Overview

Brief Summary

The Scimitar-horned Oryx (Oryx dammah) is one of two oryx species that went extinct in the wild (the other being the Arabian Oryx, Oryx leucoryx). The Scimitar-horned Oryx--both sexes of which have long, slender, hollow horns that are annulated (i.e. with ring-like divisions) for the basal third and curve over the back--used to be found on the southern and northern edges of the Sahara Desert. They did not inhabit the desert interior, as does the Addax (Addax nasomaculatus). The former range of the Scimitar-horned Oryx, which encompassed over 4 million square km, experiences prolonged droughts, the most recent of which extended from the 1960s to the early 1990s! The ongoing southward spread of the Sahara Desert likely contributed to the decline of this species. When sedentary, herds consisted of 10 to 30 or even 100 individuals. During migration, groups of 1000 or more would aggregate (an aggregation of 10,000 was reported from Chad in 1936). It is estimated the the wild population of Scimitar-horned Oryx once numbered around a million individuals. In addition to the expansion of the Sahara, the main causes of extinction were human population growth, motorized access to the desert, overhunting, and increased use of key habitats by livestock. The last known wild individuals were in Chad and Niger in the 1980s. Fortunately, captive populations were established beginning in the 1960s (around 4,000 captive animals are in the United Arab Emirates in a private collection and around 2,000 on private ranches in Texas, U.S.A.), so re-establishing wild Scimitar-horned Oryx populations is a possibility that is being actively pursued.

  • Groves, C.P. 2011. Genus Oryx. Pp. 688-692 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. Academic Press, San Diego.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

This species is well adapted for survival in the dry areas it inhabits; it is able to live for nine to ten months without drinking, thanks to a number of specialisations including kidneys that minimise urine production and an ability to reach body temperatures of 46.5°C before beginning to perspire (9). In the wild, the scimitar-horned oryx lived in groups of up to 40, with much larger herds forming at certain times of year (9) (10). In the wet season these herds migrated to the north, returning at the onset of the dry season (9). Births occur mainly in March and October (2), and the female will separate herself from the herd for a few hours while she calves (6). The young become fully independent at around 14 weeks of age (6). Browsing in the relative cool of the early morning and evening (6), these oryx feed on a wide range of grass species, foliage and fruit (9) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The scimitar-horned oryx, so named for its magnificent curved horns, is now thought to be Extinct in the Wild, hunted to the brink of extinction for its meat and exceptionally robust hide (4). The stocky body is a pale colour, with brown markings on the face and a reddish-brown neck and chest area (5). The large, spread hooves allow these antelope to walk on the sand of their dry habitat (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

May formerly have been widespread across North Africa, at least in arid and Saharan areas, but now Extinct in the Wild over all its range. Captive herds are kept in fenced protected areas in Tunisia, Senegal and Morocco (Sous Massa National Park (probably outside the known historical range) as part of long-term reintroduction programmes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Scimitar-horned oryx is found in the desert to semidesert region of Africa known as the "Great Steppe." This area is a strip of arid grassland extending from Senegal to central Sudan, which borders the southern edge of the Sahara Desert.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North Africa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The scimitar-horned oryx was once one of the most common large mammals of northern Africa with a range extending from Morocco and Tunisia to Egypt, reaching south to Mauritania and Sudan (7) (8). The range rapidly declined throughout the 20th Century, until in 1980 it was known only from Chad and Niger with a few individuals in Mali and Sudan. The species is believed to have become Extinct in the Wild in 1999 (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Scimitar-horned oryx, like other oryxes, has a black and and white face mask. However, in this species the black tends to fade to a brownish color. Their basic color is white with rusty brown necks and chests. Soms specimens have brown bands on their flanks along with a rusty brown spot outlined on the thigh. Like all orxyes, calves are born with yellow coats and lack distinguishing marks which appear later in life. The Scimitar-horned oryx is average in size compared to the larger East African oryx or the smaller Arabian oryx. Average length is 5.5 ft (1.7 m) with a shoulder height of about 3.8 ft (1.2 m)and an average weight of 148 lbs . It is the only oryx whose horns curve backwards. The horns average about 40 inches (1 m), but lengths of 50 inches (1.2 m) or more have been recorded. Both sexes have horns and, like other oryxes, the female's tend to be more slender.

