Overview

Comprehensive Description

Description

The largest salamander in North America. This completely aquatic species reaches adult sizes of 24 to 40 cm snout to vent length (30-74 cm total length) (Dundee and Dundee 1965; Dundee 1971; Petranka 1998). These salamanders are excessively slimy and are dorso-ventrally flattened. The head is broad and the eyes are tiny and lidless. The large, paddle-like tail is laterally compressed. The skin is loose and wrinkled. The limbs have flaps on the posterior edges, and there is a floppy lateral fold of skin. Adults have a single gill slit on either side of the head and lack external gills. Larvae are stream type with small gills and a low tail fin. Hatchlings are are 25-33 mm total length. The limbs are incompletely developed at hatching (Dundee 1971; Nickerson and Mays 1973; Petranka 1998).

Adult coloration is greenish, yellowish brown or slate gray with black spots or blotches (Petranka 1998). Two subspecies are recognized based on differences in geographic distribution (see below) and coloration. Cryptobranchus a. alleganiensis, the eastern hellbender, has small dark spots dorsally and a uniformly colored chin. Cryptobranchus a. bishopi, the Ozark hellbender, has larger black blotches dorsally and a darkly mottled chin region. The spiracle opening is also smaller in C. a. bishopi (Dundee and Dundee 1965; Dundee 1971; Nickerson and Mays 1973; Petranka 1998). Small larvae are uniformly dark dorsally with a white venter. Older larvae have dark spots dorsally and pigmented venters (Petranka 1998).
 
Some authors have suggested that the two currently recognized supspecies should be treated as separate species. The ranges apparently do not contact, and the morphological differences suggest reproductive isolation and absence of gene flow between the forms (Collins 1991).

Video of Indiana fauna in the wild, including Cryptobranchus alleganiensis.

Blue River, Indiana from Ravenswood Media on Vimeo.

View a different video of C. alleganiensis feeding.

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Collins, J. T. (1991). "A new taxonomic arrangement for some North American amphibians and reptiles." Herpetological Review, 22, 42-43.
  • Dundee, H. A. (1971). ''Cryptobranchus, and C. alleganiensis.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 101.1-101.4.
  • Dundee, H. A., and Dundee, D. S. (1965). ''Observations on the systematics and ecology of Cryptobranchus from the Ozark Plateaus of Missouri and Arkansas.'' Copeia, 1965(3), 369-370.
  • Nickerson, M. A., and Mays, C. E. (1973). The Hellbenders: North American ''Giant Salamanders''. Milwaukee Public Museum, Milwaukee, WI.
  • Peterson, C. L. (1988). "Breeding activities of the hellbender in Missouri." Herpetological Review, 19, 28-29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

This species occurs in the USA from southern Illinois (with a recent record from Wabash River; Smith 1961; Brandon and Ballard 1994; Phillips, Brandon and Moll 1999), southern Indiana (Minton 1972), Ohio (Pfingsten and Downs 1989), Pennsylvania (McCoy 1982), and south-western and south-central New York (Bishop 1941), to central and south-central Missouri (Johnson 1987), northern Arkansas (the Black River system and north fork of White River, and Eleven Point River, Randolph County; Trauth, Wilhide and Daniel 1992), northern Mississippi, Alabama (Tennessee River drainage; Mount 1975), northern Georgia, the western Carolinas (Martof et al. 1980), western Virginia (Tobey 1985), West Virginia (throughout, west of the Allegheny Front; Green and Pauley 1987), and extreme western Maryland. In Kentucky, near the centre of the range, Barbour (1971) regarded the species "most common in the upper reaches of the Cumberland, Kentucky, and Licking river systems". In Tennessee, no records exist for locations west of the Tennessee River (Redmond and Scott 1996). Collections are known from south-eastern Kansas (Neosha River), but these are likely to have been from introduced individuals and not from a naturally occurring population (Collins 1982, 1993; W.H. Busby pers. comm.). There are early reports, of uncertain validity, of Hellbenders in Iowa (Nickerson and Mays 1973b). Old records from the Great Lakes (Lake Erie) drainage, New Jersey, and Louisiana are probably erroneous (Pfingsten and Downs 1989; Harding 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The hellbender, Cryptobranchus alleganiesis, occupies the Susquehanna River drainage in southern New York and Pennsylvania, and large portions of the Missouri, Ohio, and Mississippi River drainage from western Pennsylvania, southern Ohio, extreme southern Indiana, most of West Virginia, Kentucky, and Tennessee, northern Alabama and Georgia, western North Carolina and Virginia. The subspecies Cryptobranchus alleganiensis bishopi, or Ozark hellbender, is only found in the Black River and White River systems of Missouri and Arkansas (Danch 1996).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) The range extends from southern Illinois (recent record from Wabash River; Smith 1961, Brandon and Ballard 1994, Phillips et al. 1999), southern Indiana (Minton 1972), Ohio (Pfingsten and Downs 1989), Pennsylvania (McCoy 1982), and southwestern and southcentral New York (Bishop 1941) to central and southcentral Missouri (Johnson 2000), northern Arkansas (Trauth et al. 1992, 2004), northern Mississippi, Alabama (Tennessee River drainage, Mount 1975), northern Georgia, the western Carolinas (Martof et al. 1980), western Virginia (Tobey 1985), West Virginia (throughout, west of the Allegheny Front, Green and Pauley 1987), and extreme western Maryland (Phillips and Humphries 2005). Populations in the White River system in southern Missouri and northern Arkansas often have been recognized as a distinct subspecies (C. a. bishopi; see taxonomy comments).

