Overview

Brief Summary

Biology

Arabian oryx are gregarious animals forming herds containing five to thirty individuals (3). The herds increase in size in good conditions, however, in poor conditions the group size is usually composed of a male, a couple of females and their young (5). Other males adopt a more solitary existence and hold large territories (5). These antelope seem to be able to detect rainfall from a great distance and have an almost nomadic way of life, travelling vast areas in search of precious new growth after intermittent rains (2). Females give birth to a single calf once a year if conditions are good; births can occur in any month and calves are weaned after three and a half months of age (2). These antelope graze on grasses and herbs and will also take roots and tubers; they can go without direct water sources for long periods of time (8). Most activity occurs in the early morning and late evening with groups resting in the shade during the searing midday heat (5). Using their front hooves, oryx excavate depressions in the ground, which allow them to lie in cooler sand, and provide some protection against the fierce desert winds (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

At one time extinct in the wild, this desert antelope can once again be seen wandering the dry Arabian Peninsula. The Arabian oryx is an antelope that is highly specialised for its harsh desert environment (5). The bright white coat reflects the sun's rays (2) and the hooves are splayed and shovel-like, providing a large surface area with which to walk on the sandy ground (5). The legs are brown in colour, with white bands on the ankles, and there are also brown markings on the face, on the bridge of the nose, the cheeks and a triangular patch on the forehead (2). Arabian oryx of both sexes have magnificent straight, ringed horns that can reach up to 68 centimetres in length (2); those of the female are thinner and longer than the male (6). Males have a tuft of hair on the throat, and the tails of both sexes are tufted at the ends (6) and dark brown/black on the lower half (2). Arabian oryx calves are brown with markings on their tail and knees (6), gaining adult markings by six months (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

The Arabian Oryx (Oryx leucoryx) is the only native oryx species outside Africa. It is one of two oryx species that went extinct in the wild (the other being the Scimitar-horned Oryx, Oryx dammah).  Both sexes have long, slender horns pointed upward and slightly back that are narrower at the base than those of other oryx species. Although this species was extinct in the wild by 1972, since then free-ranging populations have been established in Israel, Oman, and Saudi Arabia. Arabian Oryx were formerly present throughout the Arabian Peninsula, extending north to Israel, Jordan, Kuwait, Iraq, Syria, and Sinai. Poaching and overhunting in Oman eliminated the last wild individuals. Fortunately, captive breeding efforts had begun in the 1950s and reintroduction efforts began in the early 1980s and are ongoing. The world captive population is around 6,000 to 7,000, but the re-introduced free-ranging populations include only around 250 mature individuals.

(Kingdon 1997; Groves 2011)

  • Groves, C.P. 2011. Genus Oryx. Pp. 688-692 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Arabian Oryx formerly occurred through most of the Arabian Peninsula, north to Kuwait and Iraq. The species' range had already contracted by the early years of the 20th century and the decline accelerated thereafter. Before 1920, oryx distribution was separated into areas over 1,000 km apart: a northern population in and around the Nafud, and a larger southern population in the Rub Al Khali and the plains of central-southern Oman. Oryx disappeared from the north in the 1950s. In the south, their range steadily decreased due to hunting, and by the 1960s oryx were restricted to parts of central and southern Oman. The last wild individuals were probably shot in 1972 on the Jiddat al Harasis.

Arabian Oryx have been reintroduced to Oman (Arabian Oryx Sanctuary, from 1982); Saudi Arabia (Mahazat as-Sayd Reserve, 2,244 km² from 1990; Uruq Bani Ma’arid Reserve, 12,000 km² from 1995), Israel (three sites in the Northern Arava and Negev Desert, from 1997); United Arab Emirates (Arabian Oryx Reserve, Abu Dhabi, from 2007); and Jordan (Wadi Rum, beginning 2009).