Average mass: 200 kg.

Average mass: 177500 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Primarily inhabits sub-desert, annual grassland steppe areas. Found in rolling dunes, grassy steppes and wooded inter-dunal depressions, rarely entering true desert or true Sahelian bush. The Scimitar-horned Oryx is well adapted to arid areas.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Scimitar-horned oryx is found in barren steppes of desert to semidesert environments.

Terrestrial Biomes: desert or dune ; chaparral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits sub-desert areas, the area between true desert and the Sahel where the annual rainfall is less than 350 millimetres, and lives in dunes, wooded depressions between dunes and grassy steppe (9) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Scimitar-horned oryx is herbivorous, feeding on annual grasses, herbs, juicy roots, buds, and when water is scarce, fruits and vegetables. Like most inhabitants of arid environments it is subject to unpredictable and variable amounts of precipitation. Because of their great nomadic ability, the Scimitar-horned oryx will travel many miles in search of new new green grass which sprouts up quickly after sudden down pours. Though they tend to stay in small groups of about 40, when food is scarce and concentrated they can form herds of more than a hundrend.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
27.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.5 years (captivity) Observations: One specimen was still living after 27.5 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Courting is done through the means of a mating circle. During this ritual, the male and female stand parallel to one another facing opposite directions. They then circle around one another until the cow allows the male to mount from behind. HOwever, if the female is not ready to mate, she can run away and circle in the reverse direction. Once the female oryx is impregnated, gestation lasts between 8 and 8.5 months. There is only one calf per birth, weighing an average of 20 to 33 lbs (9 to 15 kg).

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 8.07 to 8.53 months.

Average birth mass: 10317 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
639 days.

Parental Investment: post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oryx dammah

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGATATCGGTACCTTATACCTTCTATTCGGTGCTTGAGCTGGCATAGTGGGAACTGCCCTGAGCTTACTAATTCGCGCTGAATTAGGCCAACCTGGGACTTTACTTGGAGATGATCAAATCTACAACGTAGTCGTAACCGCACATGCATTCGTAATAATCTTCTTTATAGTAATGCCTATTATGATTGGAGGATTTGGCAACTGACTGGTCCCCCTAATAATTGGAGCCCCCGACATAGCATTCCCTCGAATAAACAATATAAGCTTTTGACTGCTTCCTCCTTCTTTTCTACTACTCCTGGCATCTTCTATAGTTGAAGCTGGAGCTGGAACAGGTTGGACCGTGTATCCCCCTCTAGCGGGCAATCTAGCCCATGCAGGAGCCTCAGTGGATCTCACCATTTTCTCTTTACACTTAGCAGGTGTTTCCTCAATTCTAGGAGCCATTAATTTTATCACAACAATCATTAACATAAAACCCCCTGCAATAACACAATATCAAACTCCCTTGTTTGTATGATCTGTACTAATTACTGCTATCTTACTTCTCCTTTCACTCCCTGTATTAGCAGCCGGCATTACAATACTATTAACAGATCGAAACCTAAATACAACCTTCTTTGACCCGGCAGGAGGGGGAGACCCTATCCTATACCAACATCTATTCTGATTTTTTGGCCACCCTGAAGTATATATCCTTATTCTACCCGGATTCGGAATGATTTCTCACATCGTAACCTATTACTCAGGAAAAAAAGAACCATTTGGGTATATGGGAATAGTGTGAGCTATAATATCAATCGGATTCTTGGGGTTCATCGTATGAGCTCATCATATATTCACAGTTGGAATAGACGTCGACACACGAGCTTACTTCACATCAGCTACCATAATTATTGCCATCCCAACCGGAGTAAAAGTCTTTAGCTGACTAGCGACACTCCATGGAGGTAATATCAAATGATCTCCCGCTATAATATGGGCCTTAGGCTTCATTTTCCTCTTCACAGTTGGAGGCCTAACCGGAATTGTCCTAGCCAACTCTTCTCTTGACATCGTTCTTCACGATACATATTATGTAGTCGCACATTTTCACTATGTGTTATCAATAGGAGCTGTATTCGCTATCATAGGAGGATTTGTACATTGATTTCCACTATTCTCAGGCTATACCTTAAACATAACATGAGCCAAAATCCATTTCGCAATTATGTTTGTAGGCGTGAACATAACATTCTTCCCACAACACTTCTTAGGCCTGTCTGGCATGCCACGACGATACTCTGATTACCCAGACGCATACACGATGTGAAATACTATCCCATCTATAGGCTCATTTATTTCACTAACAGCAGTAATACTAATAGTTTTCATTATCTGAGAGGCATTTGCATCCAAACGGGAAGTCTCGACCGTAGACCTGACCACAACTAACCTAGAGTGACTAAACGGATGTCCTCCACCATACCACACATTTGAAGAACCCGCATATGTAAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oryx dammah