In Kentucky, near the center of the range, Barbour (1971) regarded the species "most common in the upper reaches of the Cumberland, Kentucky, and Licking river systems." In Tennessee, no records exist for locations west of the Tennessee River (Redmond and Scott 1996). Collections are known from southeastern Kansas (Neosha River), but these were likely introduced and not from a naturally occurring population (Collins 1982, 1993; Busby, pers. comm. 1994). There are early reports, of uncertain validity, of hellbenders in Iowa (Nickerson and Mays 1973). Old records from the Great Lakes (Lake Erie) drainage are probably erroneous (Pfingsten and Downs 1989, Harding 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Hellbenders occur from New York to northern Alabama and extreme northeastern Mississippi, and westward to central and southern Missouri and northern Arkansas (Petranka 1998). Principally associated with tributaries of the Ohio and Tennessee rivers west of the Appalachian Mountains. Disjunct populations occur in the Susquehanna River (New York, Pennsylvania), the upper Savannah River (Georgia), and tributaries of the Missouri and Black rivers (Missouri, northern Arkansas) (Dundee 1971). Cryptobranchus a. alleganiensis occurs in central Missouri and from southern New York south to northern Alabama and a small portion of Mississippi. Cryptobranchus a. bishopi ocurs in southern Missouri and adjoining portions of Arkansas (Petranka 1998).

The preferred habitat is large streams and rivers with fast-flowing water and a rocky substrate. Individuals are most easily found under large boulders. Water temperature is usually cold (20º C, sometimes as high as 25-30º C) and fairly constant through the year (Dundee 1971; Petranka 1998).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Collins, J. T. (1991). "A new taxonomic arrangement for some North American amphibians and reptiles." Herpetological Review, 22, 42-43.
  • Dundee, H. A. (1971). ''Cryptobranchus, and C. alleganiensis.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 101.1-101.4.
  • Dundee, H. A., and Dundee, D. S. (1965). ''Observations on the systematics and ecology of Cryptobranchus from the Ozark Plateaus of Missouri and Arkansas.'' Copeia, 1965(3), 369-370.
  • Nickerson, M. A., and Mays, C. E. (1973). The Hellbenders: North American ''Giant Salamanders''. Milwaukee Public Museum, Milwaukee, WI.
  • Peterson, C. L. (1988). "Breeding activities of the hellbender in Missouri." Herpetological Review, 19, 28-29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The hellbender is a large totally aquatic salamander characterized by loose highly folded skin along the lower sides of the body. The folds of skin are used in respiration as the hellbender has no gills and the lungs are only used for buoyancy control (Danch 1996). The hellbender's body is dorsoventrally compressed and the head is extremely flattened. The hellbender undergoes incomplete metamorphosis so that adults lack eyelids and retain one pair of gill slits that are seen as circular openings on the neck. All adults have four digits on each forelimb and five digits on each hind limb (Cogger and Zweifel 1998). The hellbender is sexually dimorphic in size, with females being larger than males. The length in adults varies from 11-29 inches, with most being in the range of 11-20 inches. The other dimorphic characteristic for the hellbender is only seen in the breeding season when the male develops a swollen ring around the opening of the cloaca (Behler and King 1979). The body color varies from yellowish brown to almost black with very faint scattered dark or light spots in the adults. The young, once they lose their external gills at about 4 to 5 inches, have numerous irregular dark spots that are easily seen on a light body color (Conant and Collins 1998).

Average mass: 358.1 g.

Average basal metabolic rate: 0.0253 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 51 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults differ from other large salamanders by lacking external gills and by their strongly flattened head and body. Larvae have four limbs; external gills; flattened, fleshy toes; a broad, flattened snout; and loose skin along the sides of the noncylindrical body.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It can be found in rocky, clear creeks and rivers, usually where there are large rocks for shelter. It usually avoids water warmer than 20°C. Males prepare nests and attend eggs beneath large flat rocks or submerged logs.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The hellbender prefers clear fast-flowing larger streams and rivers with rocky bottoms and plenty of cover in the form of logs and debris (Behler and King 1979).

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Rocky, clear creeks and rivers, usually where there are large shelter rocks. Usually avoids water warmer than 20 C. Males prepare nests and attend eggs beneath large flat rocks or submerged logs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The hellbender is strictly carnivorous. The diet consists primarily of crayfish but insects, fish, and worms will also be eaten (Behler and King 1979). The hellbender has a very unique mechanism for capturing and consuming its prey. It exhibits a highly unusual mode of asymmetrical suction feeding in which the bilateral elements of the mandibles and hyoid move independently. Typically the hellbender only depresses one side of the mandible, dropping the jaw 10 to 40 degrees from the resting position and the prey is drawn in with a jet of water (Pough et al. 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Crayfish are the most important food item, though fishes (often scavenged) and other aquatic invertebrates are also eaten (Peterson et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: No estimates are available, but there are many occurrences in at least several dozen rivers. The lack of new distributional records published in Herpetological Review during the period 1995-2000 suggests that relatively few occurrences remain undiscovered.

Most maps in state amphibian and reptile books do not distinguish between extant and historical occurrences. Redmond and Scott (1996) mapped more than 50 locations in Tennessee. Green and Pauley (1987) mapped locations in 22 counties in West Virginia. Tobey (1985) mapped 19 observation/collection sites in Virginia. Mount (1975) mapped 8 locations in Alabama. Pfingsten and Down (1989) mapped a couple dozen post-1950 locations in about 15 different rivers in Ohio; most rivers with pre-1950 locations also had post-1950 locations. Phillips et al. (1999) mapped post-1980 locations in two counties in Illinois, with four additional pre-1980 county records. Minton (1972, 2001) stated that in Indiana hellbenders persist in fairly good numbers or as a reproducing population only in Blue River. Johnson (1987, 2000) mapped locations in 18 counties in Missouri. Trauth et al. (2004) mapped 11 localities in 4 general areas in Arkansas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Total adult population size is unknown but likely at least 10,000. In Missouri, a single riffle (4,600 square meters) had an estimated population size 230-270 hellbenders during two studies (Nickerson and Mays 1973, Peterson et al. 1983). Nickerson and Mays (1973) recorded an estimated 1,142 hellbenders in a 2.67-kilometer stretch of river in Missouri.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Missouri, 80% of recaptures were within 30 m of tagging site. Also in Missouri, average home range size was 28 sq m in females, 81 sq m in males; there was considerable overlap in the home ranges of both males and females; number of rocks used as shelter ranged from 1 to 13 (Peterson and Wilkinson 1996).