Reintroductions in Kuwait, Iraq and Syria have also been proposed. There is a small introduced population on Hawar Island, Bahrain and large semi-managed populations at several sites in Qatar and UAE.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range

Once widespread on the Arabian Peninsula, reaching north into Israel, Jordan, Iraq, Syria and Sinai in Egypt (8). The last wild oryx was shot in 1972 and the species persisted only in captivity for a decade (8). The first herd was released into a small enclosure in the late 1970s, followed by release into the wild in Oman in 1982; the population has subsequently grown and a further introduction has been made in Saudi Arabia (6). Another re-introduction to the wild is planned for the Wadi Rum area in Jordan (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Geographic Range

Oryx leucoryx were originally found in Syria, Iraq, Israel, Jordan, Sinai, and the Arabian Peninsula (Nowak, 1999; Wilson and Reeder, 1993).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Historic Range:
Arabian Peninsula

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Head and body length of O. leucoryx varies from 1,530 to 2,350 mm. Tail length is 450-900 mm, and shoulder height is 900-1,400 mm. A mane extends from the head to the shoulders and the tail is tufted. Males also have a tuft of hair on the throat. Both sexes have horns ranging from 600-1,500 mm in length. They are fairly straight and are directed backwards from the eyes. The horns of females are usually longer and thinner than the horns of males. In general, the coloration of adults varies from cream to grays and browns and they may have striking markings of black and brown as well. The young are shades of brown and have markings only on their tails and knees (Nowak, 1999).

Range mass: 100 to 210 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits sandy and stony deserts.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Usually O. leucoryx are found in arid plains and deserts, however they have also been found to inhabit rocky hillsides and thick brush. Their habitat according to Nowak (1999) consists of "flat and undulating gravel plains intersected by shallow wadis and depressions and the dunes edging sand deserts with a diverse vegetation of trees, shrubs, and grasses."

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits the arid plains and deserts of Arabia, where temperatures even in the shade can reach as much as 50ºC in the summer months (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

O. leucoryx feed on diverse types of grasses and shrubs found in their arid habitat. They go to streams and water holes to drink. When free water is not available, they can obtain moisture from sources such as melons and succulent bulbs which is sufficient for lengthy periods of time.

An introduced herd of O. leucoryx in Jordan was observed to have become active just after dawn, they grazed until about 1000hrs, rested from 1400hrs to 1500hrs, grazed again, then began to move toward a sleeping area around sunset (Nowak, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
20.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.8 years (captivity) Observations: In captivity, these animals can live up to 20.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproductive timing in O. leucoryx varies. However, in favorable conditions, a female can produce a calf once a year during any month. Most births among introduced herds in Oman and Jordan occur from October to May. Gestation period in this species is about 240 days. Young are weaned by 4.5 months, and captive females initially give birth at age 2.5-3.5 years. The potential longevity of these animals seems to be about 20 years (Nowak, 1999).

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 8 (low) months.

Average gestation period: 8 months.

Range weaning age: 4.5 (high) months.

Average weaning age: 4.5 months.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
794 days.

Parental Investment: post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oryx leucoryx

