Overview

Brief Summary

Species Abstract

Oryx gazella (common name Gemsbok) is a large antelope distributed in southwestern Africa, whose range has been considerably diminished (a) in the country of South Africa due to human overpopulation, habitat destruction and overhunting; and in (b) southern Angola from destabilizing warfare which occurred in the latter part of the twentieth century when Russia and Cuba sent in large numbers of troops in an attempt to destabilise the region.

This species is well adapted to the harsh arid and semi-arid environments of the region, with morphological dentition features enabling both grazing and browsing, and remarkable thermo-regulatory physiology that prevents dehydration in these environments. The total population of O. gazella is estimated at approximately 370,000 individuals.

Distribution and subspecies

Native distribution includes the majority of Namibia and Botswana, along with vestigial populations in southwest Angola and extreme northwestern South Africa. The range was much more extensive in western South Africa and southern Angola even one century ago. The human population explosion in South Africa, with attendant habitat destruction, overhunting and habitat fragmentation has decimated most of the native population in that country. In Angola, more recent warfare surrounding the Russian financed Cuban mercenaries, with attendant neglect of wildlife conservation in the latter part of the twentieth century has created considerable species decline.

The majority of the native range is populated by O. gazella gazella, the Kalahari gemsbok; however, the Angolan population is generally considered to be the subspecies O. gazella blainei, the Angolan gemsbok.

There are non trivial introduced populations of O. gazella in western Zimbabwe (Wilson & Reeder. 1993) and in the White Sands Missile Range, New Mexico in the USA.

Morphology

Oryx gazella is a sizable bovid exhibiting a thick, muscular neck, overlain by dense, inelastic skin. O. gazella is, in fact, the most massive species within the genus Oryx. This antelope stands 1.15 to 1.25 meters high at the shoulder, and presents a tail to nose tip body length of 1.80 and 1.95 meters, with males being slightly larger than females. The female body mass ranges from about 178 to 225 kilograms, while the male body mass is from approximately 180 and 240 kilograms.

Gemsboks have the ability to increase their internal body temperature as high as 45 degrees Celsius, as a mechanism to cope with high environmental temperatures and as a means of coping with evaporative water loss in its arid habitats. Tissues in its large nose present a means of cooling this large animal, by exposing a large area of veined tissue to the surrounding air.

The dentition of O. gazella is well adapted to cropping the short tough desert grasses, with a wide row of incisors and high crowned molars. (Archer & Sanson. 2002)

Habitat

Preferred habitat for this antelope is semi-arid and arid desert, bushveldt and grassland, including harsh environments of the Kalahari and Namib Deserts. (World Wildlife Fund & Hogan. 2012) O. gazella may be found on stony plains, sand dunes, rocky slopes and alkaline flats. It may travel considerable distances to drink from springs and visit natural salt deposits or salt licks. The typical altitude range of this species is from approximately 800 to 1300 meters above sea level.

This herbivore chiefly consumes its food by grazing, but during the dry season their palette is broadened to include a greater fraction of browse vegetation such as acacia pods. Adapting to arid environments has involved the ability to consume water rich foods such as bulbs, roots, tubers and tsama melons. (Sponheimer et al. 2003) The subsurface varieties of these foods it acquires by skillful excavation. (SSC Antelope Specialist Group. 2008)

  • C.Michael Hogan. 2012. ''Species account for Oryx gazella". Globaltwitcher. ed. N.Stromberg
  • D. Archer and G. Sanson. 2002. Form and function of the selenodont molar in southern African ruminants in relation to their feeding habits. Journal of Zoology, 257: 13-26
  • J. Kingdon. 1997. The Kingdon Field Guide to African Mammals. San Diego: Academic Press.
  • Don E.Wilson and DeeAnn M. Reeder, eds. 1993. Mammal Species of the World: A Taxonomic and Geographic Reference, 2nd ed., 3rd printing. xviii + 1207
  • M. Sponheimer, J. Lee-Thorp, D. DeRuiler, J. Smith, N. Van Der Merwe, K. Reed, C. Grant, L. Ayliffe, T. Robonson, C. Heidelberger, M. Warren. 2003. Diets of Southern African Bovidea: Stable Isotope Evidence. Journal of Mammalogy, 82(2): 471-479.
  • SSC Antelope Specialist Group. 2008. Oryx gazella. In: IUCN Red List of Threatened Species
  • World Wildlife Fund and C.Michael Hogan. 2012. Kalahari Xeric Savanna. Encyclopedia of Earth. Ed. M. McGinley. National Council for Science and the Environment. Washington DC
Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Description