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EW
Extinct in the Wild

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. & Plowman, A. (Antelope Red List Authority)

Contributor/s

Justification
There has been no definite evidence of the survival of this species in the wild for more than 15 years. Sporadic reports of animals sighted in Niger and Chad have never been substantiated, despite extensive surveys dedicated to detection of Sahelo-Saharan antelopes carried out in Chad and Niger in 2001-2004.

History
  • 2007
    Extinct in the Wild
  • 2000
    Extinct in the Wild
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Though the Scimitar oryx's range has been greatly reduced, especially in the north, their numbers have stayed relatively high thanks to the large numbers living in captivity. Several large game preserves, mainly in Texas, have instigated successful programs for breeding the Scimitar-horned oryx. However, its habitat is being destroyed and reintroduction of large populations may prove difficult.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: extinct in the wild

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/02/2005
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Oryx dammah , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Extinct in the Wild (EW) on the IUCN Red List 2007 (1). Listed on Appendix I of CITES and Appendices I and II of The Convention on Migratory Species (CMS or Bonn Convention) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
An estimated 500 Oryx survived at least until 1985 in Chad and Niger, but by 1988 only a few dozen individuals survived in the wild and since then there have been no confirmed reports of any wild oryx surviving in the wild (Morrow in press).

There are captive populations in fenced protected areas in several former range states: in Tunisia, there were 130 in Bou Hedma N.P. in 2005, 25 in Sidi-Toui N.P. (2006), and 12 in Oued Dekouk N.P. (2006); in Morocco, there were 240 in Souss-Massa N.P. in 2005; and in Senegal, there were 18 at Guembeul and 12 at Ferlo in 2004 (see Morrow in press, and refs therein). These populations are all maintained in fenced enclosures of varying sizes and are subject to different degrees of management. None is eligible for consideration as a released population for assessment purposes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Overhunting and habitat loss, including competition with domestic livestock, have been reported as the main reasons for the extinction of the wild population of Scimitar-horned Oryx (Mallon and Kingswood 2001, Devillers and Devillers-Terschuren 2005, Morrow in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Originally the scimitar-horned oryx began to decline as a result of major climatic changes that caused the Sahara region to become dry. As the Sahara desert expanded, two populations of this oryx became increasingly isolated. The northern population was mostly lost prior to the 20th Century (8) (9). The decline of the southern population accelerated as Europeans began to settle the area and hunting for meat, hides and horn-trophies increased. It is thought that World War Two and the Civil War in Chad during the 1980s impacted heavily on the species through an increase in hunting for food (4) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Scimitar-horned Oryx is listed on CMS Appendix 1. A global captive breeding programme was initiated in the 1960s. In 2005 there were at least 1,550 captive animals held in managed breeding programmes around the world (Gilbert 2005). In addition, a large number, probably >4,000 are kept in a private collection in the United Arab Emirates. Additional animals are likely held on private game ranches in the USA. As part of planned reintroduction projects, animals have been released into fenced protected areas in Tunisia (Bou Hedma National Park 1985, Sidi Toui National Park 1999, Oued Dekouk National Park 1999), Morocco (Souss-Massa National Park 1995), and Senegal (Ferlo Faunal Reserve 1998, Guembuel Wildlife Reserve 1999). Reintroduction is currently also planned at a site in Niger. It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The species has successfully been bred in captivity and in 1985, five captive-bred pairs were reintroduced to Tunisia, and by 1989 the herd had produced 4 wild-born calves (9). Captive-bred oryx now exist in healthy numbers in both Tunisia and Morocco, and have been reintroduced into Senegal (1) (11). Individuals have also been introduced to Israel, although this was not within the historic range (9). Recent reports of sightings of oryx in Chad and Niger have been investigated but no animals found (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