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGATATCGGTACCTTATACCTCCTATTCGGTGCTTGAGCTGGCATAGTGGGAACCGCCCTAAGCTTACTAATTCGCGCTGAATTAGGCCAACCTGGAACTTTACTTGGAGATGATCAAATCTACAACGTAGTCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCTATTATGATTGGAGGGTTTGGCAACTGACTAGTCCCTCTAATAATTGGAGCCCCCGACATAGCATTCCCTCGAATAAACAATATAAGCTTTTGACTACTTCCTCCTTCTTTTCTACTACTCCTAGCATCTTCTATAGTTGAGGCTGGAGCCGGAACAGGTTGAACTGTATATCCCCCTCTAGCTGGCAACCTAGCCCATGCAGGAGCCTCAGTAGATCTCACTATTTTCTCTTTACACTTAGCAGGTGTTTCCTCAATTCTAGGAGCCATCAATTTTATCACAACAATCATTAACATAAAACCCCCTGCAATAACACAATATCAAACTCCCTTGTTTGTATGATCTGTACTAATTACTGCTGTTTTACTTCTCCTTTCACTCCCTGTGTTAGCAGCCGGCATTACAATATTATTAACAGATCGAAACCTAAATACAACCTTCTTTGACCCGGCAGGAGGGGGGGACCCTATCTTATATCAACATCTGTTCTGATTCTTTGGTCACCCTGAAGTATACATCCTTATTCTACCTGGATTCGGAATGATTTCTCATATCGTAACCTACTACTCAGGAAAAAAAGAACCATTCGGGTATATGGGAATAGTGTGGGCTATGATATCAATCGGATTCCTGGGGTTCATCGTATGAGCTCATCACATATTCACAGTCGGAATAGACGTCGACACACGAGCCTACTTTACATCAGCTACCATAATTATTGCCATCCCAACCGGAGTAAAAGTCTTTAGCTGACTAGCAACACTCCATGGAGGTAATATCAAATGATCTCCTGCTATAATATGGGCCCTAGGCTTTATTTTCCTCTTCACAGTTGGAGGCCTAACTGGAATTGTCCTAGCCAACTCTTCTCTTGATATTGTTCTTCATGATACATATTATGTAGTCGCACATTTTCACTATGTCCTATCAATAGGAGCTGTATTCGCTATCATAGGAGGATTTGTACATTGATTTCCACTATTCTCAGGCTATACCCTGAACATAACATGAGCCAAAATCCATTTCGCAATTATGTTTGTAGGCGTAAACATAACATTCTTCCCGCAACACTTCTTAGGCTTATCTGGCATGCCACGACGATATTCTGATTATCCAGACGCATACACGATGTGAAATACTATCTCATCTATAGGCTCATTTATTTCACTAACAGCAGTAATACTAATAATTTTTATTATCTGAGAGGCATTTGCATCCAAACGGGAAGTCTCAACCGTAGACCTAACCTCAACTAACCTAGAGTGACTAAACGGATGTCCTCCACCATACCACACATTTGAAGAACCCGCATATGTAAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oryx leucoryx

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D1

Version
3.1

Year Assessed
2011

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D. & Hoffmann, M.

Contributor/s

Justification

The 2008 assessment noted that Arabian Oryx no longer qualified for the Endangered category under criterion D on the basis of increasing numbers, and that Vulnerable D1 was appropriate and would have applied from 2006. Under IUCN Red List Guidelines, a species only moves to a lower category of threat if none of the criteria for the higher category (here Endangered) have been met for a period of five years or more. As this remains the case with Arabian Oryx, the transfer to Vulnerable should take effect from 2011.

Although numbers in the largest population (Mahazat as Sayd in Saudi Arabia) fell between 1998 and 2008 due to drought-related mortality, they have since stabilized. The total reintroduced population is now ca.1,000, so well over the threshold of 250 mature individuals needed to qualify for Endangered under criterion D. The population is stable or increasing and the area of occupancy is also increasing as oryx are released into new sites.


History
  • 2003
    Endangered
    (IUCN 2003)
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

O. leucoryx is also classified as endangered by the USDI.

The last known individuals in the wild were killed in 1972, and there are unconfirmed reports from as late as 1979. However, in the 1950's efforts were made in several Arabian countries to establish captive herds. In 1962, some Arabian oryx were taken from the wild and were brought to the U.S. These animals served as the foundation of an international breeding effort and for reintroductions into the wild in Oman in 1982, Jordan in 1983, and central Saudi Arabia in 1990. There are now approximately 500 individuals in the wild, 300 in captivity on the Arabian Peninsula, and 2,000 held elsewhere (such as the Phoenix and San Diego zoos). Despite the former severe reduction of the species, its current genetic variability is considered normal (Nowak, 1999; Wilson and Reeder, 1993; Burton, 1987).

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Status in Egypt

Extinct.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Oryx leucoryx , see its USFWS Species Profile

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Population

Population
Current total population is estimated at approximately 1,000: Oman (approximately 50); Saudi Arabia (approximately 600: 400 in Mahazat as Sayd and 200 in Uruq Bani Ma’arid); United Arab Emirates (approximately 200), Israel (over 100) and Jordan (c.50). The population in Oman reached a high point of 450 before illegal live capture began and severely reduced numbers. Now only males remain. In Saudi Arabia, numbers are roughly stable in Uruq Bani Ma’arid, but have declined in Mahazat As Sayd, which is completely fenced and where animals have exceeded carrying capacity. There has been a slow, but steady increase in the Israeli population. Numbers in the Arabian Oryx Reserve, Abu Dhabi are also increasing slowly.

