Overview

Brief Summary

Biology

This large, horse-like mammal moves around in herds of 5 to 35 animals consisting of females and their young, and a single male that defends the herd from other males (2). Roan antelope do not have fixed territories, so the dominant male excludes other males from a 500 metre radius around the herd (3). If the dominant male encounters another adult male a violent interaction may sometimes ensue; they strut proudly around in circles before running forward, dropping to their knees and clashing their enormous horns ferociously together (2). Roan antelope graze on medium to tall grasses (3) (4), occasionally also feeding on shrubs, herbs and the pods of Acacia trees. They drink regularly, thus can only inhabit areas with easy access to water (2). Breeding can occur at any time throughout the year, but births are rarer in the dry season. Gestation lasts for around 280 days and the female gives birth to her calf in a secluded area. While the mother returns to the herd within one week, the young remains in hiding until old enough to keep up with the herd (2), with the mother returning to the calf to suckle in the early morning and late afternoon (4). Females reach sexual maturity at about two years of age; males are not sexually mature until three years (2), when they are forcibly evicted from the herd by the dominant male (3). For the next three years the young male will live in a bachelor herd with up to ten others, before winning the position as dominant male in a female herd. Roan antelope are known to live for up to 17 years (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The roan antelope is one of the largest of all African bovids, exceeded only in size by the African buffalo and eland (3). It is somewhat horse-like in appearance with a number of striking features (4); a distinct, erect mane runs from between the ears to just beyond the shoulders; massive, heavily-ringed horns, measuring up to a metre, curve back away from the head; and the face bears a prominent black and white pattern (2) (4). The roan antelope is tall and powerful with a thick neck (2), and long, narrow ears tipped with a tassel of hair (4). The coarse coat varies in colour depending on the region; from grey, to more tawny, to reddish, and the hairs of the mane are dark at the tips (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Roan Antelope formerly occurred very widely in the savanna woodlands and grasslands of sub-Saharan Africa, but has been eliminated from large parts of its former range. Remarkably, the species remains locally common in West and Central Africa, while in East and southern Africa, the traditional antelope strongholds, the species is now very rare. The species is now locally extinct in Burundi, Eritrea and possibly Gambia. It was also eliminated from Swaziland and later reintroduced to the privately owned Mkhaya Nature Reserve (East 1999; Chardonnet and Crosmary in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Roan antelope occur from south Sahara to Botswana. Two subspecies, H. equinus kobc and H. equinus bokeri, occupy the northern savannah of Africa from Chad to Ethiopia. The other two subspecies, H. equinus equinus and H. equinus cottoni, are located in the southern savannah of Africa in south and central Africa. (Knowles 2000)

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in the savannas of Africa (4), from Senegal east to western Ethiopia, and south to South Africa, northern Botswana, and Namibia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Roan antelope are the second largest antelope species. Their pelage is grayish-brown with a hint of red. The legs are darker than the rest of the body. Young roan antelope are much lighter and reddish-brown. The head is dark brown or black, with white around the mouth and nose, large white patches in front of the eyes and pale patches behind them. The ears are long and narrow, with dark brown hair at the tips. Roan antelope have a mane consisting of short stiff hair that is black at the tips. The tail has a brush of black hair at the tip. Horns in both sexes rise from the top of the head and sweep backwards in an even curve, ridged almost to the tips and are often described as scimitar-shaped. Females have two pairs of teats between their hind legs. Males are larger and built more sturdily than females, with longer, thicker horns. The penis sheath is clearly visible. Males weigh from 260-300 kg. Females weigh from 225-275 kg. Males are from 150-160 cm high at the shoulder and females range from 140-160 cm in shoulder height. (African Hunting Adventures 2001, Grzimek 1960)

Range mass: 225 to 300 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Savannah woodlands and grasslands, and the bushveld and lowveld of southern Africa, with the cover of high grasses and woody plants playing an important role for both grazing and calving (Chardonnet and Crosmary in press). A water-dependent grazer/browser.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Roan antelope are found in lightly wooded savanna with medium to tall grass and must have access to water (Wildlife Africa CC 2001).