The most distinctive features of this heavily built antelope are its long, rapier-shaped horns and striking black and white facial markings (2). The beautiful horns of the gemsbok are sought after as charms in many cultures and were even sold as unicorn horns in medieval England (3). The body is fawn-grey with a black stripe along the side separating the upperparts from the white underparts (2). There are five subspecies of Oryx gazella including the gemsbok (Oryx gazella gazella), the beisa oryx (O.g. beisa) and the fringe-eared oryx (O.g. callotis) (4). The gemsbok has a broader black side stripe than the beisa and fringe-eared oryx, and also has more extensive black on its upper legs (2). The fringe-eared oryx can be distinguished from the beisa oryx by the long tufts of hair growing from the tips of the ears, from which it gets its name (2). All subspecies have long, horse-like tails, and whilst both sexes possess the impressive horns, those of the male are shorter and more robust than the female's. Gemsbok calves lack any black body markings (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The gemsbok is remarkably adapted to its arid environment; particularly noteworthy is its ability to survive without drinking water for most of the year (5). It conserves water within its body by lying in the shade during the hottest part of the day, and restricts activity to early mornings, late afternoons or the cool nights. The gemsbok does not waste precious moisture on panting or sweating, but instead allows its body temperature to rise by a few degrees above normal on hot days (5). Gemsboks are gregarious animals, usually found in herds of up to 30 individuals (2), but occasionally herds of several hundred animals can be encountered as they move to fresh grazing grounds (2). Gemsbok feed primarily on grass but when this is not available they will browse on shrubs, trees and herbs (6). During periods of drought, they obtain moisture from roots and tubers which are dug up with their hooves (6). From the age of five or six, male gemsboks establish territories. These territories are around 25 square kilometres and may be defended for up to three years (2). During this period, the male rounds up herds of females and young gemsbok into his territory to gain sole mating rights with receptive females (2). Single calves are born to females older than two years (5), after a pregnancy of around 264 days (6). The calf remains hidden during the day, but may venture out at night with the mother to a new site. At three to six weeks of age, the calf will join the herd (2). Gemsboks have a lifespan of around twenty years (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

Range Description

The Gemsbok formerly occurred widely in the semi-arid and arid bushland and grassland of the Kalahari and Karoo and adjoining regions of southern Africa, with a marginal intrusion into south-west Angola (East 1999; Knight in press). The extensive contraction of its distribution and decline of its numbers which accompanied the expansion of human activities in Southern Africa during the 19th and 20th centuries have been partly compensated in the last 10 - 20 years by the widespread reintroduction of Gemsbok to private land and protected areas. Today, they remain widely, albeit patchily, distributed in south-western southern Africa, although populations in Angola are now considered extirpated, even from the former stronghold in Iona N.P. (East 1999). They have also been introduced in small numbers to areas outside their natural range, such as private game ranches in Zimbabwe (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southwestern Angola (extirpated?), Botswana, Namibia, northern South Africa, and western Zimbabwe (Grubb, in Wilson and Reeder 2005). Introduced in the White Sands area of New Mexico (Reid and Patrick 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

O.g. gazella has an extensive distribution in south-west Africa, O.g. beisa has a widespread but fragmented distribution in the Horn of Africa, whilst O.g. callotis has the most limited distribution, in eastern Kenya and north-east Tanzania (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Gemsbok are large bovids with very thick, muscular necks, covered in dense, inelastic skin. Oryx gazella is the largest of the Oryx species. Gemsbok measure 115 to 125 cm high at the shoulder, and have total body lengths between 180 and 195 cm. Females weigh from 180 to 225 kg, whereas males are slightly larger, weighing between 180 and 240 kg. The slightly curved, ringed horns range from 60 to 150 cm in length. The horns of females are often shorter and more slender than those of males.

Black markings on the face extend down from the base of the horns to above the muzzle, and sweep back in stripes over the eyes and cheeks. Black continues down the neck and around the underbody, forming bands around all four legs. A stripe also runs up the spine, starting at the tip of the tail and ending at a short thick mane of black. There are black markings on the front of all four legs. The lower portion of the legs, muzzle, and underbelly are all white, whereas the body and neck are a gray or tan color. In instances of high productivity grazing, fat deposits under the skin become noticeable.