An estimated 6,000-7,000 animals are held in captivity worldwide, mostly within the region. Some of these are maintained in large fenced enclosures, including those in Qatar, Saudi Arabia, Syria (Al Talila Reserve) and UAE.

Current population trend is stable or increasing slowly.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The Oman population has been devastated by illegal live capture for sale to private collections and has been rendered totally ineffective. Some poaching has been recorded in Uruq Bani Ma’arid. Other populations in protected areas are generally secure from poaching but the security of animals that wander outside release sites cannot be guaranteed, except perhaps in Israel. Drought and overgrazing have reduced habitat quality in places and limited the choice of potential release further release sites.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Bedouin people of the Arabian Peninsula traditionally hunted Arabian oryx for their meat and hides. The total decimation of the species did not occur until after the Second World War however, with the availability of firearms and motorised transport (5), and the demand for sport hunting (10). The species became extinct in the wild in 1972 when the last recorded animal was shot (8). Following the success of re-introduced herds during the 1990s, poaching once again became a serious threat although it has been controlled in recent years (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Protective legislation in all countries with reintroduced populations is adequate. Almost all released animals occur in protected areas. Captive population is well-managed, with an international studbook. In addition, large numbers are kept in private collections, especially in Qatar, UAE and Saudi Arabia. The Environment Agency – Abu Dhabi is funding the reintroduction into Jordan and is considering releases in Iraq. A regional Arabian Oryx conservation strategy was developed in 2007. The Coordinating Committee for the Conservation of the Arabian Oryx is an inter-governmental body charged with coordination of conservation efforts within the Arabian Peninsula. It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The rescue of the Arabian oryx began in early 1960s when Fauna and Flora International had the foresight to capture wild oryx and transfer them to Phoenix Zoo in Arizona (8). Operation Oryx, as it became known, succeeded in establishing a large captive herd in the USA that could later be used for re-introductions (5). The first herds were released in Oman at Jaaluni in the Jiddat-al-Harasis in 1982 (8), over the years the wild population became firmly established and by 1996 numbered over 400 animals (11). Poaching since 1996 has decreased numbers again (5), but the re-introduction of the Arabian oryx still represents a remarkable conservation success story and an example of what international cooperation can achieve.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These animals could cause a negative effect on humans if their habitats overlap as oryx may consume crop plants. However, historically this has not been the case (Nowak, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

O. leucoryx have many positive benefits for humans. The meat is greatly appreciated, their hides are valued for leather, and other parts have alleged medicinal uses. The head is also highly valued as a trophy (Nowak, 1999).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Arabian oryx

The Arabian oryx (Oryx leucoryx) or white oryx is a medium-sized antelope with a distinct shoulder bump, long, straight horns, and a tufted tail.[2] It is a bovid, and the smallest member of Oryx genus, native to desert and steppe areas of the Arabian Peninsula. The Arabian oryx was extinct in the wild by the early 1970s, but was saved in zoos and private preserves and reintroduced into the wild starting in 1980.

In 1986, the Arabian oryx was classified as endangered on the IUCN Red List, and in 2011 it was the first animal to revert to Vulnerable status after previously being listed as extinct in the wild. It is listed in CITES Appendix I. In 2011, populations were estimated at over 1000 individuals in the wild, and 6000–7000 individuals in captivity worldwide.

A Qatari oryx named "Orry" was chosen as the official games mascot for the 2006 Asian Games in Doha,[3] and is shown on tailwings of planes belonging to Middle Eastern airline Qatar Airways.