Habitat Regions: tropical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The roan antelope inhabits open or lightly wooded grassland, with medium to tall grass and access to water. It avoids areas of short grass (4), and prefers locations where there are few other herbivores and predators (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Roan antelope are grazers that prefer leaves over stems. They will browse if grazing forage is poor. The preferred feeding height is 15-150 cm and green shoots are often grazed down to a height of 2 cm. Roan antelope feed grasses and other foliage in the morning and evening hours and retreat to more densely wooded areas during the middle of the day. (Schuette 1998)

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Roan antelope are important in nutrient cycling in the savannah ecosystems in which they live. They also serve as important prey species for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Roan antelope live in small herds and will fight aggressively when threatened. Healthy adults are likely to be relatively invulnerable to predation but young, ill, and elderly individuals will be taken by large predators such as lions, hyenas, and African hunting dogs.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Hippotragus equinus is prey of:
Panthera leo
Panthera pardus
Lycaon pictus
Crocuta crocuta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Roan antelope may live up to 17 years in the wild.

Range lifespan

Status: wild:
17 (high) years.

Average lifespan

Status: captivity:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.9 years (captivity) Observations: In the wild it has been estimated that these animals may live up to 19 years (http://www.wildlifesafari.info/). One captive specimen lived for 25.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Dominant males mate with the females in their herd and actively defend access to those females. Males fight among themselves for positions as dominant males with a herd of females. These fights can be ferocious but rarely result in death. Males fight with their scimitar-shaped horns.

Mating System: polygynous

Roan antelope do not seem to have a distinct breeding season. Females go into estrus 2 to 3 weeks after giving birth and seem to be capable of having young every 10 to 10.5 months. A single calf is born after a gestation period of 260 to 281 days. Female roan antelope become reproductively active after they reach 32 to 34 months of age (African Hunting Adventures 2001). They leave the herd for about one or two weeks before giving birth. After giving birth they return to the herd during the day and leaves the newborn in hiding for the day. They returns to the calf at dusk and spends the night with it. Calves stay hidden for about four or five weeks after birth and join the herd after they are strong enough to outrun danger (Wildlife Africa CC 2001). 2001).

Breeding season: Breeding and births can occur throughout the year.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 8.67 to 9.37 months.

Average gestation period: 9.13 months.

Average weaning age: 6 months.

Average age at sexual or reproductive maturity (female): 2-6 years.

Average age at sexual or reproductive maturity (male): 2-6 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 15167 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
814 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Female roan antelope nurse and care for their young in a protected area until the young are strong enough to join the herd.