In Pennsylvania, home range averaged 346 sq m (Hillis and Bellis 1971).

Density in Missouri was about 400-500 per km of suitable river habitat (Nickerson and Mays 1973, Peterson et al. 1983); 1-6 per 100 sq m in Ozark streams (Peterson et al. 1988). Larvae often are rare or at least difficult to find.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Primarily nocturnal but sometimes active in daylight. In West Virginia, Humphries and Pauley (2000) documented a peak in nocturnal activity in May and June; individuals tended to be hidden in summer and early fall. In Missouri and Arkansas, evidently active throughout the year in streams heavily influenced by springs (Peterson et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
25.0 years.

Average lifespan

Status: captivity:
6.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29 years (wild) Observations: This is a relatively long-lived species, and some estimates indicate these animals may live over 30 years in the wild (http://www.pwrc.usgs.gov/neparc/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Unusual among salamanders is the fact that the hellbender exhibits external fertilization. The breeding season shows a degree of geographic variability. With those in the eastern populations demonstrating breeding activity in late August through early September. While the western and southern populations begin breeding activity in early September to early November. At the onset of the breeding season the male will excavate a nest site that he will defend from other males. The nest site is usually beneath flat rocks or other debris. Males will persuade females to enter the nest site and lay their eggs. The eggs are between 5 and 7 millimeters in diameter and are spherical in shape. The eggs are always laid in paired rosary-like strings that form an egg mass that contains anywhere from 270 to 450 eggs. The male will float over the female and will undulate his lower body in order to disperse his milt throughout the nest cavity. Often times the male will attract more than one female to the nest site in a season so there could be as many as 1,000 or more eggs per nest site. The male will remain with the eggs until hatching to provide protection from predators. The eggs usually hatch 68 to 84 days after fertilization, with larvae ranging in size from 23 to 26 millimeters in length. The larvae retain their external gills for approximately one and a half years or until they reach about 4 inches in length. At this stage the larvae resemble the larvae of other salamanders and lack the pronounced flattening of the body and the dermal folds. The hellbender grows very slowly at a rate of about 2 centimeters per year, and may continue for five or six years before sexual maturity is reached, at which point the individual will be approximately 14 inches in length. The hellbender is long lived and captive individuals have been recorded to survive for 29 years (Danch 1996).

Average time to hatching: 72 days.

Average number of offspring: 275.

Average age at sexual or reproductive maturity (male)

Sex: male:
1825 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1825 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lays eggs in late summer or fall (August, September, early October; e.g., Jensen et al., 2004, Herpetol. Rev. 35:156); winter breeding has been observed in the Spring River, Arkansas (Peterson et al. 1989). Clutch size averages about 350-500; increases with female body length. Several females may oviposit in same site. Males guard developing eggs. Larvae hatch in 1.5-3 months, lose gills about 18 months after hatching. Sexually mature in 5-8 years (Minton 1972, Peterson et al. 1988). Longevity 25+ years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cryptobranchus alleganiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBAP1151-10|GQ368662|Cryptobranchus alleganiensis| ACTCGATGGTTATTTTCAACGAATCATAAAGATACTGGCACTTTATATTTAGTATTCGGTGCCTGAGCTGGGATAATTGGAACAGCATTA---AGCTTATTAATCCGAGCAGAATTAAGCCAGCCTGGAGCCTTATTTGGCGAT---GATCAGATTTATAATGTTATTGTAACAGCCCATGCTTTTGTAATAATTTTTTTTATGGTGATACCAGTTATGATTGGCGGTTTTGGAAATTGATTAGTCCCTTTAATA---ATTGGGGCTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGCTTTTGATTATTACCGCCATCTTTATTATTATTACTAGCATCTTCTGGTATTGAAGCGGGTGCCGGAACGGGGTGAACAGTATATCCGCCTTTAGCTGGTAACCTCGCCCATGCTGGAGCTTCTGTAGATTTA---ACAATCTTTTCACTTCATTTAGCCGGTATTTCATCAATTCTTGGAGCTATTAATTTTATTACTACATCAGTTAATATAAAACCACCGGCTATAACCCAATACCAAACTCCTTTATTTGTTTGATCTGTGTTAATTACTGCAATCTTATTATTATTATCTCTTCCTGTCTTAGCTGCC---GGAATTACTATGCTGCTAACAGATCGGAATCTTAATACAACTTTCTTTGATCCATCTGGCGGTGGTGACCCTGTTTTATATCAACACCTTTTTTGATTTTTTGGTCATCCGGAAGTTTATATTCTAATTCTTCCAGGCTTTGGTATAATCTCTCATATTGTTACATACTATTCAGCTAAAAAA---GAACCTTTTGGTTATATAGGGATAGTATGAGCAATAATGTCTATTGGCGTACTAGGTTTTATCGTATGAGCACATCATATATTTACAGTAGATCTCA  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cryptobranchus alleganiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson, Christopher Phillips

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Near Threatened because this species is probably in significant decline (but probably at a rate of less than 30% over three generations (assuming a generation length to be approximately ten years) because of widespread habitat loss through much of its range, thus making the species close to qualifying for Vulnerable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although the hellbender has no special status given to it there are still a number of factors which may in the near future change it's status. Agricultural runoff and the acidic runoff from large scale mining operations threaten much of the hellbenders habitat. The most serious threat to the future of the hellbender is the impoudment of rivers and streams for the formation of recreational lakes and hydroelectric facilities. Another threat to the hellbender comes in the form of indiscrimante collecting, for both the pet trade and scientific research (Danch 1996).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Wide range in the central interior portion of the eastern U.S.; many populations have declined or have been eliminated by dams, sedimentation, water pollution, and overcollecting; better information is needed on the conservation status of this species in much of its range.

Intrinsic Vulnerability: Highly vulnerable

Comments: Slow to mature. Low vagility and recruitment rate make this species vulnerable to local extirpation.