Contents

Etymology [edit]

The taxonomic name Oryx leucoryx is from the Greek orux (gazelle or antelope) and leukos (white). The Arabian oryx is also called the white oryx in English, and is known as maha, wudhaihi, baqar al wash, and boosolah in Arabic.[4]

Russian zoologist Peter Simon Pallas introduced "oryx" into scientific literature in 1767, applying the name to the African eland as Antilope oryx (Pallas, 1767). In 1777, he transferred the name to the Cape gemsbok. At the same time, he also described what we now call the Arabian oryx as Oryx leucoryx, giving its range as "Arabia, and perhaps Libya." In 1816, Henri Marie Ducrotay de Blainville subdivided the antelope group, adopted Oryx as a genus name, and changed the Antilope oryx of Pallas to Oryx gazella (de Blainville, 1818). In 1826, Martin Lichtenstein confused matters by transferring the name Oryx leucoryx to the scimitar-horned oryx (now Oryx dammah) which was found in the Sudan by the German naturalists Wilhelm Friedrich Hemprich and Christian Gottfried Ehrenberg (Lichtenstein, 1826). The Arabian oryx was then nameless until the first living specimens in Europe were donated to the Zoological Society of London in 1857. Not realizing this might be the Oryx leucoryx of previous authors, Dr. John Edward Gray proposed calling it Oryx beatrix after HRH the Princess Beatrice of the United Kingdom (Gray, 1857). Though this name was to persist for many years, Oldfield Thomas renamed the scimitar-horned oryx as Oryx algazal in 1903 (it has since been renamed Oryx dammah), and gave the Arabian oryx back its original name. The confusion between the two species has been exacerbated because both have been called white oryx in English.[4]

Anatomy and morphology [edit]

Arabian oryx in the western region of Abu Dhabi

An Arabian oryx stands about 1 m (39 in) high at the shoulder and weighs around 70 kg (150 lb). Its coat is an almost luminous white, the undersides and legs are brown, and black stripes occur where the head meet the neck, on the forehead, on the nose and going from the horn down across the eye to the mouth. Both sexes have long, straight or slightly curved, ringed horns which are 50 to 75 cm (20 to 30 in) long.

Arabian oryx rest during the heat of the day and can detect rainfall and will move towards it, meaning they have huge ranges; a herd in Oman can range over 3,000 km2 (1,200 sq mi). Herds are of mixed sex and usually contain between two and 15 animals, though herds of up to 100 have been reported. Arabian oryx are generally not aggressive toward one another, which allows herds to exist peacefully for some time.[5]

Other than humans, wolves are the Arabian oryx's only predator. In captivity and good conditions in the wild, oryx have a life span of up to 20 years.[6] In periods of drought, though, their life expectancy may be significantly reduced by malnutrition and dehydration. Other causes of death include fights between males, snakebites, disease, and drowning during floods.[7]

Distribution and habitat [edit]

Historically, the Arabian oryx probably ranged throughout most of the Middle East. In the early 1800s, they could still be found in the Sinai, Israel, the Transjordan, much of Iraq, and most of the Arabian Peninsula. During the 19th and early 20th centuries, their range was pushed back towards Saudi Arabia, and by 1914, only a few survived outside that country. A few were reported in Jordan into the 1930s, but by the mid-1930s, the only remaining populations were in the Nafud Desert in northwestern Saudi Arabia and the Rub' al Khali in the south.[2]

In the 1930s, Arabian princes and oil company clerks started hunting Arabian oryx with automobiles and rifles. Hunts grew in size, and some were reported to employ as many as 300 vehicles. By the middle of the 20th century, the northern population was effectively extinct.[2] The last Arabian oryx in the wild prior to reintroduction were reported in 1972.[8]

Arabian oryx prefer to range in gravel desert or hard sand, where their speed and endurance will protect them from most predators, as well as most hunters on foot. In the sand deserts in Saudi Arabia, they used to be found in the hard sand areas of the flats between the softer dunes and ridges.[2]

Arabian oryx have been reintroduced to Oman, Saudi Arabia, Israel, United Arab Emirates, and Jordan. A small population was introduced on Hawar Island, Bahrain and large semimanaged populations at several sites in Qatar and the UAE. The total reintroduced population is now estimated to be around 1,000. This puts the Arabian oryx well over the threshold of 250 mature individuals needed to qualify for Endangered.[1]

Ecology [edit]

Feeding ecology [edit]