This oryx was used as a food source in the past, but now its most valuable contribution is probably its place in ecotourism. Both Africa and the United States are profiting greatly from the recent rise in this new form of tourism.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Scimitar oryx

The scimitar oryx or scimitar-horned oryx (Oryx dammah), also known as the Sahara oryx, is a species of Oryx now extinct in the wild. It formerly inhabited all of North Africa. It has a long taxonomic history since its discovery in 1816 by Lorenz Oken, who named it the Oryx algazel. This spiral-horned antelope stands a little more than 1 metre (3.3 ft) at the shoulder. The males weigh 140–210 kg (310–460 lb) and the females weigh 91–140 kg (200–310 lb). The coat is white with a red-brown chest and black markings on the forehead and down the length of the nose. The calves are born with a yellow coat, and the distinguishing marks are initially absent. The coats change to adult coloration at 3–12 months old.

The scimitar oryx formed herds of mixed sexes of up to 70 members, usually guided by the bulls. They inhabited semideserts and deserts and were adapted to live in the extreme heat, with their efficient cooling mechanism and very low requirement of water. Scimitar oryx feed on foliage, grasses, succulent plants and plant parts during the night or early morning. Births peak between March and October. After a gestation of eight to nine months, one calf is born. Soon after, the female has a postpartum estrus.

The scimitar oryx was once widespread in northern Africa. Its decline began as a result of climate change, and later it was hunted extensively for its horns. Today, it is bred in captivity in special reserves in Tunisia, Morocco and Senegal. The scimitar oryx was domesticated in Ancient Egypt and is believed to have been used as food and sacrificed as offerings to gods. Wealthy people in Ancient Rome also bred them. The use of their valuable hides began in the Middle Ages. The unicorn myth may have originated from sightings of a scimitar oryx with a broken horn.

Contents

Taxonomy and naming[edit]

The scimitar oryx is a member of the genus Oryx and family Bovidae. The German naturalist Lorenz Oken first described it in 1816, naming it Oryx algazel. The nomenclature has undergone various changes since then, with the introduction of names like Oryx tao, O. leucoryx, O. damma, O. dammah, O. bezoarticus and O. ensicornis. In 1826, Philipp Jakob Cretzschmar used the name Oryx ammah for the species. A year later, the name Orys leucoryx came into use, but as this was a synonym of the Arabian oryx (then called Oryx beatrix), it was abandoned, and Oryx algazel was accepted once more. Over a hundred years later, in 1951, Sir John Ellerman and Terence Morrison-Scott realized the invalidity of the name Oryx algazel. Finally, in January 1956, the International Trust for Zoological Nomenclature accepted Oryx dammah as the scientific name. There have been no more changes since then, though many papers published after 1956 created confusion by using names like O. gazella tao.[2]

Its scientific name, Oryx dammah, is derived from: Ancient Greek ὄρυξ (orux), meaning a gazelle or antelope (originally a pickaxe[3]); Latin damma (fallow deer or antelope); and Arabic dammar (sheep).[4] The scimitar oryx is named for its horns,[5] which resemble scimitars.[4] Its common name in English is "scimitar-horned oryx", or simply "scimitar oryx".[2]

Genetics and evolution[edit]

The scimitar oryx has 58 chromosomes. It has one pair of large submetacentric autosomes and 27 acrocentric autosomal pairs. The X and Y chromosomes are the largest and smallest acrocentrics.[6] The first molecular study of this species (published in 2007) observed genetic diversity among European, North American and some other captive groups. Divergence was found within the mitochondrial DNA haplotypes, and was estimated to have taken place between 2.1 and 2.7 million years ago. Population increases occurred approximately 1.2 and 0.5 million years ago.[7]