Environmental Specificity: Very narrow. Specialist or community with key requirements scarce.

Comments: This is a habitat specialist with little tolerance of environmental change (Williams et al. 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total adult population size is unknown, but the population is in overall decline (although there are secure populations in many areas).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Populations are apparently still declining in some areas, but little is known about current or recent population trend in most of the range (Phillips and Humphries 2005).

Global Long Term Trend: Decline of 30-70%

Comments: Compared to historical conditions, the species has significantly declined in population size, extent of occurrence, area of occupancy, and number and condition of occurrences (subpopulations) to a moderate extent (actual degree of decline is unknown but is closer to 25% than to 75%) (Nickerson and Mays 1973, Williams et al. 1981, Minton 2001, Wheeler et al. 2003, Trauth et al. 2004, Phillips and Humphries 2005). Some populations in Illinois (Phillips et al. 1999, Phillips and Humphries 2005), Indiana (Kern 1986, Minton 2001), and Ohio (Pfingsten 1990) have been extirpated. In Indiana, most reductions occurred between 1935 and 1965 (Minton 2001). However, populations are still present in most of the historical range. For example, the species is still common in many high-elevation streams in West Virginia (Humphries 1999). Populations still remain in the Allegheny and Susquehanna drainages in New York (Bothner and Gottlieb 1991) and in those systems in Pennsylvania and Maryland (Gates 1983). The species still occurs throughout the historical range in Missouri and Arkansas (Phillips and Humphries 2005), although a population in the Spring River in Arkansas is nearing extirpation (Trauth et al. 2004). Aside from the Spring River population, good documentation of population declines is scarce (Phillips and Humphries 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Hellbenders usually breed in the late summer and early fall (September), but eastern hellbenders may breed two months or more earlier than Ozark hellbenders (Dundee and Dundee 1965; Nickerson and Mays 1973; Peterson 1988). Hellbenders form breeding aggregations in and around nest sites, such as burrows in streamside banks or under large rocks. Males compete for access to mates (Nickerson and Mays 1973; Peterson 1988). Similar mating behavior has been observed in Andrias japonicus, the Japanese giant salamander, another member of the family Cryptobranchidae (Kawamichi and Ueda 1998). Fertilization is external, and chemical cues may be important in courtship and mating (Peterson 1988). Nests have been found containing from 138 - 334 eggs, and a female laid 200 eggs in captivity. Females may share oviposition sites, and over 1900 eggs have been found in a single nest. Males tend the eggs after oviposition and fertilization, and they guard against egg predation by conspecifics (Petranka 1998). Hatching occurs in late fall after a developmental period of 45 - 75 days, depending on locality (Peterson 1998; Petranka 1998).

Hellbenders forage at night, sometimes on overcast days, and they retreat to crevices under rocks during the day (Nickerson and Mays 1973). The diet is varied including crayfish, small fish, mollusks, and worms. The slime produced by these animals is noxious to many predators, but they are occasionally preyed upon by large fish, turtles and water snakes. Eggs and larvae are frequently eaten by conspecifics. See Petranka (1998) for references. Hellbender densities have been estimated at over 400 animals/km of stream, and up to 10 animals/100 m2 (Nickerson and Mays 1973; Peterson 1988). Hellbenders are fairly long-lived and may reach ages of 20-30 years in the wild (Petranka 1998).

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Collins, J. T. (1991). "A new taxonomic arrangement for some North American amphibians and reptiles." Herpetological Review, 22, 42-43.
  • Dundee, H. A. (1971). ''Cryptobranchus, and C. alleganiensis.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 101.1-101.4.
  • Dundee, H. A., and Dundee, D. S. (1965). ''Observations on the systematics and ecology of Cryptobranchus from the Ozark Plateaus of Missouri and Arkansas.'' Copeia, 1965(3), 369-370.
  • Nickerson, M. A., and Mays, C. E. (1973). The Hellbenders: North American ''Giant Salamanders''. Milwaukee Public Museum, Milwaukee, WI.
  • Peterson, C. L. (1988). "Breeding activities of the hellbender in Missouri." Herpetological Review, 19, 28-29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The principal threat to this species is degradation of habitat, since it is a habitat specialist with little tolerance of environmental change (Williams et al. 1981). It breathes primarily (approximately 90%) through the skin (Guimond 1970) and is therefore dependent on cool, well-oxygenated, flowing water. Construction of dams stops swift water flow and submerges riffles. Logging, mining, road construction and maintenance, and other activities, can cause extensive sedimentation that covers the loose rock and gravel important as nest sites, and for shelter and food production. In Illinois, "most former rocky habitat has been buried under silt" (Phillips, Brandon and Moll 1999). Chemical pollutants and acid mine drainage are probably destructive, especially to eggs and larvae. Thermal pollution of water with a consequent oxygen loss would also be detrimental. Several streams in Alabama "have been polluted, impounded, or otherwise modified to the extent that they are, from all indications, incapable of supporting hellbender populations" (Mount 1975). Injuries and deaths sometimes also result when the salamanders are hooked by anglers, and some fishermen still believe that Hellbenders are dangerously poisonous and also destroy game fish and their eggs (both beliefs are false), and therefore kill them at every opportunity. In the past, there were even attempts by organized sportsmen’s groups in West Virginia to eradicate them. There is some collecting of Hellbenders for sale as live animals or as preserved specimens. Over-collecting has been considered a serious threat in some parts; a decline was noted in the early 1990s, apparently due to collecting. Nickerson and Mays (1973b) noted additional factors they suspected might affect local populations, such as gigging (hunting of the species at night), heavy canoe traffic, dynamiting of large boulders to enhance commercial canoe traffic, and riverside cattle and pig pens. Hellbenders generally are intolerant of heavy recreational use of habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: The principal threat is degradation of habitat, including impoundments, channelization, ore and gravel mining, silt and nutrient runoff (e.g., from timber harvest, agriculture, faulty septic and sewage treatment systems), other water pollution, and den site disturbance due to recreational uses of rivers (Nickerson and Mays 1973, Mount 1975:109, Bury et al. 1980, Williams et al. 1981, LaClaire 1993, Phillips et al. 1999, Wheeler et al. 1999, Minton 2001, Trauth et al. 2004). The species depends on cool, flowing, well-oxygenated water, and it needs a coarse (rocky) substrate. In agricultural regions, most of the former rocky habitat has been buried under silt (Phillips et al. 1999). Hellbenders appear to be intolerant of heavy recreational use of the habitat.

