Overview

Brief Summary

Biology

Sable antelope mate during the dry season from May to July when sub-populations congregate on remaining green pastures (5). Maternal herds of 15 to 25 breeding females and their young are led by a single alpha female (3). Young males are driven out of this herd at about three to four years of age and join bachelor herds of around two to twelve individuals. When around five or six years of age, males will establish and defend a territory at choice feeding grounds which attract females (3). The dominant male allows subordinate males to graze in his territory as long as they are submissive and show no interest in his females, but will fiercely fight any male that challenges his authority. Fights involve males circling one another, shaking their heads, dropping to their knees and engaging in 'horn wrestling' (3) (5). Fatalities are known, but rare (5). A bull also uses urine and faeces to scent-mark the perimeter of his territory to warn off all other rival bulls (3). Peak mating activity occurs in June, and after a gestation of eight to nine months, females typically give birth to a single calf at the end of the rainy season, when food is abundant and the long grass provides sufficient cover (3) (5). After birth, the calf remains concealed for at least two weeks (3), joined by its mother for the first week, before she returns to the maternal group that the calf will eventually join (5). The calf is weaned and fully independent at six to eight months of age (3). Females start to breed at two and a half years of age and attain rank status in the herd hierarchy based on seniority, while males are evicted from the social group at three to four years old. These males then join bachelor herds of two to twelve individuals until they reach sexual maturity at five years (3) (5). Most active in the early morning and late afternoon (2), sable antelope graze on a variety of short grasses abundant during the growing season and survive during the harsh dry season by browsing on herbs, bushes and trees (3). Water is visited at least every other day and no sable antelope will travel more then two miles from a watering hole or river (5). Adults are rarely attacked by predators such as lions because of their large horns and formidable fighting abilities, but the young, injured and old are vulnerable to predation by lions, leopards, hyenas, African hunting dogs and crocodiles (3) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This stunning antelope rivals even the greater kudus as the most handsome of all antelope, with its powerful, robust build, vertical mane and fantastically long, curved horns, which arch majestically backwards (5) (6). Newborn calves are born with a camouflaging, sandy-brown coat, but as they grow and achieve herd status their coats continually darken (3). Mature females eventually become a rich chestnut-brown to dark brownish-black and fully mature males are a glossy brownish-black to pitch-black, varying with the subspecies (3) (5). Coat colour appears to be controlled hormonally, with castrated males losing their black colour to become brown again, and it is thought to help communicate age, and therefore social status, to others (3) (7). Both sexes have sharply contrasting white abdominal, rump, and facial patches, and black facial stripes running down the bridge of the nose and from the eyes to the nostrils (2) (3). The semi-circular, ridged horns are longer and thicker in males, growing up to an incredible 165 centimetres in length, while those of females reach a worthy 100 centimetres (2). These massive horns are very effective defensive weapons against natural predators and are used in dominance fighting (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A truly good-looking member of the bovidae family is the sable antelope (Hippotragus niger). Mature males are a striking jet-black in colour, with long ridged horns curving towards their backs, ending in smooth sharp tips (Mills and Hess, 1997). Although slightly smaller than the closely related Roan antelope (Hippotragus equinus), they weigh in at an average of 230 kg, standing about 1.35 m tall at the shoulder (Wilson and Herst, 1977; Skinner and Chimimba, 2005).

This mammal species inhabit open wooded savannah, preferably close a water source (Mills and Hess, 1997; Thompson and Monfort, 1999). Male sable antelope are predominantly solitary, whilst females are found in small herds consisting of a dominant female and recent offspring (although sometimes accompanied by a single male), whereas young males often travel in small bachelor herds (Jarman, 1974). They are predominantly grazers, feeding on fresh growth at a relatively high level off the ground (Wilson and Herst, 1977; Skinner and Chimimba, 2005).

Females are sexually mature around 2 years of age and reproduction occurs when food is most abundant, with females typically leaving the herd to calve (Skinner and Chimimba, 2005). There is a loose association between mothers and calves, with mothers often travelling up to 2 km away from the young, hidden foal, but the cryptic coloration and lack of odour serves to make the foal almost invisible during this vulnerable period of its life (Wilson and Herst, 1977). 