In another study, intended to note genetic differences between Oryx species, karyotypes of Oryx species and subspecies – namely O. gazella gazella, O. g. beisa, O. g. callotis, O. dammah and O. leucoryx – were compared with the standard karyotype of Bos taurus. The number of autosomes in all karyotypes was 58. The X and Y chromosomes were conserved in all five species.[8]

Physical description[edit]

Scimitar oryx in the Werribee Open Range Zoo, Victoria, Australia

The scimitar oryx is a spiral-horned antelope that stands just over 1 m (3.3 ft) at the shoulder. The males weigh 140–210 kg (310–460 lb) and the females 91–140 kg (200–310 lb).[9] The body measures 140–240 cm (55–94 in) from the head to the base of the tail. The tail is 45–60 cm (18–24 in) long and ends with a tuft. Males are larger than females.[10]

Its coat is white with a red-brown chest and black markings on the forehead and down the length of the nose.[4] The coat reflects the sun's rays, while the black portions and the tip of the tongue provide protection against sunburn.[11][12] The white coat helps to reflect the heat of the desert.[13] Calves are born with yellow coats and lack distinguishing marks, which appear later in life.[14] Their pelage changes to adult coloration at 3–12 months old.[11]

Both sexes have horns, but those of the females are more slender.[14] The horns are long, thin, and symmetrical; they curve backwards (a distinctive feature of this species) and can reach 1.0 to 1.2 m (3 ft 3 in to 3 ft 10 in) on both the males and the females. The horns are so thin that they can break easily.[4] The female has four nipples. The large, spreading hooves are well adapted to allow these antelopes to walk on the sand of their dry habitats.[5] A scimitar oryx can live as long as 20 years.[4][13][15] At Smithsonian National Zoo, a female oryx died at 21, an exceptional age since females generally have a lifespan of about 15 years.[16]

Diseases and parasites[edit]

The scimitar oryx can be infected with cryptosporidiosis, a parasitic disease caused by protozoan parasites of genus Cryptosporidium in the phylum Apicomplexa. A study in 2004 revealed that C. parvum or similar organisms infected 155 mammal species, including the scimitar oryx.[17] An analysis in 2005 found Cryptosporidium parasites in stool samples from 100 mammals, including the scimitar oryx.[18] Oocysts of a new parasite, Eimeria oryxae, have been discovered in the feces of a scimitar oryx from Zoo Garden in Riyadh.[19] In France, Streptococcus uberis was isolated for the first time in an oryx. It had caused vegetative endocarditis in the animal, leading to fatal congestive heart failure.[20]

A 1983 study examined the blood serum chemistry of blood samples taken from the jugular veins of fifty scimitar oryx ranging from neonates to adults over 13 years old. The study concluded that the higher eosinophil counts of the juveniles and adults might reflect larger internal parasite burdens in them as compared with the neonates.[21]

Ecology and behavior[edit]

The scimitar oryx was a very sociable animal and traveled in herds of between two and forty individuals, generally, led by a dominant bull. This species once gathered in groups of several thousand for migration. During the wet season, they migrated north into the Sahara.[14] Scimitar oryx are diurnal. In the cool early mornings and evenings, they rest under trees and shrubs, or if neither are available, they dig depressions in the soil with their hooves and rest there. Males fight often, but not for long and not violently. Predators, such as lions, leopards, hyenas, cheetahs, golden jackals, vultures and Cape hunting dogs, mostly kill weak and young oryx.[2][4]

The play activity of eight calves in captivity was observed in a 1983 study. Male calves played for longer than females calves did. Mixed sex play was usual; selection of partners depended on age, but not on sex or genetic relatedness. Results suggested that size dimorphism was an important factor responsible for sex differences in play.[22]

Adaptations[edit]

Scimitar oryx grazing in herds in grassland

With a metabolism that functions at the high temperatures prevalent in their habitats, scimitar oryx need less water for evaporation to help conduct heat away from the body, enabling them to go for long periods without water. They can allow their body temperature to rise to almost 46.5 °C (115.7 °F) before beginning to perspire.[5] In times of ample supply, oryx can use fluid loss through urination and feces to lower their body temperature to below 97 °F (36 °C) at night, giving more time before reaching maximum body temperature the following day.[14] They can tolerate high temperatures that would be lethal to most mammals. They have a network of fine blood vessels that carry blood from the heart to the brain, passing close to the nasal passage and thus allowing the blood to cool by up to 5 °F (3 °C) before reaching the brain, which is one of the most heat-sensitive organs of the body.[13][14]