Inidividuals in northern populations have characteristic black tufts on the ears and are generally darker in color with thinner black markings than are individuals from southern populations.

Gemsbok are able to increase their body temperature to 45 degrees from 35.7 degrees C in order to delay evaporative cooling.

Range mass: 180 to 240 kg.

Range length: 180 to 195 cm.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adapted to waterless wastelands uninhabitable for most large mammals, Gemsboks inhabit semi-arid and arid bushland and grassland of the Kalahari and Karoo and adjoining regions of Southern Africa. They are is equally at home on sandy and stony plains and alkaline flats. It ranges over high sand dunes and climbs mountains to visit springs and salt licks.

Although they are predominantly grazers, they broaden their diets in the dry season to include a greater proportion of browse, ephemerals and Acacia pods. They drink water regularly when available, but can get by on water-storing melons, roots, bulbs, and tubers, for which it digs assiduously. Adaptations to living in a desert environment are summarized by Knight (in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gemsbok are found at elevations from 900 to 1,200 meters, in wooded grasslands as well as wetter grasslands. They can survive in areas of low productivity. Gemsbok prefer stony plains with at least limited water access, but can subsist in areas of dunes, rocky mountainous areas, and arid habitats with little seasonal water. Gemsbok also frequent open areas more than areas with increased tree density.

Range elevation: 900 to 1200 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

  • Estes, R. 1991. The Behavior Guide to African Mammals. Berkely: The University of California Press.
  • Clark, R., L. Clark. 2005. "Cruiser Safari" (On-line). Gemsbok Information. Accessed February 15, 2005 at http://www.cruisersafaris.com/animals/gemsbok.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Generally on arid plains.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gemsboks generally occur in semi-arid to arid grasslands and bushlands, but also inhabit light woodland and, in the southern part of its range, sand dunes (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Although generally a grazer, O. gazella will revert to browsing during droughts or whenever grasses are not available. These animals will also dig up to a meter to find tubers and roots. These, supplemented with wild tsama melons and cucumbers, provide all the water needed to sustain gemsbok (approximately three liters per 100 kg daily).

The dentition is highly adapted to cutting coarse desert grasses short, with high crowned molars and a wide incisor row. Desert dwellers can eat dry grass, but prefer green grasses. Activity at dawn and dusk allow for the consumption of the condensation present on the grasses.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; fruit

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Gemsbok exploit areas that few other animals can inhabit; they tend not to interact with many other species. Also, because they are nomadic, they tend not to overgraze areas.

In regions of the North American Southwest where gemsbok (and other exotic species) have been introduced, overgrazing has occurred, leading to the degradation of the areas populated by these herds.

Ecosystem Impact: biodegradation

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Top predators of African grasslands are threats to the gemsbok. These include lions, cheetahs, leopards, and spotted hyenas. Even hunting dogs will attack them. Humans occasionally hunt these animals. The primary response to predation is flight, despite impressive weaponry. The young are typically targeted, since attacking the adults involves a risk of puncture wounds. However, it is debatable whether or not fatal stab wounds have ever been inflicted upon a predator, or whether predators show any avoidance of gemsbok in general. Predation may account for the high mortality rate in young. In the northern part of their range, 80% of spotted hyena kills are gemsbok calves.

Known Predators:

  • lions
  • cheetahs
  • leopards
  • spotted hyenas
  • hunting dogs
  • humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Basically gregarious, with herds of up to dozens or hundreds; herds may be allfemale or all male; males sometimes are solitary and territorial (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication is particularly evident through dominance displays and aggressive behaviors. However, more subtle communication is conveyed by scent glands in the hooves, as well as urine sampling (primarily used to determine fertility). The animals have excellent hearing and smell, accounting for the prominence of stripe displays and scent marking. Although not specifically reported for these animals, as mammals it is likely that they use some accoustic means of communication. Tactile communication is also likely to play a role in reproductive activities.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average life span is approximately 18 years in the wild, and 20 in captivity.

Average lifespan

Status: wild:
18 years.

Average lifespan

Status: captivity:
22 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.8 years (captivity) Observations: One captive specimen lived at least 23.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Gemsbok are polygynous. The resident bull of the herd mates with receptive females. Solitary territorial males are known to attempt to herd mixed or nursery herds onto their territories, thereby securing exclusive mating access to the females.