Their distribution ranges from central Tanzania, down to the north of South Africa and extends west to the south-eastern corners of Angola (for map, see http://maps.iucnredlist.org/map.html?id=10170). They are listed as least concern by the IUCN Red List of Threatened Species with large numbers reported in protected areas. There is an estimated 75,000 wild sable antelope, with numbers increasing on private game farms and conservancies.        

  • Mills, G. and Hes, L. 1997. The Complete Book of Southern African Mammals. Joyce, P. Reid, H., Barrett, J. and Lubbe, E (eds.), 1st ed., Struik Publishers, Cape Town, p. 205.
  • Skinner, D. and Chimimba, C. T. 2005. The Mammals of the Southern African Subregion. Van der Horst, D. (ed.), 3rd ed., Cambridge University Press, Cape Town, pp. 412-416.
  • Wilson, D. E. and Herst, S. M. 1977. Ecology and factors limiting roan and sable antelope populations in South Africa. Wildlife Monogr. 54, 3-111.
  • Jarman, P. J. 1974. The social organisation of antelope in relation to their ecology. 48, 215-267.
  • Thompson, K. V. and Monfort, S. L. 1999. Synchronisation of oestrous cycles in sable antelope. Anim. Reprod. Sci. 57, 185-197.
Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Sable Antelope formerly occurred widely in the savanna woodlands of southern and eastern Africa, with an isolated population (Giant Sable) in central Angola, between the Cuanza and Luando Rivers and immediately north of the Luando. They have been eliminated from large areas of their former range by meat hunting and loss of habitat to the expansion of agricultural settlement and livestock (East 1999). This range reduction has been most marked in Mozambique, where they survive only in good numbers in Niassa in the north, and in the western Gaza province, southeast DR Congo, and north-east Tanzania (East 1999; Estes in press). Sable have been reintroduced to many parts of their former range, but have also been introduced to areas where they never naturally occurred, including to Swaziland (East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hippotragus niger lives in the southern savanna of Africa from southeastern Kenya, eastern Tanzania, and Mozambique to Angola and southern Zaire, mainly in the Miombo Woodland Zone. Good places to view sable antelope include- Shimba Hills National Reserve, Kenya; Ruaha National Park, Selous Grassland Reserve, Tanzania; Kafue and Mweru- Wantipa National Park, Zambia; Matetsi Safari Area, Hwange, Zambezi, and Kazuma Pan NP, Zimbabwe; Kruger National Park, South Africa (Estes 1993).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the southern savannah of Africa from southeastern Kenya, eastern Tanzania and Mozambique to Angola and southern Zaire, mainly in the Miombo Woodland Zone (5). The Critically Endangered giant antelope is confined to central Angola, where it is primarily located in the Luando Reserve and Cangandala National Park (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This stunning antelope rivals even the most handsome kudus and is a popular zoo animal. Hippotragus niger has a powerful, robust build and a thick neck outlined by a vertical mane atop sturdy legs. Males and females are strikingly similar until 3 years old, when males become darker and develop majestic horns. Males weigh around 238 kilograms at a height of 116-142 centimeters. Females weigh 220 kilograms and are slightly shorter than males. The horns are massive and more curved in males reaching lengths of 81-165 centimeters, while females' horns are only 61-102 centimeters in length. Coloration in bulls is black, females and young are chestnut except in southern populations, where females turn brown-black. Most sable antelope have white “eyebrows”, a rostrum sectioned into cheek stripes, white belly and rump patch. Young under 2 months typically are light brown and have slight markings (Estes 1993).