Diet[edit]

The habitat of scimitar oryx in the wild was steppe and desert, where they ate foliage, grass, herbs, shrubs, succulent plants, legumes, juicy roots, buds, and fruit.[14] They can survive without water for nine to ten months because their kidneys prevent water loss from urination – an adaptation to desert habitats. They can get water from water-rich plants such as the wild melon (Citrullus colocynthis) and Indigofera oblongifolia and from the leafless twigs of Capparis decidua. In the night or early morning, they often search for plants such as Indigofera viscosa, which produce a hygroscopic secretion that fulfils water requirements. They eat tuft grasses such as Cymbopogon schoenanthus after it has rained, but they normally prefer more palatable grasses, such as Cenchrus biflora, Panicum laetum and Dactyloctenium aegyptium. When the dry season begins, they feed on the seedpods of Acacia raddiana, and during the dry season, they rely on perennial grasses of genera such as Panicum (especially Panicum turgidum) and Aristida, and browse plants such as Leptadenia species, Cassia italica and Cornulaca monacantha.[2]

Reproduction[edit]

A young oryx with its mother

Both males and females reach sexual maturity at 1.5 to 2 years of age.[4] Births peak between March and October.[4] Mating frequency is greater when environmental conditions are favorable. In zoos, males are sexually most active in autumn.[2] The estrous cycle lasts roughly 24 days, and females experience an anovulatory period in spring. Periods between births are less than 332 days, showing that the scimitar oryx is polyestrous.[23]

Courting is done by means of a mating circle: the male and female stand parallel to one another, facing in opposite directions, and then circle around each other until the female allows the male to mount from behind. If the female is not ready to mate, she runs away and circles in the reverse direction.[14] Pregnant females leave the herd for a week, give birth to the calf and conceive again during their postpartum estrus; thus they can produce a calf a year.[11] Gestation lasts about nine months, after which a single calf is born, weighing 20 to 33 pounds (9.1 to 15 kg).[14] Twin births are very rare - only 0.7% of the births observed in one study. Both mother and calf return to the main herd within hours of the birth.[4] The female separates herself from the herd for a few hours while she nurses the calf. Weaning starts at 3.5 months, and the young become fully independent at around 14 weeks old.[5]

Habitat and distribution[edit]

The scimitar oryx once inhabited grassy steppes, semideserts[14] and deserts in a narrow strip of central north Africa (Niger and Chad).[5] It was widespread on the fringes of the Sahara, mainly in the subdesert Great Steppe,[clarification needed] the grassy zone between the real desert and the Sahel, an area characterized by an annual rainfall of 75–150 mm (3.0–5.9 in). In 1936, a single herd of 10,000 oryx was seen in the steppe area of Chad. By the mid-1970s, Chad was home to more than 95% of the world population of this species.[24]

Status and conservation[edit]

A group of scimitar oryx at Marwell Zoo in Hampshire, UK

The scimitar oryx was hunted almost to extinction for its horns.[when?] Its population decline began as a result of major climatic changes that caused the Sahara to become dry. The northern population was already almost lost before the 20th century. The decline of the southern population accelerated as Europeans began to settle the area and hunt them for meat, hides and horn trophies. World War II and the Civil War in Chad that started in the 1960s are thought to have caused heavy decreases of the species through an increase in hunting for food.[5][25] Roadkill, nomadic settlements near waterholes (their dry-season feeding places) and firearms for easy hunting have also reduced numbers.[26]

The IUCN lists the scimitar oryx as regionally extinct in Algeria, Burkina Faso, Chad, Egypt, Libya, Mali, Mauritania, Morocco, Niger, Nigeria, Senegal, Sudan, Tunisia and Western Sahara, and has assessed it as extinct in the wild since 2000. Reports of sightings in Chad and Niger remain unsubstantiated, despite extensive surveys carried out throughout Chad and Niger from 2001 to 2004 in an effort to detect antelopes in the Sahel and the Sahara. At least until 1985, 500 oryx were estimated to be surviving in Chad and Niger, but by 1988, only a few individuals survived in the wild.[1]