Overexploitation (collection and illegal or unintentional harvest) may be a threat to declining populations, whose viability may be reduced by removal of relatively few adults.

Many populations have become reduced to the point at which the usual problems associated with small populations size come into effect. Fragmentation of populations as a result of habitat loss/degradation is making it increasingly unlikely that extirpated populations can be reestablished through natural dispersal.

Some recent studies found open sores, tumors, and missing limbs and eyes in hellbenders in the Spring and Eleven Point rivers in the Ozark region (see Wheeler et al. 2002, Trauth et al. 2004). The cause of the abnormalities is unknown.

An exceptionally large flood event may have contributed to the decline in the Spring River, Arkansas (Trauth et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Siltation and pollution, including thermal pollution, are threats to populations of C. alleganiensis (Dundee 1971; Petranka 1998).
  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Collins, J. T. (1991). "A new taxonomic arrangement for some North American amphibians and reptiles." Herpetological Review, 22, 42-43.
  • Dundee, H. A. (1971). ''Cryptobranchus, and C. alleganiensis.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 101.1-101.4.
  • Dundee, H. A., and Dundee, D. S. (1965). ''Observations on the systematics and ecology of Cryptobranchus from the Ozark Plateaus of Missouri and Arkansas.'' Copeia, 1965(3), 369-370.
  • Nickerson, M. A., and Mays, C. E. (1973). The Hellbenders: North American ''Giant Salamanders''. Milwaukee Public Museum, Milwaukee, WI.
  • Peterson, C. L. (1988). "Breeding activities of the hellbender in Missouri." Herpetological Review, 19, 28-29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Deeply wrinkled with a dappled, muddy hue, the skin of the eastern hellbender—the giant Appalachian salamander—also serves as its lungs. This “water-breather” absorbs oxygen through its skin from the cool, fast-flowing mountain streams in which it lives. As a result the hellbender is extremely sensitive to its environment, be it the temperature of its water, pollutants, oxygen content or acidity..."
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Many of the presently known populations are in national or state forests, national parks, and other public lands, where there is good potential for protecting habitat. The St. Louis Zoo maintains a captive-breeding programme for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Buffer zones around streams should be maintained.

Translocated individuals may disperse up to 2,340 m (greatest movement during high stream discharge); reintroduction of a small number of individuals may be most effective during early spring period of low stream discharge (Gates et al. 1985).

Biological Research Needs: Demographic, behavioral, and ecological studies are needed. Specific research is needed on the impact of spraying for the gypsy moth, siltation, acid mine drainage, and acid precipitation. The minimum population size necessary to maintain genetic viability should be investigated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Several (4-12) occurrences appropriately protected and managed

Comments: Many of the presently known populations are in national or state forests, national parks, and other public lands, where there is good potential for protecting habitat, except where rivers are negatively impacted by activities in upstream portions of a watershedd.

Needs: Streams need to be protected from siltation and thermal and chemical pollution. This should include maintenance of buffer zones around the streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The hellbender does not have a direct positive economic importance. However, the hellbender belongs to the suborder Cryptobranchoidea which is the most primitive of the living salamanders and may hold clues for scientists to use when studying the evolution of other salamanders (Cogger and Zweifel 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: Maintenance of unpolluted, free-flowing rivers with a rocky substrate is the primary management need.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relation to Humans

Many fisherman consider hellbenders to be poisonous and will cut their line rather than unhook them (Conant and Collins 1991). Native Americans traditionally used this species as a food source (Petranka 1998).
  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Collins, J. T. (1991). "A new taxonomic arrangement for some North American amphibians and reptiles." Herpetological Review, 22, 42-43.
  • Dundee, H. A. (1971). ''Cryptobranchus, and C. alleganiensis.'' Catalogue of American Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, 101.1-101.4.
  • Dundee, H. A., and Dundee, D. S. (1965). ''Observations on the systematics and ecology of Cryptobranchus from the Ozark Plateaus of Missouri and Arkansas.'' Copeia, 1965(3), 369-370.
  • Nickerson, M. A., and Mays, C. E. (1973). The Hellbenders: North American ''Giant Salamanders''. Milwaukee Public Museum, Milwaukee, WI.
  • Peterson, C. L. (1988). "Breeding activities of the hellbender in Missouri." Herpetological Review, 19, 28-29.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hellbender

The hellbender (Cryptobranchus alleganiensis), also known as the hellbender salamander, is a species of giant salamander that is endemic to eastern North America.[1] A member of the Cryptobranchidae family, hellbenders are the only members of the Cryptobranchus genus, and are joined only by one other genus of salamanders (Andrias, which contains the Japanese and Chinese giant salamanders) at the family level. Hellbenders are ecologically significant for many reasons, including their uniqueness. These salamanders are much larger than any others in their endemic range, they employ an “unusual” means of respiration (which involves cutaneous gas exchange through capillaries found in their dorsoventral folds), and they fill a particular niche—both as a predator and prey—in their ecosystem which either they or their ancestors have occupied for around 65 million years.[2][3]

Contents

Etymology

The origin of the name "hellbender" is unclear. The Missouri Department of Conservation says:

The name 'hellbender' probably comes from the animal’s odd look. Perhaps it was named by settlers who thought "it was a creature from hell where it’s bent on returning". Another rendition says the undulating skin of a hellbender reminded observers of 'horrible tortures of the infernal regions'. In reality, it’s a harmless aquatic salamander.[4]