Range mass: 220 to 238 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A savanna woodland species, very closely associated with the miombo Brachystegia woodland zone. The Sable is an “edge” species that frequents the woodland/grassland ecotone; it spends the wet season in woods open enough to support an understory of grasses no more than 30 cm high on well-drained soils, and in the dry season emerges onto the grasslands in search of green grass and forbs (Estes in press). They are both gramivorous and folivorous, although grass makes up the bulk of their diet (Estes in press, and references therein).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Favorable habitat is a mixture of savanna woodlands and grassland. Woodlands consist of fire-resistant, broadleaf deciduous trees scattered over an under story of sparse grasses that are grazed during the rainy season. Dry season feeding grounds are grassland areas that were once flooded, then burned, subsequently producing new growth. If possible, Hippotragus niger avoids extensive open lands (Estes 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred habitat is a mixture of open savanna woodlands and grassland, consisting of fire-resistant, broadleaf deciduous trees scattered over an under-storey of sparse grasses that are grazed during the rainy season. During the dry season, feeding grounds are floodplain grasslands that produce new growth after the annual fires, although extensive open plains are generally avoided (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Typically, sable antelope are specialized grazers feeding on foliage and herbs, especially those growing on termite mounds. During the dry season they are less reluctant to browse (Estes 1993). One of the reasons for declining antelope numbers could be their very specific feeding pattern. Typically they will feed on grasses (up to ninety percent of their diet) at heights of 40-140 millimeters from the ground taking only the leaf. In a savannah setting, sable antelope are the last to feed on the new grasses available during the late dry season when food availability is vital (Spinage 1986). In the paddock setting, where grasses are tall (above 140mm), feed is high in protein and low in fiber, and sable antelope quickly lose weight. In a particular enclosure study, sable antelope fed primarily on Brachiaria nigropedata, which only had a frequency occurrence of 3.9% across the study area (Wilson and Hirst 1977). The correlation of neck length, angle of the jaws and selective feeding habits serves to separate Hippotragus niger from other grazers and suggests why they are habitat limited (Spingage 1986). Water is visited at least every other day and no sable antelope will travel more then 2 miles from a watering hole or river. Salt licks are visited periodically and they will chew on bones to get trace essential elements not present in mineral-deficient soil (Estes 1993).

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Sable antelope help to cycle grass/plant nutrients into other areas and the young are prey for large predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Lions seldom attack adults, because of their size and the formidable fighting abilities of these antelope. Humans are the only real threat to adult sable antelope and their populations (Spinage 1986). Young Hippotragus niger are susceptible to predation by lions, leopards, hyenas, African hunting dogs and crocodiles.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Hippotragus niger is prey of:
Crocodylidae
Homo sapiens
Panthera leo
Panthera pardus
Lycaon pictus
Hyaeninae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Sable antelope in the wild can live up to 16 years and over 19 years in captivity (  http://www.marwell.org.uk/anim-25.htm).

Average lifespan

Status: captivity:
17.0 years.

Average lifespan

Status: captivity:
19.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.2 years (captivity) Observations: In captivity, these animals can live up to 22.2 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Dominant males defend harems of females and their immediate foraging territory extending 300 to 500 meters out from the herd. These dominant males mate with females in their harem and vigorously defend them against intruding males (see behavior section). Males may drop to their knees and engage in horn wrestling in fights. Fatalities from these fights are rare.

Mating System: polygynous

Hippotragus niger females usually undergo only one estrous cycle per breeding season that last from May to July, with a peak mating in June. Gestation lasts 8 to 9 months, allowing for birth at the end of rains. Normally one calf is born during the end of the rainy season when long grass is available for cover. The mother stays concealed for the first week of the calf’s three-week hiding phase. After the first week, the mother joins a maternal group that the calf will eventually join. Yet, the calf will seek out the mother only for nursing. In fact, the mother-offspring bond is so feeble, even small calves will spend days apart in a divided herd. Weaning takes place six months after birth, usually towards the end of the dry season when “sourveld” vegetation is lowest in protein and other nutrients (Wilson and Hirst 1977). Females start to breed at 2.5 years old and congregate in social groups that are a rank hierarchy based on seniority. Males are subordinate to females until they are bigger. At 3 to 4 years of age males are evicted from female social groups and live in bachelor herds until they reach sexual maturity at 5 years (Estes 1993).

Breeding season: Mating occurs from May to July, birthing occurs from January to April.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 8.63 to 9.07 months.

Average gestation period: 8.87 months.

Range weaning age: 6 to 8 months.

Range age at sexual or reproductive maturity (female): 2.5 to 5 years.

Range age at sexual or reproductive maturity (male): 2.5 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 16375 g.

Average number of offspring: 1.

Females care for their young primarily by nursing them and hiding them from predators. Young are weaned at 6 months of age.