Arabian oryx, Antelope Ranch, Israel

The diets of the Arabian oryx consist mainly of grasses, but they will eat a large variety of vegetation, include trees, buds, herbs, fruit, tubers and roots. Herds of Arabian oryx follow infrequent rains to eat the new plants that grow afterward. They can go several weeks without water.[5] Research in Oman has found grasses of the genus Stipagrostis are primarily taken; flowers from Stipagrostis plants appeared highest in crude protein and water, while leaves seemed a better food source with other vegetation.[9]

Behavioral ecology [edit]

When the oryx is not wandering its habitat or eating, it digs shallow depressions in soft ground under shrubs or trees for resting. They are able to detect rainfall from a distance and follow in the direction of fresh plant growth. The number of individuals in herd can vary greatly (up to 100 have been reported occasionally), but the average is 10 or fewer individuals.[10] Bachelor herds do not occur, and single territorial males are rare. Herds establish a straightforward hierarchy that involves all females and males above the age of about seven months.[11] Arabian oryx tend to maintain visual contact with other herd members, subordinate males taking positions between the main body of the herd and the outlying females. If separated, males will search areas where the herd last visited, settling into a solitary existence until the herd's return. Where water and grazing conditions permit, male oryx establish territories. Bachelor males are solitary.[6] A dominance hierarchy is created within the herd by posturing displays which avoid the danger of serious injury their long, sharp horns could potentially inflict. Males and females use their horns to defend the sparse territorial resources against interlopers.[12]

Importance to humans [edit]

The Arabian oryx is the national animal of Jordan and Qatar.

The Hebrew word re’em may refer to the Arabian oryx, although this word could also refer to the extinct aurochs, or some other type of horned mammal. In the King James Version of the Bible, the word re’em is translated as unicorn.

Unicorn myth [edit]

The mythical unicorn may have originated in part from the Arabian oryx, which can appear to have only one horn when seen in profile.[13]

An alternative origin of the mythical one-horned unicorn may have been from sightings of an injured oryx; Aristotle and Pliny the Elder held that the oryx was the unicorn's "prototype".[14] From certain angles, the oryx may be mistaken as having one horn instead of two,[15] and given that its horns are made from hollow bone which cannot be regrown, if an oryx were to lose one of its horns, for the rest of its life it would have only one horn.[14]

Conservation [edit]

Arabian oryx in Zoo Dvůr Králové, Czech Republic

The Phoenix Zoo and the Fauna and Flora Preservation Society of London (now Fauna and Flora International), with financial help from the World Wildlife Fund, are credited with saving the Arabian oryx from extinction. In 1962, these groups started the first captive-breeding herd in any zoo, at the Phoenix Zoo, sometimes referred to as "Operation Oryx".[16][17] Starting with 9 animals, the Phoenix Zoo has had over 200 successful births. From Phoenix, oryx were sent to other zoos and parks to start new herds.

Arabian oryx were hunted to extinction in the wild by 1972. By 1980, the number of Arabian oryx in captivity had increased to the point that reintroduction to the wild was started. The first release, to Oman, was attempted with oryx from the San Diego Wild Animal Park.[8] Although numbers in Oman have declined, there are now wild populations in Saudi Arabia and Israel,[18][19] as well. One of the largest populations is found in Mahazat as-Sayd Protected Area, a large, fenced reserve in Saudi Arabia, covering more than 2000 km2.[1]

In June 2011, the Arabian oryx was relisted as vulnerable by the IUCN Red List. The IUCN estimated more than 1000 Arabian oryx in the wild, with 6000–7000 held in captivity worldwide in zoos, preserves, and private collections. Some of these are in large, fenced enclosures (free-roaming), including those in Syria (Al Talila), Bahrain, Qatar, and UAE.[1] This is the first time the IUCN has reclassified a species as vulnerable after it had been listed as extinct in the wild.[20] The Arabian oryx is also listed in CITES Appendix I.[21]

On June 28, 2007, Oman's Arabian Oryx Sanctuary was the first site ever to be removed from the UNESCO World Heritage List. UNESCO's reason for this was the Omani government's decision to open 90% of the site to oil prospecting. The Arabian oryx population on the site has been reduced from 450 in 1996 to only 65 in 2007. Now, fewer than four breeding pairs are left on the site.[22]