Vernacular names include "snot otter", "devil dog", "mud-devil", "grampus", "Allegheny alligator", "mud dog", and "leverian water newt".[5][6] The genus name is derived from the Ancient Greek, kryptos (hidden[7]) and branchos (gill); a reference to oxygen absorption primarily through gills that are in a covered chamber and not lungs.[8]

Diagnosis

The hellbender has a few characteristics that make it distinguishable from other native salamanders—these include a gigantic, dorsoventrally flattened body with thick folds travelling down the sides, a single open gill slit on each side, and hind feet that have five toes each.[2][9] Easily distinguished from most other endemic salamander species simply by their size—hellbenders average up to sixty centimeters or about two feet in length—the only species that requires further distinction (due to an overlap in distribution and size range) is the mudpuppy (Necturus maculosus).[10][11] This demarcation can be made by noting the presence of external gills in the mudpuppy, which are lacking in the hellbender, as well as by noting the presence of four toes on each hind foot of the mudpuppy (in contrast with the hellbender’s five).[2] Furthermore, the average size of C. a. alleganiensis has been reported to be 45-60 cm (with some being reported as reaching up to 74 cm --30"), while N. m. maculosus has a reported average size of 28-40 cm in length, which means that hellbender adults will still generally be notably larger than even the biggest mudpuppies. [10][12][3]

Taxonomy and physical description

The genus Cryptobranchus has historically only been considered to contain one species, Cryptobranchus alleganiensis, with two subspecies, Cryptobranchus alleganiensis alleganiensis and Cryptobranchus alleganiensis bishopi. [6] Recent decline in population size of the Ozark subspecies Cryptobranchus alleganiensis bishopi has led to further research into populations of this subspecies, including genetic analysis to determine the best route for conservation status.[10] Crowhurst et al., for instance, found that the “Ozark subspecies” denomination is insufficient for describing genetic (and therefore evolutionary) divergence within the Cryptobranchus genus in the Ozark region. The researchers found three equally divergent genetic units within the genus: Cryptobranchus alleganiensis alleganiensis, and two distinct eastern and western populations of Cryptobranchus alleganiensis bishopi. These three groups were shown to be isolated and are considered to most likely be “diverging on different evolutionary paths".[10]

Both males and females grow to an adult length of 24 centimetres (9.4 in) to 40 centimetres (16 in) from snout to vent, with a total length of 30 centimetres (12 in) to 74 centimetres (29 in) making it the third largest aquatic salamander species in the world (next to the Chinese giant salamander and the Japanese giant salamander) and the largest in North America.[11] An adult weighs 1.5 kilograms (3.3 lb) to 2.5 kilograms (5.5 lb). Hellbenders reach sexual maturity at about five years of age, and may live thirty years in captivity.[13]

C. alleganiensis have flat bodies and heads, with beady dorsal eyes and slimy skin. Like most salamanders, they have short legs with four toes on the front legs and five on their back appendages, and their tails are keeled to propel them through water. The hellbender has working lungs, but gill slits are often retained although only immature specimens have true gills; the hellbender absorbs oxygen from the water through capillaries of its side-frills.[13] They are blotchy brown or red-brown in color, with a paler underbelly.

Distribution

Hellbender species are present in a number of eastern states that stretch “from southern New York to northern Georgia,”[14] including parts of Ohio, Pennsylvania, Maryland, West Virginia, Virginia, Kentucky, Illinois, Indiana, Tennessee, North Carolina, South Carolina, Alabama, Mississippi, Arkansas, Missouri, and even a small bit of Oklahoma and Kansas.[1] The subspecies (or species, depending on the source) Cryptobranchus alleganiensis bishopi is confined to the Ozarks of northern Arkansas and southern Missouri while Cryptobranchus alleganiensis alleganiensis is found in the rest of the aforementioned states.[1]

Some hellbender populations—namely a few in Missouri, Pennsylvania, and Tennessee—have historically been noted to be quite abundant, but several anthropogenic maladies have converged on the species such that it has seen serious population decline throughout its range. Hellbender populations were listed in 1981 as already extinct or endangered in Illinois, Indiana, Iowa, and Maryland, decreasing in Arkansas and Kentucky, and were noted as being generally threatened as a species throughout their range by various human activities and developments.[1]

Ecology

The hellbender salamander is considered to be a “habitat specialist”—in other words, it has adapted to fill a specific niche within a very specific environment. It is labeled as such “because its success is dependent on a constancy of dissolved oxygen, temperature and flow found in swift water areas,” which in turn limits it to a narrow spectrum of stream/river choices.[14] As a result of this specialism, hellbenders are generally found in areas with large, irregularly shaped and intermittent rocks and swiftly moving water, and tend to avoid wider, slow moving waters with muddy banks and/or slab rock bottoms. This specialism likely aided the decline in hellbender populations, as collecting was made easier by being able to easily spot their specific habitat selection.[14] One collector noted that before in the ecosystems natural condition, “one could find a specimen under almost every suitable rock,” but that after years of collecting, the population had declined significantly.[15] The same collector noted that he “never found two specimens under the same rock,” corroborating the account given by other researchers that hellbenders are generally solitary—they are only thought to gather during the mating season.[15][16]

Both species, C. a. alleganiensis and C. a. bishopi undergo a metamorphosis after around a year and a half of life.[14] It is at this point—when they are roughly 13.5 centimeters in length—that they lose the gills that were present during their larval stage, and develop toes from lobes on their front limbs and “paddle-shaped” hind limbs. Until this point, they are easily confused with mudpuppies, and can be differentiated often only through toe number.[13] After this metamorphosis, hellbenders have to be able to absorb oxygen through the folds in their skin, which is largely behind the need for fast moving, oxygenated water. If a hellbender ends up in an area of slowly moving water, not enough water will pass over its skin in a given time period, making it difficult to garner enough oxygen to support necessary respiratory functions. Likewise, a below favorable oxygen content can make life just as difficult.[15] Hellbenders are preyed upon by multiple different predators, including various fish and reptiles (including both snakes and turtles). Cannibalism of eggs is also considered to be a common occurrence.[11]

Life History and Behavior

Behavior

Once a hellbender finds a favorable location, it generally does not stray too far from it—except occasionally for breeding and hunting—and will protect it from other hellbenders both in and out of the breeding season.[16] While the range of two hellbenders may overlap, they are noted as rarely being present in the overlapping area when the other salamander is in the area. The same researchers claim the species is at least somewhat nocturnal, with peak activity being reported by one source as occurring around “two hours after dark” and again at dawn (although the dawn peak was recorded in the lab and could be misleading as a result).[16][13] Nocturnal activity has been found by at least one set of researchers to be most prevalent in early summer, perhaps coinciding with highest water depths.