Parental Investment: altricial ; female parental care ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippotragus niger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGACTATTTTCAACTAACCATAAAGATATCGGCACCCTATACCTCCTATTCGGTGCTTGAGCTGGCATGGTAGGGACCGCCCTAAGCCTACTAATTCGCGCTGAGTTAGGCCAACCTGGAACCTTACTTGGGGATGACCAGATCTACAACGTAGTCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGGTTTGGCAACTGATTAGTTCCTTTAATAATTGGAGCCCCCGACATGGCATTCCCTCGAATAAACAATATAAGCTTTTGACTGCTTCCCCCTTCCTTTCTGTTACTCCTAGCATCCTCTATGGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTATACCCCCCTCTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTGGATCTCACCATTTTCTCTCTACACCTAGCAGGTGTTTCCTCAATTCTAGGGGCCATCAACTTTATTACAACAATTATTAACATAAAACCCCCTGCAATAACACAATATCAAACACCCTTATTCGTGTGATCCGTATTAATTACTGCCGTATTACTACTCCTATCACTCCCTGTACTAGCAGCCGGCATTACAATACTACTAACGGACCGAAATCTAAATACTACCTTCTTTGATCCAGCAGGAGGAGGAGATCCTATCCTATATCAGCACCTATTCTGATTTTTTGGCCACCCTGAAGTATATATTCTTATTCTACCCGGATTCGGAATAATTTCTCACATCGTGACCTATTATTCAGGGAAAAAAGAACCATTCGGGTACATGGGAATAGTATGAGCTATAATATCAATCGGGTTCCTAGGGTTTATCGTATGGGCTCATCACATATTTACAGTCGGCATAGACGTCGATACACGAGCCTACTTCACATCAGCCACCATAATTATTGCTATCCCAACCGGAGTAAAAGTCTTCAGCTGATTAGCAACACTTCATGGGGGTAACATTAAATGATCTCCCGCTATAATATGAGCCCTAGGCTTCATTTTCCTCTTCACAGTTGGGGGCCTAACCGGAATTGTCCTAGCCAATTCTTCCCTCGACATTGTTCTTCACGATACATATTATGTAGTCGCACATTTCCACTACGTATTATCAATAGGAGCCGTATTCGCTATCATAGGAGGGTTCGTACATTGATTTCCCTTATTCTCAGGTTATACTCTAAACATAACATGAGCCAAAATCCACTTCGCAATTATATTTGTAGGCGTAAACATAACTTTCTTCCCACAACATTTCTTAGGCTTATCTGGCATGCCACGACGATACTCTGATTACCCAGACGCATACACAATATGAAACACTATCTCATCTATGGGTTCATTTATTTCACTAACAGCGGTAATACTAATAGTTTTCATCATCTGAGAGGCATTCGCATCCAAACGGGAAGTCCTAACTGTGGACCTAACTACAACAAATCTAGAGTGACTAAACGGATGTCCCCCACCATATCACACATTTGAAGAACCCACATATGTCAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hippotragus niger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as Sable are currently estimated to number ca. 75,000, and population trends are more or less stable in protected areas, increasing on private land and decreasing elsewhere (25%). The overall conservation status is unlikely to change, since any further decrease in the free-living population may be compensated by the continued growth of its numbers on private farms and conservancies. The latter should continue in view of this spectacular antelope’s aesthetic appeal and its high value as a trophy animal. Nonetheless, certain subpopulations remain vulnerable, in particular that of the Giant Sable in Angola.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN lists Hippotragus niger as lower risk and conservation dependent, but declining numbers could lead to a threatened listing in the near future. The subspecies Hippotragus niger variani is listed as endangered due to habitat loss and trophy hunting. Studies in the past show that a complex blend of factors such as disease, malnutrition, and habitat quality compounded by interspecific competition and attempts to manipulate populations have limited sable antelope numbers. Historic data has demonstrated their tendency to be dense in some regions and practically nonexistent in others, even in well managed national parks (Wilson and Hirst 1977).