Parental Investment: altricial ; precocial ; female parental care ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippotragus equinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGACATCGGCACCCTGTACCTCCTATTCGGTGCCTGAGCTGGCATAGTGGGAACCGCCCTAAGTTTACTAATTCGCGCCGAATTAGGTCAGCCTGGGACTCTACTCGGAGATGATCAAATCTACAACGTAGTTGTAACCGCACATGCATTCGTAATAATCTTTTTTATAGTGATACCTATCATAATTGGGGGATTTGGCAACTGACTGGTTCCTCTGATAATTGGGGCCCCCGACATGGCATTCCCTCGAATAAACAACATGAGCTTCTGACTGCTTCCTCCTTCCTTTCTATTACTCCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACCGTATACCCTCCTCTAGCAGGTAACCTGGCCCATGCAGGAGCCTCAGTGGATCTCACCATTTTTTCTCTACACCTAGCAGGTGTTTCCTCAATTCTGGGGGCCATCAACTTTATCACAACAATCATTAACATAAAACCCCCTGCAATAACACAATATCAGACACCCTTATTCGTATGATCCGTATTAATTACTGCCGTATTACTTCTTCTCTCACTCCCCGTACTAGCAGCCGGCATCACAATGCTACTAACAGACCGAAATCTTAATACTACCTTCTTTGATCCAGCAGGGGGAGGGGATCCTATCCTATATCAACACCTGTTCTGATTCTTCGGCCACCCTGAAGTATATATTCTCATTCTACCTGGGTTCGGAATGATTTCTCACATCGTAACTTACTACTCAGGGAAAAAAGAACCATTCGGATACATGGGAATAGTATGGGCTATAATATCAATCGGATTCCTAGGGTTCATCGTATGAGCTCATCATATATTCACAGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCTACCATAATTATTGCCATTCCAACCGGAGTAAAAGTCTTTAGCTGACTAGCAACACTACACGGAGGTAATATTAAATGATCTCCCGCTATAATATGAGCCCTAGGCTTCATTTTCCTCTTCACAGTTGGAGGCCTAACCGGAATTGTCCTAGCCAATTCTTCCCTTGACATTGTTCTCCATGACACATACTACGTAGTCGCACATTTCCACTATGTACTATCAATGGGAGCTGTGTTCGCTATTATAGGGGGATTCGTACACTGATTTCCACTATTTTCAGGCTATACTCTAAGCACAACATGAGCCAAAATCCACTTCGCAATTATATTTGTAGGCGTGAACATAACTTTCTTCCCACAACATTTTTTAGGCTTATCTGGCATGCCACGACGATACTCTGACTACCCAGACGCATACACAATGTGAAACACTATTTCATCTATGGGCTCATTTATTTCACTAACAGCAGTAATACTAATAATTTTCATCATCTGAGAGGCATTCGCATCCAAACGGGAAGTCTCAACCGTAGACCTAACTACAACAAATCTAGAGTGACTAAATGGATGTCCCCCACCATACCACACATTTGAGGAGCCCGCATATGTCAACCTTAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hippotragus equinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Distribution remains widespread and total numbers were estimated to be 76,000, with 60% in protected areas. About one-third of the total population was estimated to stable or increasing, with the rest declining. As yet, the evidence does not indicate that these declines have reached a level that would qualify for Near Threatened or Vulnerable. However, if present trends continue, the Roan Antelope’s status may eventually decline to threatened as it disappears from large parts of its current range because of poaching and loss of habitat to the expansion of settlement. This trend will only be reversed if more of the surviving populations receive adequate protection and management.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Listed by IUCN as lower risk, conservation dependent and is on CITES Appendix III in Ghana. Roan antelope have declined drastically in recent years as a result of habitat deterioration, hunting and poaching, agricultural encroachment, and have been slaughtered deliberately in tsetse fly control efforts.

US Federal List: no special status

CITES: appendix iii; no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Citing various authors East (1999) indicates that summation of the available population estimates suggests a total population of about 40,000 Roan, but this does not allow for undercounting bias in aerial surveys or the extensive areas of the species’ current distribution for which estimates are unavailable. Accounting for these biases, East (1999) gives an estimated total population of 76,000, with the largest populations in Burkina Faso (>7,370), Cameroon (>6,070), Zambia (>5,080) and Tanzania (>4,310). However, large numbers are also believed to survive in southern Sudan. Despite the fact that Roan are generally common in West and Central Africa, some populations are in decline, such as that in Comoé N.P. where numbers have declined by about 70% between 1978 and 1998 to around 500 animals (Fischer and Linsenmair 2001).

Density estimates are summarized by East (1999) and Chardonnet and Crosmary (in press). Overall population trend is generally stable or decreasing in protected areas and decreasing elsewhere, apart from the small numbers on private land in southern Africa which are increasing.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The Roan Antelope has been eliminated from large parts of its former range because of poaching and loss of habitat to the expansion of settlement, and now survives mainly in and around protected areas and in other areas with low densities of people and livestock. Its persistence in West Africa is probably due to its ability to withstand illegal hunting pressures better than many other large herbivores, especially the more water dependant and more sedentary species which are more exposed to poaching (East 1999; Chardonnet and Crosmary in press).