Mating System: polygynous

There is not a specific breeding season for gemsbok, though young within a herd tend to be of similar ages, indicating a reproductive synchrony in females. Females become sexually mature at about 2 years of age, and can conceive almost immediately after an 8.5 month gestation. Gemsbok are classified as "hiders", meaning the young are not seen present with the mother, but are hidden in the general vicinity, with the mother returning to nurse the calf 2 to 3 times each day. The young weigh between 9 and 15 kg at birth. At birth, calves are entirely brown in color. They develop the characteristic markings at about 3.5 months. At this point, the young are weaned. The males disperse and females join the maternal herd about a month after weaning.

Breeding interval: Gemsbok tend to breed every 9 months, and usually with little time between giving birth and becoming pregnant again.

Breeding season: Breeding season is year round, pending water availability.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 8.5 months.

Average weaning age: 3.5 months.

Average time to independence: 4.5 months.

Range age at sexual or reproductive maturity (female): 1.5 to 2 years.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 1.5 to 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); post-partum estrous

Average birth mass: 12000 g.

Average gestation period: 270 days.

Average number of offspring: 1.

Like most ungulates, pregnant gemsbok isolate themselves from the herd before calving. The single neonate is kept concealed, usually within sight of the mother. This hiding behavior continues up to six weeks of age, ending with reconciliation with the herd.

Males are not reported to participate directly in parental care, so the feeding, sheltering, protection, and grooming of the young are all accomplished by the mother. As is the case with most bovids, the young are able to stand shortly after birth, and can move around with the mother as needed.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adult females give birth at approximately 9-month intervals; gestation period is about 8.5 months; litter size usually is 1 (see Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oryx gazella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACCAACCATAAAGATATTGGTACCTTGTACCTCCTATTCGGTGCTTGAGCTGGCATAGTGGGAACCGCCCTGAGCTTACTAATTCGCGCTGAATTAGGCCAGCCTGGGACTTTACTTGGAGATGATCAAATCTACAACGTAGTCGTAACCGCACATGCATTCGTAATAATCTTCTTTATAGTAATACCTATTATGATTGGAGGGTTTGGCAACTGGCTAGTCCCTTTAATAATTGGAGCCCCCGACATAGCATTCCCTCGAATAAACAATATAAGCTTTTGACTGCTTCCTCCTTCTTTTCTATTACTCCTAGCATCTTCTATAGTTGAAGCTGGAGCCGGAACAGGTTGAACCGTATATCCCCCTCTAGCTGGCAACCTAGCCCATGCAGGAGCCTCAGTGGATCTCACTATTTTCTCTTTACACTTAGCAGGTGTTTCCTCAATTCTAGGAGCCATCAATTTTATTACAACAATTATTAACATAAAACCCCCTGCAATAACACAATATCAAACTCCCCTGTTTGTATGATCTGTATTAATTACTGCTGTTTTACTTCTCCTTTCGCTCCCTGTATTAGCAGCCGGCATTACAATACTATTAACAGATCGAAATCTAAATACAACCTTCTTTGACCCGGCAGGAGGGGGAGACTCTATCTTATATCAACATCTATTCTGATTCTTTGGTCACCCTGAAGTATATATCCTTATTCTACCCGGATTTGGAATGATTTCTCATATCGTAACCTACTACTCAGGAAAAAAAGAACCATTTGGGTATATAGGAATAGTGTGGGCCATGATATCAATCGGATTCCTGGGGTTCATCGTATGAGCTCATCATATGTTCACAGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCTACCATAATTATTGCAATCCCAACCGGAGTAAAGGTCTTTAGCTGACTGGCAACACTCCATGGAGGTAATATCAAATGATCTCCCGCTATAATGTGGGCCCTAGGCTTCATTTTCCTCTTCACAGTTGGAGGCCTAACTGGAATTGTTCTAGCCAACTCTTCTCTTGACATTGTTCTTCATGATACATACTATGTAGTCGCACATTTCCACTATGTCCTATCTATAGGAGCTGTATTCGCTATCATAGGAGGATTTGTACATTGATTTCCACTATTCTCAGGCTATACTCTAAACATAACATGAGCCAAAATCCATTTCGCAATTATGTTTGTAGGCGTAAACATAACATTCTTCCCACAACACTTCTTAGGCCTATCTGGCATACCACGACGATATTCTGATTATCCAGACGCATACACGATATGAAATACTATCTCATCTATAGGCTCATTTATTTCACTAACAGCAGTAATACTAATAATTTTCATTATCTGAGAGGCATTTGCATCCAAACGGGAAGTCTCGACTGTAGACCTAACTACGACCAACCTAGAGTGACTAAACGGATGTCCCCCACCATACCACACATTTGAAGAACCCGCATACGTAAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oryx gazella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the species is numerous and widespread, and populations are currently stable or even increasing. The Gemsbok’s future is secure as long as it continues to occur in large numbers on private land and in protected areas in Southern Africa. Its high value as a trophy animal should ensure further increases in its numbers on private land.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The current total population of gemsbok is around 275,000 individuals. Though the numbers do not indicate a threatened population, large declines in several areas have resulted from livestock overgrazing, human encroachment on land, climate change, and habitat destruction. Other gemsbok populations have been declining due to over hunting.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1). The status of the gemsbok is currently under review for the IUCN Red List 2008. The IUCN Red List currently classifies the gemsbok as one species with five subspecies (as described here); however, current taxonomy suggests it is likely to be two separate species: Oryx gazella and Oryx beisa, with the latter having two subspecies, Oryx beisa beisa and Oryx beisa callotis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population estimates are available for almost all of this species’ range. Summation of these estimates gives a total population of 326,000, but actual numbers are probably higher because of an unknown level of undercounting bias in aerial surveys. Assuming an average correction factor for undercounting bias of 1.3 would give a total population estimate of 373,000. Overall population trend is increasing in private farms and conservancies and protected areas, and stable elsewhere (East 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Presently there are no major threats to the survival of the species. In the past its numbers and its distribution decline significantly due to the expansion of human activities in Southern Africa during the 19th and 20th centuries. Yet, in the last two decades there has been widespread reintroduction of Gemsbok to private land and protected areas, For example, in Namibia the largest numbers occur on private farmland, where the estimated population increased from 55,000 in 1972 to >164,000 in 1992 (East 1999).