US Federal List: endangered

CITES: appendix i; no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1). Four subspecies of sable antelope are currently recognised: Hippotragus niger kirkii (Zambian sable), H. n. niger (common or southern sable), H. n. roosevelti (eastern sable), and H. n. variani (giant or Angolan sable) (3). Of these, the giant sable antelope (H. n. variani) is classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and is listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Summation of available population estimates gives a total population of about 54,000 Sable, but this does not allow for undercounting bias in aerial surveys or parts of the species’ range for which estimates of numbers are unavailable. East (1999) estimated the total population at 75,000, of which about half occurs in and around protected areas and one-quarter on private land. The population in the Selous ecosystem probably represents the largest free-ranging population in Africa. Overall population trends are more or less stable in protected areas, increasing on private land and decreasing etsewhere (East 1999).

Total numbers of the Giant Sable surviving are estimated (2007) at 200-400 (P. vaz Pinto in litt to ASG, 2007).

Like other ungulates of the miombo woodlands, the Sable occurs at low density in comparison with ungulate densities in semi-arid savanna. Wilson and Hirst (1977) estimated density at 4/km² in the Matetsi area of SW Zimbabwe, which they considered the best Sable habitat in southern African.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Sable have been eliminated from large areas of their former range by meat hunting and loss of habitat to the expansion of agricultural settlement and livestock. Poaching and armed conflict have been a major threat, specially for the Giant Sable (H. n. variani) and Sable populations in Mozambique. Further decline in the distribution and numbers of the Sable Antelope may occur in the more northerly parts of its range in future, unless the expansion of human populations and livestock is countered by the implementation of higher levels of protection and management of wildlife in countries such as Tanzania, Zambia, Malawi and Mozambique (East 1999).

The survival of the Giant Sable through more than 20 years of civil war is highly encouraging, but its survival remains precarious as many Angolans who fled the Luando Reserve during the mid-1970s flood back to areas they had formerly evacuated. There have been recent incidents of hybridization of Giant Sable with Roan Antelope in the Cangandala N.P. (Vaz Pinto 2006).

Inbreeding, evidenced by increased calf mortality, is a major risk in many of the smaller, privately owned herds (Grobler and van der Bank 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sable antelope have been eliminated from large areas of their former range due to a combination of disease, drought-caused food shortages, and habitat loss and degradation, compounded by interspecific competition (3) (5). Subsistence hunting poses an additional threat (3), and its powerful stature and imposing horns have also made this species a prized trophy animal to many big-game hunters, some of which are willing to pay thousands of dollars to hunt them (5). As the African human population continues to grow, the rate of habitat loss due to pressure for agricultural land, and poaching for protein-rich meat are likely to grow (3). The giant sable antelope (H. n. variani) occupies a particularly precarious position in Angola (3), and was classified as Vulnerable on the IUCN Red List even before the commencement of 20 years of civil war (6). With the onset of civil war, most of the protected areas in which the giant sable antelope was found were evacuated, and have been left unattended and unprotected for more than 25 years (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Sable sunrvive in good and generally stable numbers in areas such as Moyowosi-Kigosi, Katavi-Rukwa and the Ruaha and Selous ecosystems (Tanzania), Kafue (Zambia), Liwonde (Malawi), Okavango and Chobe (Botswana), Hwange, Matetsi, Sebungwe and the Middle Zambezi Valley (Zimbabwe) (East 1999). The population in Kruger N.P. (South Africa) has been in decline (Grant and van der Walt 2000). In addition, there are relatively large, increasing numbers on private farms and conservancies in Namibia (extralimital), Zimbabwe and South Africa (East 1999).

Luando Reserve and Cangandala N.P. are the essential strongholds for Giant Sable (East 1999). There have been calls for the establishment of a Giant Sable National park to encompass both these protected areas (Walker 2002).

Sable are held in captivity, although no individuals of the Giant Sable subspecies are held captive.