There is now a global captive breeding program for the scimitar oryx.[27] In 2005, at least 1,550 captives were managed as part of breeding programs, and in 2008, more than 4,000 were believed to be held in private collections in the United Arab Emirates.[1] Reintroduction plans involve fenced-in herds in Bou Hedma National Park (1985),[28] Sidi Toui National Park (1999) and Oued Dekouk National Park (1999) in Tunisia; Souss-Massa National Park (1995) in Morocco; and Ferlo Faunal Reserve (1998) and Guembuel Wildlife Reserve (1999) in Senegal.[1]

In culture[edit]

Woodcut illustration of a unicorn, from The History of Four-Footed Beasts and Serpents by Edward Topsell

Ancient times[edit]

In ancient Egypt scimitar oryx were domesticated[12] and tamed, possibly to be used as offerings for religious ceremonies or as food.[15] They were called ran and bred in captivity. In ancient Rome they were kept in paddocks and used for coursing, and wealthy Romans ate them. The scimitar oryx was the preferred quarry of Sahelo-Saharan hunters. Its hide is of superior quality, and the king of Rio de Oro sent 1000 shields made of it to a contemporary in the Middle Ages. Since then, it has been used to make ropes, harnesses and saddlery.[2]

Unicorn myth[edit]

The myth of the one-horned unicorn may have originated from sightings of injured scimitar oryx; Aristotle and Pliny the Elder held that the oryx was the unicorn's "prototype".[29] From certain angles, the oryx may seem to have one horn rather than two,[30] and given that its horns are made from hollow bone that cannot be regrown, if an oryx were to lose one of its horns, for the rest of its life it would have only one.[29]

References[edit]