Diet

Studies have been performed in which hellbenders were captured, transported back to the lab, and then dissected to determine dietary habits. Stomach pumping of living specimens has also been performed to determine diet. These studies demonstrated quite clearly that C. alleganiensis feeds primarily on crayfish and small fish. One report, written by a commercial collector in the 1940s, noted a trend of more crayfish predation in the summer during times of higher prey activity, whereas fish made up a larger part of the winter diet while crayfish are less active.[15] There seems to be a specific temperature range in which hellbenders feed, as well: between 45 and 80°F. Several researcher note that cannibalism—mainly on eggs—has been known to occur within hellbender populations, and one researcher claims that perhaps density is maintained—and density dependence in turn created—in part by intraspecific predation.[16][14][13]

Reproduction

The hellbenders' breeding season begins in late August or early- to mid-September and can continue as late as the end of November, depending on region. They exhibit no sexual dimorphism, except during the fall mating season, when males have a bulging ring around the cloaca glands. Unlike most salamanders, the hellbender performs external fertilization. Before mating, each male excavates a brood site, a saucer-shaped depression under a rock or log with its entrance positioned out of the direct current, usually pointing downstream. The male remains in the brood site awaiting a female. When a female approaches, the male guides or drives her into his burrow and prevents her from leaving until she oviposits.[13]

Female hellbenders lay 150-200 eggs over a two- to three-day period; the eggs are 18–20 mm in diameter, connected by 5–10 mm cords. As the female lays eggs, the male positions himself alongside or slightly above them, spraying the eggs with seminal fluid while swaying his tail and moving his hind limbs, which disperses the sperm uniformly. The male often tempts other females to lay eggs in his nest, and as many as 1,946[17] eggs have been counted in a single nest. Cannibalism, however, leads to a much lower number of eggs in hellbender nests than would be predicted by ovarian counts.[13]

After oviposition, the male drives the female away from the nest and guards the eggs. Incubating males rock back and forth and undulate their lateral skin folds, which circulates the water, increasing oxygen supply to both eggs and adult. Incubation lasts from 45–75 days, depending on region.[13] Hatchling hellbenders are 25 millimetres (0.98 in) to 33 millimetres (1.3 in) long, have a yolk sac as a source of energy for the first few months of life, and lack functional limbs.[13]

Adaptations

Hellbenders are superbly adapted to the shallow,fast-flowing rocky streams in which they live their flattened shape offers little resistance to the flowing water,allowing them to work their way upstream and also to crawl into narrow spaces under rocks.Although their eyesight is relatively poor the have light-sensitive cells all over their bodies.Those on their tail are especially finely tuned and may help them position safely under rocks without their tail poking out to give the game away.They have a good sense of smell and will move upstream in search of food such as dead fish ,following the trail of scent molecules.Smell is possibly their most important sense when hunting.They also have a lateral line simulator to that of fish,with which they can detect vibrations in the water.[18]

Conservation status

Research throughout the range of the hellbender has shown a dramatic decline in population abundance in the majority of locations. Many different anthropogenic sources have helped to create this decline, including the siltation and sedimentation, blocking of dispersal/migration routes, and destruction of riverine habitats created by dams and other development, as well as pollution, disease and overharvesting for commercial and scientific purposes.[1][3] As many of these detrimental effects have done irreversible damage to hellbender populations, it is important to conserve the remaining intact populations through protecting habitats and—perhaps in places where the species was once endemic and has been extirpated—by augmenting numbers through reintroduction.[1] Due to sharp decreases that have been seen in the Ozark subspecies, researchers have been looking at trying to differentiate C. a. alleganiensis and C. a. bishopi into two management units. Indeed, researchers found significant genetic divergence between the two groups, as well as between them and another isolated population of C. a. alleganiensis. This could be reason enough to ensure work is done on both denominations, as preserving extant genetic diversity is of crucial Ecological importance.[1]

The Ozark hellbender has been listed as an endangered species under the Endangered Species Act by the U.S. Fish and Wildlife Service on Oct. 5, 2011. This hellbender subspecies inhabits the White River and Spring River systems in southern Missouri and northern Arkansas, and its population has declined an estimated 75% since the 1980s, with only about 590 individuals remaining in the wild. Degraded water quality, habitat loss resulting from impoundments, ore and gravel mining, sedimentation, and collection for the pet trade are thought to be the main factors resulting in the amphibian's decline.[19]

The Ozark hellbender was successfully bred in captivity for the first time at the St. Louis Zoo, in a joint project with the Missouri Department of Conservation, hatching on Nov. 15, 2011.[20] The decade-long collaboration has yielded 63 larvae.[21]

Fossil record

Extant species in the Cryptobranchidae family are the modern-day members of a lineage that extends back millions of years—the earliest fossil records of a basal species date back to the Middle Jurassic and were found in volcanic deposits in northern China.[22] (This reported estimated Middle Jurassic age for the fossils has been reputed and defended multiple times, and the debate is still not fully settled).[12] These specimens are the earliest known relatives of modern salamanders, and together with the numerous other basal groups of salamanders found in the Asian fossil record, they form a concrete base of evidence for the fact that “the early diversification of salamanders was well underway” in Asia during the Jurassic period.[22] Interestingly, little has changed in the morphology of the Cryptobranchidae since the time of these fossils, leaving researchers to note “extant cryptobranchid salamanders can be regarded as living fossils whose structures have remained little changed for over 160 million years.”[22]