Hippotragus niger variani is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

With three quarters of the wild population living on protected natural habitat in national parks, national game reserves, private game reserves, conservancy lands, and private farms, this species is currently considered stable. Sable antelope are held in a number of zoos throughout the world, and the North American Regional Studbook has recently been published, helping to keep captive populations genetically healthy by coordinating breeding between institutions (3). However, due to their aggressive nature and strong social inclusion and exclusion structures, sable antelope can pose difficulties to captive management (3). The Critically Endangered giant sable antelope occurs in the Luando Reserve and Cangandala National Park (6), but its future nevertheless remains uncertain (3). Strict legislation and enforcement are required to protect this magnificent animal from poachers (6), but before this is likely to become a viable prospect or priority, it is essential for the Angolan government to reach stability and for the quality of life of the Angolan people to be improved (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sable antelope have no negative affects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sable antelope are found in parks all across eastern and southern Africa offering an attraction to the ecotourism industry. Sable antelope are prized trophy animals to many big-game hunters and some are willing to spend thousands of dollars to hunt them. However, declining sable antelope numbers calls into question the advisability of hunting them.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sable antelope

The sable antelope (Hippotragus niger) is an antelope which inhabits wooded savannah in East Africa south of Kenya, and in Southern Africa.

Subspecies[edit]

The four subspecies are:

Physical description[edit]

The sable antelope is sexually dimorphic, with the male heavier and about one-fifth taller than the female.[2] The head-and-body length is typically between 190–255 cm (75–100 in).[3] Males reach about 117–140 cm (46–55 in) at the shoulder, while females are slightly shorter. Males typically weigh 235 kg (518 lb) and females 220 kg (490 lb).[4] The tail is 40–75 cm (16–30 in) long, with a tuft at the end.[3][2]

The sable antelope has a compact and robust build, characterised by a thick neck and tough skin.[2] It has a well-developed and often upright mane on its neck as well as a short mane on the throat.[4] Their general colouration is rich chestnut to black. Females and juveniles are chestnut to dark brown, while males begin darkening and turn black after three years. However, in southern populations, females have a brown to black coat. Calves below two months are a light tan and show faint markings.[4] The underparts, cheek, and chin are all white, creating a great contrast with the dark back and flanks.[2] Long, white hairs are present below the eyes, and a wide, black stripe runs over the nose.[3]

Both sexes have ringed horns which arch backward. In females, these can reach 61–102 cm (24–40 in), while in males they are 81–165 cm (32–65 in) long.[4] The average lifespan of the sable antelope is 16 years in wild and 19 years in captivity.[5]

Ecology and behavior[edit]

Sable antelope live in savanna woodlands and grasslands during the dry season, where they eat mid-length grasses and leaves. Sable antelope visit salt licks and have been known to chew bones to collect minerals. They are diurnal, but are less active during the heat of the day. They form herds of 10 to 30 females and calves led by a single male, called a bull. Males fight among themselves; they drop to their knees and use their horns.

In each herd, the juvenile males are exiled from the herd at about three years old. All of the female calves remain, however. When the herd gets too large, it divides into smaller groups of cows and their young. These groups form new herds, once again with only one adult bull. The young males, which have been separated from the herd, associate in "bachelor groups" of up to 12 individuals. Among the bachelors, the most dominant is the first individual to join a new group of females when the position is open. Very seldom, during their fights for dominance, are they able to inflict bodily harm to the contender.

When sable antelopes are threatened by predators, including lions, they confront it, using their scimitar-shaped horns. Many of these big cats have died during such fights. Numbers have been reduced severely as part of regional tse-tse fly control programs.

The grassland habitat of the sable is being reduced by habitat destruction for agricultural development. Antelope are important to their habitats as grazers and browsers. They are also important as prey for carnivores.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Hippotragus niger. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved November 2008.Database entry includes a brief justification of why this species is of Least concern.
  2. ^ a b c d Nowak, R. M. (1999). Walker's Mammals of the World (6th ed. ed.). Baltimore, Maryland: Johns Hopkins University Press. pp. 1174–5. ISBN 0801857899. 
  3. ^ a b c Huffman, B. "Sable antelope". Ultimate Ungulate. Retrieved 6 March 2014. 
  4. ^ a b c d R. D., Estes (1999). The Safari Companion : A Guide to Watching African Mammals, Including Hoofed Mammals, Carnivores, and Primates (Rev. ed. ed.). White River Junction: Chelsea Green Pub. Co. pp. 98–100. ISBN 1890132446. 
  5. ^ "Hippotragus niger (mbarapi or sable antelope)". University of Michigan Museum of Zoology. Animal Diversity Web. Retrieved 6 March 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!