Despite this favourable trend, in some areas such as south-western Botswana its distribution is increasingly restricted to protected areas, to the point where there are now two discrete concentration areas within this region, in Central Kgalagadi-Khutse Game Reserves and within and to the north and east of Gemsbok National Park. Outside these protected areas, it occurs mainly in areas of the Kalahari without cattle (East 1999).

Its ability to meet its survival needs within a relatively small area of semi-arid or arid savanna, even during severe droughts, enable it to occupy much smaller mean annual ranges than migratory species such as blue wildebeest and red hartebeest. The gemsbok’s independence of surface water and non-migratory behaviour have enabled it to largely escape the adverse effects of veterinary cordon fencing (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Some populations have been extirpated by hunters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

All subspecies of gemsbok have suffered population and range declines (2). The Beisa oryx and fringe-eared oryx have particularly declined in Somalia, Uganda and Sudan, but are still quite widespread in Ethiopia and pars of Kenya and Tanzania (6) (7). The habitat of the gemsbok continues to be encroached upon by humans and their livestock (1) (6). In addition, gemsboks face the threat of hunting (1), for their meat, hides and horns (3), which has the potential to greatly impact populations due to their slow reproductive rate (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The largest numbers occur on private land (about 45% of the population), especially in Namibia, and in protected areas (35%) such as Namib-Naukluft and Etosha (Namibia), Central Kgalagadi-Khutse Game Reserves and Gemsbok National Park and surrounds (Botswana) and Kalahari Gemsbok National Park (South Africa). All of these populations are stable or increasing.

The Gemsbok is of major economic value to the wildlife industry in southern Africa. It is a key trophy species on game farms and an important component of game-capture activities. In South Africa it is in great demand among farmers because of its trophy value. It has been introduced widely to areas outside its natural range, e.g., Gemsbok numbers have increased dramatically on bushveld farms in the north of the country, mainly due to introductions from Namibia. Kalahari Gemsbok National Park supports South Africa’s largest Gemsbok population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The gemsbok occurs in many major national parks (6), where it receives protection from the threats of habitat loss and hunting. Therefore, whilst the gemsbok is not considered to yet be threatened with extinction, it is somewhat reliant on the continued enforcement of protected areas, and thus IUCN has classified it as Lower Risk / Conservation Dependent (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative economic impacts of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Gemsbok are hunted for their thick skin, which is used for shield covers by local African peoples. The horns are also used in making spears.

