus, with metamorphic treefrogs harboring far less of a trematode parasite load and little associated mortality or deformities. H. versicolor may have higher immunity to this parasite (Johnson and Hartson 2009).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Wright, A. H. and Wright, A. A. (1949). Handbook of Frogs and Toads of the United States and Canada. Comstock Publishing Company, Inc., Ithaca, New York.
  • Johnson, T.R. (1977). The Amphibians of Missouri. University of Kansas Publications, Lawrence, KS.
  • Bartlett, R. D., and Bartlett, P. P. (1999). A Field Guide to Texas Reptiles and Amphibians. Gulf Publishing Company, Houston, Texas.
  • Cook, F. R. (1984). Introduction to Canadian Amphibians and Reptiles. National Museums of Canada, Ottawa, Canada.
  • Johnson, J. R., and Semlitsch, R. D. (2003). ''Defining core habitat of local populations of the Gray Treefrog (Hyla versicolor) based on choice of oviposition sites.'' Oecologica, 137, 205-210.
  • Johnson, P. T. J., and Hartson, R. B. (2008). ''All hosts are not equal: explaining differential patterns of malformations in an amphibian community.'' Journal of Animal Ecology, 78, 191-201.
  • Logier, E. B. S. (1952). The Frogs, Toads and Salamanders of Eastern Canada. Clarke, Irwin & Company Ltd., Canada.
  • Matson, T. O. (1990). ''Erythrocyte size as a taxonomic character in the identification of Ohio Hyla chrysoscelis and H. versicolor.'' Herpetologica, 46, 457-462.
  • Oldfield, B. and Moriarty, J. J. (1994). Amphibians and Reptiles Native to Minnesota. University of Minnesota Press, Minneapolis.
  • Relyea, R. A., and Mills, N. (2001). ''Predator-induced stress makes the pesticide carbaryl more deadly to grey treefrog tadpoles (Hyla versicolor) .'' Proceedings of the National Academy of Sciences, 98, 2491-2496.
  • Schmid, W. D. (1982). ''Survival of frogs in low temperature.'' Science, 215, 697-698.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is not threatened overall. Introduced bluegill sunfish might cause declines in larval tree frog abundance (Smith et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: Medium

Comments: Introduced bluegill sunfish may cause declines in larval treefrog abundance (Smith et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species is classified as Least Concern. However, habitat preservation is still important. Hyla versicolor requires terrestrial habitat adjacent to breeding sites as well as the breeding wetlands, with a minimum suggested terrestrial habitat buffer of 60 m surrounding the main breeding pond (Johnson and Semlitsch 2003).

H. versicolor is one of the frog species which has been used to demonstrate the insufficiency of many of the pesticide studies conducted by pesticide manufacturers under current EPA regulations. H. versicolor tadpoles are susceptible to mortality from exposure to low concentrations of the pesticide carbaryl, with 10-60% of carbaryl-exposed tadpoles dying in laboratory experiments. This mortality rate shoots up to 60-90% if the tadpoles are simultaneously exposed to both stress and low concentrations of carbaryl, with stress induced experimentally by placing a caged predator in the water (Relyea and Mills 2001). Thus studies examining only low concentrations of pesticide without considering synergistic effects from other factors may be highly likely to underestimate the negative effects of the pesticide.

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Wright, A. H. and Wright, A. A. (1949). Handbook of Frogs and Toads of the United States and Canada. Comstock Publishing Company, Inc., Ithaca, New York.
  • Johnson, T.R. (1977). The Amphibians of Missouri. University of Kansas Publications, Lawrence, KS.
  • Bartlett, R. D., and Bartlett, P. P. (1999). A Field Guide to Texas Reptiles and Amphibians. Gulf Publishing Company, Houston, Texas.
  • Cook, F. R. (1984). Introduction to Canadian Amphibians and Reptiles. National Museums of Canada, Ottawa, Canada.
  • Johnson, J. R., and Semlitsch, R. D. (2003). ''Defining core habitat of local populations of the Gray Treefrog (Hyla versicolor) based on choice of oviposition sites.'' Oecologica, 137, 205-210.
  • Johnson, P. T. J., and Hartson, R. B. (2008). ''All hosts are not equal: explaining differential patterns of malformations in an amphibian community.'' Journal of Animal Ecology, 78, 191-201.
  • Logier, E. B. S. (1952). The Frogs, Toads and Salamanders of Eastern Canada. Clarke, Irwin & Company Ltd., Canada.
  • Matson, T. O. (1990). ''Erythrocyte size as a taxonomic character in the identification of Ohio Hyla chrysoscelis and H. versicolor.'' Herpetologica, 46, 457-462.
  • Oldfield, B. and Moriarty, J. J. (1994). Amphibians and Reptiles Native to Minnesota. University of Minnesota Press, Minneapolis.
  • Relyea, R. A., and Mills, N. (2001). ''Predator-induced stress makes the pesticide carbaryl more deadly to grey treefrog tadpoles (Hyla versicolor) .'' Proceedings of the National Academy of Sciences, 98, 2491-2496.
  • Schmid, W. D. (1982). ''Survival of frogs in low temperature.'' Science, 215, 697-698.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Tree Frogs feed on insects!