See also [edit]

References [edit]

  1. ^ a b c d IUCN SSC Antelope Specialist Group (2011). Oryx leucoryx. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 20 June 2011. Database entry includes justification for why this species is listed as Vulnerable.
  2. ^ a b c d Talbot, Lee Merriam (1960). A Look at Threatened Species. The Fauna Preservation Society. pp. 84–91. 
  3. ^ "Mascot of Asian Games 2006". Travour.com. Archived from the original on 16 February 2008. Retrieved 2008-02-07. 
  4. ^ a b "Conservation Programme for Arabian Oryx: Taxonomy & description". National Wildlife Research Center. 2007. Retrieved 2009-11-15. 
  5. ^ a b Paul Massicot (2007-02-13). "Arabian Oryx". Animal Info. Archived from the original on 25 January 2008. Retrieved 2008-01-11. 
  6. ^ a b "Arabian Oryx". The Phoenix Zoo. Archived from the original on 15 February 2008. Retrieved 2008-01-27. 
  7. ^ "The Oryx Facts". The Arabian Oryx Project. Archived from the original on 12 January 2008. Retrieved 2008-01-27. 
  8. ^ a b Stanley-Price, Mark (July/August 1982). "The Yalooni Transfer". saudiaramcoworld.com. Saudi Aramco World. Archived from the original on 10 June 2011. Retrieved 31 December 2012. 
  9. ^ Spalton, J. A. (1999). "The food supply of Arabian oryx (Oryx leucoryx) in the desert of Oman". Journal of Zoology 248 (248): 433–441. doi:10.1111/j.1469-7998.1999.tb01043.x. 
  10. ^ Leu, H. (2001) "Oryx leucoryx" (On-line), Animal Diversity Web.
  11. ^ How to go wild. New Scientist (1989-10-28). Retrieved on 2013-01-01.
  12. ^ Science & Nature – Wildfacts – Arabian oryx. BBC (2012-04-27). Retrieved on 2013-01-01.
  13. ^ "Arabian Oryx". Natural History Museum of Los Angeles County. Archived from the original on 2007-10-10. Retrieved 2008-01-25. 
  14. ^ a b Rice, Michael (1994). The archaeology of the Arabian Gulf, c. 5000–323 BC. Routledge. p. 63. ISBN 0415032687. 
  15. ^ Tongren, Sally (1981). What's for lunch: animal feeding at the zoo. GMG Publications. 
  16. ^ The Arabian Oryx Project – Timeline. oryxoman.com
  17. ^ Phoenix Zoo Species Survival Plan. Phoenixzoo.org (2006-01-03). Retrieved on 2013-01-01.
  18. ^ Saltz, D. (1998). "A long-term systematic approach to planning reintroductions: the Persian fallow deer and the Arabian oryx in Israel". Animal Conservation 1 (4): 245. doi:10.1111/j.1469-1795.1998.tb00035.x. 
  19. ^ Gilad, O., Grant, W.E., and Saltz, D. (2008). "Simulated dynamics of Arabian Oryx (Oryx leucoryx) in the Israeli Negev: Effects of migration corridors and post-reintroduction changes in natality on population viability". Ecological Modelling 210: 169. doi:10.1016/j.ecolmodel.2007.07.015. 
  20. ^ Platt, John (17 June 2011). "Arabian Oryx Makes History as First Species to Be Upgraded from "Extinct in the Wild" to "Vulnerable"". scientificamerican.com. Retrieved 20 June 2011. 
  21. ^ "Appendices I, II and III". cites.org. CITES. Retrieved 20 June 2011. 
  22. ^ "Oman's Arabian Oryx Sanctuary: first site ever to be deleted from UNESCO's World Heritage List". UNESCO World Heritage Centre. Archived from the original on 18 January 2008. Retrieved 2008-01-16. 

Further reading [edit]

  • Silverberg, Robert (1967). The Auk, the Dodo, and the Oryx: Vanished and Vanishing Creatures. New York: Thomas Y. Crowell Company. LCCN 67002554. L.C. Card AC 67-10476;. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!