This species is a common game ranch species since both females and males have horns, making trophies cheaper to produce.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gemsbok

The gemsbok or gemsbuck (Oryx gazella) is a large antelope in the Oryx genus. It is native to the arid regions of Southern Africa, such as the Kalahari Desert. Some authorities formerly included the East African oryx as a subspecies. The current gemsbok population in South Africa is estimated at 373,000 individuals.[1]

Name[edit]

The name "gemsbok" in English is derived from Afrikaans gemsbok, which itself is derived from the Dutch name of the male chamois, gemsbok. Although some superficial similarities in appearance (especially in the facial pattern) are noticed, the chamois and the oryx are not closely related. The usual pronunciation in English is /ˈɡɛmzbɒk/.[2]

Description[edit]

Gemsbok are light brownish-grey to tan in colour, with lighter patches toward the bottom rear of the rump. Their tails are long and black in colour. A blackish stripe extends from the chin down the lower edge of the neck, through the juncture of the shoulder and leg along the lower flank of each side to the blackish section of the rear leg. They have muscular necks and shoulders, and their legs have white 'socks' with a black patch on the front of both the front legs, and both genders have long, straight horns. Comparably, the East African oryx lacks a dark patch at the base of the tail, has less black on the legs (none on the hindlegs), and less black on the lower flanks.

Gemsbok are the largest species in the Oryx genus. They stand about 1.2 m (3.9 ft) at the shoulder.[3][4] The body length can vary from 190 to 240 cm (75 to 94 in) and the tail measures 45 to 90 cm (18 to 35 in).[5][6] Male gemsbok can weigh between 220 and 300 kg (490 and 660 lb), while females weigh 100–210 kg (220–460 lb).

Horns[edit]

A drinking gemsbok with a group of helmeted guineafowl in the foreground

Gemsbok are widely hunted for their spectacular horns that average 85 cm (33 in) in length. From a distance, the only outward difference between males and females is their horns, and many hunters mistake females for males each year. In males horns tend to be thicker with larger bases. Females have slightly longer, thinner horns.

Female gemsbok use their horns to defend themselves and their offspring from predators, while males primarily use their horns to defend their territories from other males.[7]

Gemsbok are one of the few antelope species where female trophies are sometimes more desirable than male ones. A gemsbok horn can be fashioned into a natural trumpet and, according to some authorities, can be used as a shofar.[8]

Behaviour[edit]

Gemsbok live in herds of about 10–40 animals, which consist of a dominant male, a few nondominant males, and females. They are mainly desert-dwelling and do not depend on drinking water to supply their physiological needs. They can reach running speeds of up to 60 km/h (37 mph).

Introduction to North America[edit]

In 1969, the New Mexico State Department of Game and Fish decided to introduce gemsbok to the Tularosa Basin in the United States. The introduction was a compromise between those who wanted to preserve nature and those who wanted to use it for profit and promotion.[9] Ninety-three were released from 1969 to 1977, with the current population estimated to be around 3,000 specimens. They thrived because their natural predators, including the lion, are not present.[10]

References[edit]

  1. ^ a b IUCN SSC Antelope Specialist Group (2008). Oryx gazella. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 13 November 2008.Database entry includes justification for why this species is listed as Least concern.
  2. ^ Dictionary.com: "Gemsbok". Dictionary.reference.com. Retrieved on 2013-10-10.
  3. ^ Oryx Gemsbok. Zoo la Boissière-du-Doré
  4. ^ Oryx gemsbok – Fiche détaillée – Les mammifères. Tous vos animaux. Retrieved on 2013-10-10.
  5. ^ Gemsbok videos, photos and facts – Oryx gazella. ARKive. Retrieved on 2013-10-10.
  6. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  7. ^ Matign System. bio.davidson.edu
  8. ^ Hearing Shofar: Making a Gemsbok Shofar. Hearingshofar.blogspot.com (2010-01-01). Retrieved on 2013-10-10.
  9. ^ CHAPTER SIX: A BRAVE NEW WORLD: WHITE SANDS AND THE CLOSE OF THE 20th CENTURY, 1970–1994. US National Park Service. Retrieved on 2013-10-10.
  10. ^ Exotic Animal Management (African Oryx). US National Park Service. Retrieved on 2013-10-10.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Does not include O. beisa (Grubb, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!