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Hyla versicolor on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

People benefit from the substantial amount of insect pests that are eaten by H. versicolor. The spring breeding chorus also provides evening entertainment to re-affirm our connection with nature. We also use the presence of eastern gray treefrogs as a scientific tool to indicate the overall biodiversity and the level of contaminants in a region. Overall, the eastern gray treefrog plays an important role in the ecological balance of wooded farmlands and residential areas and contributes to our own well-being.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gray tree frog

The gray tree frog or gray treefrog (Hyla versicolor) is a species of small arboreal frog native to much of the eastern United States and southeastern Canada.[2]

It is sometimes referred to as the eastern gray tree frog, common gray tree frog, or tetraploid gray tree frog to distinguish it from its more southern, genetically disparate relative, the Cope's gray tree frog (Hyla chrysoscelis). It may sometimes be referred to as the North American tree frog by Europeans to distinguish it from their European tree frog (Hyla arborea).

Physical description[edit]

Hind leg of similar Hyla chrysoscelis

As the scientific name implies, gray tree frogs are variable in color owing to their ability to camouflage themselves from gray to green, depending on the substrate where they are sitting. The degree of mottling varies. They can change from nearly black to nearly white. They change color at a slower rate than a chameleon. Dead gray tree frogs and ones in unnatural surroundings are predominantly gray. They are relatively small compared to other North American frog species, typically attaining no more than 1.5 to 2 in (3.8 to 5.1 cm). Their skin has a lumpy texture to it, giving them a warty appearance. They are virtually indistinguishable from the Cope's gray tree frog, H. chrysoscelis, the only readily noticeable difference being their calls. Cope's gray tree frog has a shorter, faster call.[3] The gray tree frog also has an extra set of chromosomes (4N), or 48 in total, and is called tetraploid gray tree frog in scientific circles. The Cope's gray tree frog, or diploid gray tree frog, retained its 2N (24) original chromosome set. Hybridization between these species results in early mortality of many larvae, but some individuals survive to adulthood though they have reduced fertility.[4]

Both H. chrysoscelis and H. versicolor have bright-yellow patches on their hind legs, which distinguishes them from other tree frogs, such as H. avivoca.[5] The bright patches are normally only visible while the frog is jumping. Both species of gray tree frogs are slightly sexually dimorphic. Males have black or gray throats, while the throats of the females are lighter.[6]

Tadpoles have rounded bodies (as opposed to the more elongated bodies of stream species) with high, wide tails that can be colored red if predators are in the system. Metamorphosis can occur as quickly as two months with optimal conditions. At metamorphosis, the new froglets will almost always turn green for a day or two before changing to the more common gray. Young frogs will also sometimes maintain a light green color and turn gray or darker green after reaching adulthood.

Gender identification[edit]

The female does not croak and has a white throat; however, the male does croak and has a black/gray throat. The female is usually larger than the male.

Male showing black throat

Mating[edit]

H. versicolor in amplexus
Video of gray tree frogs breeding and laying eggs

Mating calls and chorusing are most frequent at night, but individuals often call during daytime in response to thunder or other loud noises. Mass chorusing can be observed in some parts of their range during the spring rains.

Geographic range[edit]

On flower stem

Gray tree frogs inhabit a wide range, and can be found in most of the eastern half of the United States, as far west as central Texas. They also range into Canada in the provinces of Quebec,[7] Ontario, and Manitoba, with an isolated population in New Brunswick.

The gray tree frog is capable of surviving freezing of their internal body fluids to temperatures as low as -8°C.[8]

Habitat[edit]

The gray tree frog is most common in forested areas, as it is highly arboreal. Their calls are often heard in rural residential areas of the East Coast and the Midwest.

Behavior[edit]

These frogs rarely ever descend from high treetops except for breeding. They are strictly nocturnal. Male gray tree frogs rarely have large choruses, as they are mostly solitary animals, but might vocalize competitively at the height of breeding periods.

References[edit]

  1. ^ Hammerson (2004). Hyla versicolor. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006. Database entry includes a range map and justification for why this species is of least concern.
  2. ^ NatureServe 'Hyla versicolor'
  3. ^ Carl Gerhardt and John A. Doherty (1988). "Acoustic communication in the gray treefrog, 'Hyla versicolor': evolutionary and neurobiological implications". J. Comp. Physiol. A 162 (2): 261–278. doi:10.1007/BF00606090. 
  4. ^ H. Carl Gerhardt, Margaret B. Ptacek, Louise Barnett and Kenneth G. Torke (1994). "Hybridization in the Diploid-Tetraploid Treefrogs Hyla chrysoscelis and Hyla versicolor". Copeia 1994 (1): 51–59. 
  5. ^ Bernard S. Martof et al. (1980). "Amphibians and Reptiles of the Carolinas and Virginia". Chapel Hill: University of North Carolina Press. ISBN 0-8078-4252-4.
  6. ^ Thomas F. Tyning (1990). A Guide to Amphibians and Reptiles. Boston: Little, Brown and Company. ISBN 0-316-81719-8.
  7. ^ Quebec range map, Quebec Biodiversity website
  8. ^ Adaptations of Frogs to Survive Freezing
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Hyla versicolor was not distinguished from look-alike species H. chrysoscelis in most historical literature; it can be distinguished by chromosomes, erythrocyte size (Matson 1990), and call characteristics. Based on molecular markers and advertisement calls, Holloway et al. (2006) determined that Hyla versicolor is a tetraploid species that originated multiple times through interbreeding of extant diploid gray tree frogs and two other, apparently extinct, lineages of tree frogs. Tetraploid lineages then merged through interbreeding to form a single species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!