As the fossil record for the Cryptobranchidae shows an Asian origin for the family, the story of how these salamanders made it to the eastern U.S. has been a point of scientific interest. Research has led to a dispersal via land bridge-based theory, and scientists have gone on to note the waves of adaptive radiation that seem to have swept the Americas from north to south.[22][15]

Notes

  1. ^ a b c d e f Williams, R.D., Gates, J.T., Hocutt, C.H, and G.J. Taylor. The Hellbender: A Nongame Species in Need of Management. Wildlife Society Bulletin. Vol. 9:2 (2010) pp.94-100
  2. ^ a b c Guimond, R.W.,and V.H. Hutchison. Aquatic Respiration: An Unusual Strategy in the Hellbender Cryptobranchus alleganiensis alleganiensis (Daudin). Science, New Series. Vol. 182:4118 (1973) pp.1263-1265.
  3. ^ a b c Sabatino, S.J., and E.J. Routman. Phylogeography and conservation genetics of the hellbender salamander (Cryptobranchus alleganiensis). Conservation Genetics. (2009) Vol. 10 pp.1235-1246
  4. ^ The Hellbender[dead link]
  5. ^ Nickerson, M.A. and C.E. Mays. 1973. The hellbenders: North American giant salamanders. Milwaukee Public Museum Publications in Biology and Geology 1, 106pp.
  6. ^ Silvia Geser and Peter Dollinger. "WAZA virtual zoo". World Association of Zoos and Aquariums (WAZA). http://www.waza.org/virtualzoo/factsheet.php?id=402-003-002-001&view=Amphibia. Retrieved 2009-02-09. 
  7. ^ "Online Etymology Dictionary". Etymonline.com. http://www.etymonline.com/index.php?term=crypt. Retrieved 2011-10-18. 
  8. ^ http://mdc.mo.gov/documents/nathis/herpetol/amphibian/hellbend.pdf[dead link]
  9. ^ Gehlbach, Frederick R. Comments on the Study of Ohio Salamanders with Key to Their Identification. Journal of the Ohio Herpetological Society. (1960) Vol. 2:3 pp.40-45.
  10. ^ a b c d Crowhurst, R.S., Faries, K.M., Collantes, J., Briggler, J.T., Koppelman, J.B., and Lori S. Eggert. Genetic relationships of hellbenders in the Ozark highlands of Missouri and conservation implications for the Ozark subspecies (Cryptobranchus alleganiensis bishopi). Conservation Genetics. (2010)
  11. ^ a b c AmphibiaWeb - Cryptobranchus alleganiensis
  12. ^ Lanza, B., Vanni, S., & Nistri, A. (1998). Cogger, H.G. & R.G. Zweigel ed. Encyclopedia of Reptiles and Amphibians. San Diego: Academic Press. pp. 70–74
  13. ^ a b c d e f g h i http://www.fws.gov/midwest/eco_serv/soc/amphibians/eahe-sa.pdf Mayasich, J., Grandmaison, D., and Phillips, C. Eastern Hellbender Status Assessment Report.
  14. ^ a b c d e Peterson, C.L, Metter, D.E., Miller, B.T., Wilkinson, R.F., and M.S. Topping. Demography of the Hellbender Cryptobranchus alleganiensis in the Ozarks. American Midland Naturalist. (1988) Vol. 199:2 pp.291-303.
  15. ^ a b c d Swanson, P.L. Notes on the Amphibians of Venango County, Pennsylvania. American Midland Naturalist. (1948) Vol. 40:2 pp.362-371.
  16. ^ a b c d Humphries, W.J., and T.K. Pauley. Seasonal Changes in Nocturnal Activity of the Hellbender, Cryptobranchus alleganiensis, in West Virginia. Journal of Herpetology. (2000) Vol. 34:4 pp.604-607.
  17. ^ Chris Mattison (2005). Encyclopedia of Reptiles and Amphibians. The Brown Reference Group. p. 23. 
  18. ^ title=Encyclopedia of Reptiles and Amphibians , Author=Chris Mattison chapter=what is an amphibian? page=22 publishers=Grange books ISBN=1-84013-794-0
  19. ^ "U.S. Fish and Wildlife Service Lists the Ozark Hellbender as Endangered and Moves to Include Hellbenders in Appendix III of CITES" (Press release). U. S. Fish and Wildlife Service. 2011-10-05. http://us.vocuspr.com/Newsroom/Query.aspx?SiteName=fws&Entity=PRAsset&SF_PRAsset_PRAssetID_EQ=128569&XSL=PressRelease&Cache=True. Retrieved 2011-10-09. 
  20. ^ "Animals in the news". The Atlantic. http://www.theatlantic.com/infocus/2012/01/animals-in-the-news-0112/100225/#img15. Retrieved 17 January 2012. 
  21. ^ "Saint Louis Zoo, Missouri Department of Conservation Announce World's First Captive Breeding of Ozark Hellbenders-Salamander Numbers Drastically Down in the Wild". St. Louis Zoo. http://www.stlzoo.org/pressroom/pressreleases/hellbenderbabies. Retrieved 17 January 2012. 
  22. ^ a b c d Gao, K., and N.H. Shubin. Earliest known crown-group salamanders. Nature. (2003) Vol. 422 pp.424-428.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species exhibits low range-wide allozyme diversity and high between-population mtDNA variation (Routman 1993). A mtDNA phylogeny by Routman et al. (1994) indicated that the two subspecies of hellbenders are paraphyletic with respect to one another. Some hellbender populations in the southern Ozarks ("C. c. bishopi") are most closely related to populations of C. a. alleganiensis inhabiting the Tennessee River drainage whereas others are so divergent that phylogenetic affinities are undetectable. Extremely low levels of divergence among mtDNA haplotypes found in populations from Pennsylvania, Indiana, Illinois, and the northern Missouri Ozarks suggest a recent, probably post-Pleistocene, invasion of this region from a refugium in one of these areas." Recognition of the nominal subspecies, which are based mostly on noncategorical coloration differences, appears to be unwarranted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!