  1. ^ a b c d IUCN SSC Antelope Specialist Group (2008). Oryx dammah. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 9 September 2009. Database entry includes justification for why this species is listed as extinct in the wild.
  2. ^ a b c d e f The Biology, Husbandry and Conservation of Scimitar-horned Oryx (Oryx dammah) (2nd ed.). United Kingdom: Marwell Preservation Trust. 2004. ISBN 978-095-2139-723 Check |isbn= value (help). 
  3. ^ Harper, Douglas. "oryx". Online Etymology Dictionary. Retrieved 2013-02-21. 
  4. ^ a b c d e f g h i Huffman, B. "Oryx dammah ( Scimitar-horned oryx )". Ultimate Ungulate. 
  5. ^ a b c d e f "Scimitar-horned oryx (Oryx dammah)". ARKive. 
  6. ^ Claro, F.; Hayes, H.; Cribiu, E.P. (1994). "The C-, G-, and R-banded karyotype of the scimitar-horned oryx (Oryx dammah)". Hereditas 120 (1): 1–6. PMID 8206781. 
  7. ^ Iyengar, A.; Gilbert, T.; Woodfine, T.; Knowles, J. M.; Diniz, F. M.; Brenneman, R. A.; Louis, E. E.; Maclean, N. (1 June 2007). "Remnants of ancient genetic diversity preserved within captive groups of scimitar-horned oryx (Oryx dammah)". Molecular Ecology 16 (12): 2436–49. doi:10.1111/j.1365-294X.2007.03291.x. 
  8. ^ Kumamoto, A.T.; Charter, S.J.; Kingswood, S.C.; Ryder, O.A.; Gallagher, Jr., D.S. (1999). "Centric fusion differences among Oryx dammah, O. gazella, and O. leucoryx (Artiodactyla, Bovidae)". Cytogenetic and Genome Research 86 (1): 74–80. doi:10.1159/000015416. 
  9. ^ Mungall, E.C. (2007). Exotic Animal Field Guide : Nonnative Hoofed Mammals in the United States (1st ed.). College Station: Texas A&M University Press. p. 169. ISBN 1-58544-555-X. 
  10. ^ Hoath, R. (2009). "Other Artiodactyla- Family Bovinae". A Field Guide to the Mammals of Egypt. Cairo: Amer Univ In Cairo Press. p. 149. ISBN 978-977-416-254-1. 
  11. ^ a b c "Scimitar-horned Oryx (Oryx dammah)". World Association of Zoos and Aquariums (WAZA). 
  12. ^ a b "Oryx dammah". Sahelo-Saharan Megafauna. Sahelo-Saharan Antelopes. 
  13. ^ a b c "Scimitar-horned Oryx". National Zoological Park. 
  14. ^ a b c d e f g h i Johnson, H. "Oryx dammah". University of Michigan Museum of Zoology. Animal Diversity Web. 
  15. ^ a b "Animal species: Algazellen (Oryx dammah) | Animal and nature: animals". Ours Life Force. 
  16. ^ Zoon, J. (22 March 2012). "Elderly Oryx Dies at Smithsonian's National Zoo". Smithsonian Newsdesk. Retrieved 15 October 2012. 
  17. ^ Fayer, R. (2004). "Cryptosporidium: a water-borne zoonotic parasite". Veterinary Parasitology 126 (1–2): 37–56. doi:10.1016/j.vetpar.2004.09.004. PMID 15567578. 
  18. ^ Alves, M.; Xiao, L.; Lemos, V.; Zhou, L.; Cama, V.; Cunha, M. B. da; Matos, O.; Antunes, F. (2005). "Occurrence and molecular characterization of Cryptosporidium spp. in mammals and reptiles at the Lisbon Zoo". Parasitology Research 97 (2): 108–12. doi:10.1007/s00436-005-1384-9. 
  19. ^ Alyousif, M.S.; Al-Shawa, Y.R. (2002 Apr). "A new coccidian parasite (Apicomplexa: Eimeriidae) from the scimitar-horned oryx, Oryx dammah". Journal of the Egyptian Society of Parasitology 32 (1): 241–6. PMID 12049259. 
  20. ^ Chai, N. (1999 Dec). "Vegetative endocarditis in a scimitar-horned oryx (Oryx dammah)". Journal of zoo and wildlife medicine : official publication of the American Association of Zoo Veterinarians 30 (4): 587–8. PMID 10749451. 
  21. ^ Bush, M.; Custer, R. S.; Whitla, J. C.; Montali, R. J. (1983). "Hematologic and serum chemistry values of captive scimitar-horned oryx (Oryx tao): variations with age and sex". The Journal of Zoo Animal Medicine 14 (2): 51. doi:10.2307/20094637. 
  22. ^ Pfeifer, S. (1985). "Sex differences in social play of scimitar-horned oryx calves (Oryx dammah)". Zeitschrift für Tierpsychologie 69 (4): 281–92. doi:10.1111/j.1439-0310.1985.tb00153.x. 
  23. ^ Morrow, C.J.; Wildt, D.E.; Monfort, S.L. (1999). "Reproductive seasonality in the female scimitar-horned oryx (Oryx dammah)". Animal Conservation (Cambridge University Press) 2 (4): 261–8. 
  24. ^ West and Central Africa. Gland: IUCN. 1990. p. 27. ISBN 2-8317-0016-7. 
  25. ^ "Oryx dammah (O. tao)". Animal Info. 
  26. ^ Newby, J. (2009). "Can Addax and Oryx be saved in the Sahel?". Oryx 15 (03): 262. doi:10.1017/S0030605300024662. 
  27. ^ United Nations Environment Programme (2008). Africa: Atlas of Our Changing Environment. Nairobi, Kenya: United Nations Evnironment Programme. ISBN 978-92-807-2871-2. 
  28. ^ Godon, I.J.; Gill, J.P. (2007). "Reintroduction of Scimitar-horned oryx Oryx dammah to Bou-Hedma National Park, Tunisia". International Zoo Yearbook 32 (1): 69–73. doi:10.1111/j.1748-1090.1993.tb03517.x. 
  29. ^ a b Rice, M. (1994). The Archaeology of the Arabian Gulf, c. 5000–323 BC. Routledge. p. 63. ISBN 0-415-03268-7. 
  30. ^ Tongren, S. (1981). What's for Lunch: Animal Feeding at the Zoo. GMG Publications. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!