Different explanations have been provided for the decline of Roan and its lack of subsequent recovery in the Kruger N.P. in South Africa (450 animals in 1986 to around 30 in 2001; Harrington et al. 1999; Grant et al. 2002). The most likely reason is increased predation pressure following the influx of grazers from artificial waterpoints (Knoop and Owen-Smith 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the last century, roan antelope have seen a substantial reduction in both numbers and range. In some areas, such as Mauritania, Niger, Uganda, and Kenya, it is close to extinction (2), while in other parts this species has been entirely eliminated, largely as the result of illegal hunting and the destruction of its habitat (6). Generally, it is outside of protected areas that the survival of the roan antelope is most threatened by hunting and habitat destruction (6). However, not all national parks are a guaranteed refuge for this species, as roan antelope numbers fell in Kruger National Park after a decline in rainfall made conditions less favourable for the tall grasses on which roan feed. An influx of zebra and wildebeest, benefiting from the shorter grass conditions, also led to an increase in lion numbers, and consequently resulted in increased predation on adult roan antelope (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
At present, about one-third of the species’ total population occurs in protected areas. The largest surviving populations occur in areas such as Niokolo-Koba (Senegal), Comoe (Côte d'Ivoire), Arly-Singou and Nazinga (Burkina Faso), Mole (Ghana), Pendjari (Benin), Waza National Park and the national parks and hunting zones of North Province (Cameroon), Manovo-Gounda-St. Floris (Central African Republic), Moyowosi-Kigosi and Katavi-Rukwa (Tanzania), the Luangwa Valley (Zambia), Nyika National Park (Malawi) and northern Botswana. Most of these populations are stable or increasing but some, e.g., in Comoe, Arly-Singou and Cameroon’s North Province, are in decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Roan antelope occur within many national parks (6), including Serengeti National Park in Tanzania, a Natural World Heritage Site (8). It is the continued protection of these conservation areas on which this striking antelope's survival relies (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative affects of roan antelope on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Roan antelope were hunted in the past for their meat and for sport. They are declining in numbers and hunting is now illegal. They attract ecotourism activities as well (Benedetti 2001).

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Roan antelope

Roan Antelope at Kafue National Park, Zambia


The roan antelope (Hippotragus equinus) is a savanna antelope found in West, Central, East and Southern Africa. It is the namesake of the Chevaline project, whose name was taken from the French Antelope Chevaline.[2]

Roan antelope are one of the largest species of antelope. They measure 190–240 cm (75–94 in) from the head to the base of tail and the tail measures 37–48 cm (15–19 in). The body mass of males is 242–300 kg (534–661 lb) and of females is 223–280 kg (492–617 lb). The shoulder of this species is typically around 130–140 cm (51–55 in).[3][4][5] Named for their roan colour (a reddish brown), they have lighter underbellies, white eyebrows and cheeks and black faces, lighter in females. They have short, erect manes, very light beards and prominent red nostrils. The horns are ringed and can reach a metre long in males, slightly shorter in females. They arch backwards slightly.

They are similar in appearance to sable antelope and can be confused where their ranges overlap. Sable antelope males are darker, being black rather than dark brown.

Roan antelope are found in woodland and grassland savanna, mainly in the tropical and subtropical grasslands, savannas, and shrublands biome, which range in tree density from forest with a grassy understorey (such as central Zambezian Miombo woodlands) to grasslands dotted with few trees, where they eat midlength grasses. They form harem groups of five to 15 animals with a dominant male. Roan antelope commonly fight among themselves for dominance of their herd, brandishing their horns while both animals are on their knees.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Hippotragus equinus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved November 2008.Database entry includes a brief justification of why this species is of Least concern.
  2. ^ "Roan Antelope". World Association of Zoos and Aquariums. Retrieved 2014-04-14. 
  3. ^ ANIMAL BYTES – Roan Antelope. Seaworld.org. Retrieved on 2013-10-10.
  4. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  5. ^ Roan antelope videos, photos and facts – Hippotragus equinus. ARKive (2011-06-28). Retrieved on 2013-10-10.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!