Overview

Brief Summary

Biology

These antelope are mainly active during the night, particularly in the hot season; in the day, they dig 'beds' into the sand under shade to avoid the heat of the desert sun (2), and also to shelter from sandstorms (10). Small nomadic herds spend most of their time wandering in search of food (5); these previously numbered around 20 individuals but today groups are only two to four strong and lone individuals are also seen (6). When the population was more abundant, these antelope migrated seasonally between the Sahara and the Sahel and aggregations of 1,000 individuals were seen (7). The herds are led by a dominant male and breeding can occur all year round (5). Males defend territories and mate with more than one female. Usually a single young is born and is fully weaned at around a month old (5). In captivity, addax can live up to 25 years (5). Addax feed on desert grasses, but will also browse on herbs and acacia species if grass is unavailable (8). Addax are able to obtain all the water they need from their food and their range is therefore not generally restricted by available water sources (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Addax is a desert living antelope and is well adapted to its harsh habitat; the hooves are splayed to enable them to travel on sand (5), and these antelope produce highly concentrated urine as a method of conserving water (6). The short, glossy coat is a grey-brown colour in the winter, fading to almost white during the summer months (5). The underparts, rump, limbs, chin, lips and inside of the ears are white, as is the x-shaped blaze on the face (7). There is a tuft of dark hair on the forehead and the horns are long and twisted in both sexes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Addax were formerly widespread in the Sahelo-Saharan region of Africa, west of the Nile Valley, and present in suitable habitats in all countries sharing the Sahara Desert (Newby in press). As with other ungulates of the Sahelo-Saharan fauna, the Addax has undergone an unprecedented reduction in geographical range over the past century. Today, the only known remaining population survives in the Termit/Tin Toumma region of Niger. However, there are sporadic records of small isolated groups and individuals from eastern Air Mountains/Western Ténéré desert in Niger, and from the Equey region of western Chad (Newby in press). Possible rare vagrants from these areas may be seen in north Niger, southern Algeria and Libya (Newby in press). There are continued rumours of Addax along the Mali/Mauritania border (Majabat Al Koubra), but no confirmed sightings for several years. However, in early March, 2007, the fresh tracks of about 15 Addax were seen in central Mauritania, in an area where they had not been reported for over 20 years (R. Vernet in Newby in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Formerly occurred in desert and semidesert areas from Western Sahara and Mauritania to Egypt and Sudan. The current range reduced to desert regions in Northeastern Niger, North Central Chad, Northwestern Mali, Eastern Mauritania, Southern Libya, and Northwestern Sudan.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
North Africa

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Once found across northern Africa, on both sides of the Sahara (7), from the west to the east. Populations exist today in a mere fragment of the former range in Niger, Chad, and possibly along the border between Mali and Mauritania (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The addax is a sandy to almost white color during the summer, darkening to a grayish brown in the winter. White markings are present on the face, ears, belly, hips, and legs, and there is a black tuft of hair on the forehead. Horns are present on both males and females, average about 72 cm in length. They have approximately 1.5 to 3 spiral twists. The hooves are widely splayed as an adaption to travelling over desert sand. The addax head-body length is 150-170 cm, shoulder height is 95-115 cm, and tail length is 25-35 cm, with males being slightly larger than females.

Range mass: 60 to 125 kg.

Range length: 150 to 170 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The most desert-loving large ungulate, occurring in areas of extreme temperature and aridity (less than 100 mm annually) (Newby in press). With the exception of truly mountainous areas, Addax have been recorded from all major habitat types in the Sahara, from gravelly and sandy plains, to dune fields, sandy basins and depressions, pans and wadi systems; their preference is for harder, packed sands and flatter areas within and between dune fields that support perennial vegetation (Newby in press; and references therein).

Addax are nomadic, wandering over large areas in search of grazing. In the Sahel, movements tend to be north-south in direction, i.e., from the more arid desert to the less arid sub-desert and Sahel (Gillet 1965; Newby 1978). In central Niger, movement may also be east-west, i.e., from the open desert towards the better-wooded and more varied habitats of the Aïr and Termit mountains (Hue 1960).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The addax is not restricted to areas with free water, and is usually found within the desert or the surrounding stony country.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits sand and stony desert regions (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The addax feeds on desert grasses and scrub. It searches great distances through the Sahara for sparse vegetation. The addax is the most desert-adapted of the antelopes. They spend most of their lives without drinking water; they receive enough moisture to survive from the vegetation they feed on.

Plant Foods: leaves; wood, bark, or stems; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Addaxes can live up to 25 years in captivity.

Range lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: captivity:
19.0 years.

Average lifespan

Status: captivity:
25.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 28 years (captivity) Observations: One wild born specimen was about 28 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding can occur throughout the year, with population birth peaks in winter and early spring. Gestation lasts 257-264 days, and there is almost always one young born. The calf is weaned after 23-39 weeks. Males are sexually mature at about 24 months, females during their second or third summer.

Breeding interval: Addax females give birth to as many as one young each year.

Breeding season: Breeding may occur at any time of the year, but is most common during the spring.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 8.57 to 8.8 months.

Range weaning age: 5.37 to 9.1 months.

Average weaning age: 7.235 months.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 5600 g.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Addax nasomaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGATATCGGTACCTTATACCTTCTATTCGGTGCTTGAGCTGGCATAGTGGGAACTGCCCTGAGCTTACTAATTCGCGCTGAATTAGGCCAACCTGGGACTTTACTTGGAGATGATCAAATCTACAACGTAGTCGTAACCGCACATGCATTCGTAATAATCTTCTTTATAGTAATGCCTATTATGATTGGAGGATTTGGCAACTGACTGGTCCCCCTAATAATTGGAGCCCCCGACATAGCATTCCCTCGAATAAACAATATAAGCTTTTGACTGCTTCCTCCTTCTTTTCTACTACTCCTGGCATCTTCTATAGTTGAAGCTGGAGCTGGAACAGGTTGGACCGTGTATCCCCCTCTAGCGGGCAATCTAGCCCATGCAGGAGCCTCAGTGGATCTCACCATTTTCTCTTTACACTTAGCAGGTGTTTCCTCAATTCTAGGAGCCATTAATTTTATCACAACAATCATTAACATAAAACCCCCTGCAATAACACAATATCAAACTCCCTTGTTTGTATGATCTGTACTAATTACTGCTGTCTTACTTCTCCTTTCACTCCCTGTATTAGCAGCCGGCATTACAATACTATTAACAGATCGAAACCTAAATACAACCTTCTTTGACCCGGCAGGAGGGGGAGACCCTATCCTATACCAACATCTATTCTGATTTTTTGGCCACCCTGAAGTATATATCCTTATTCTACCCGGATTCGGAATGATTTCTCACATCGTAACCTATTACTCAGGAAAAAAAGAACCATTTGGGTATATGGGAATAGTGTGAGCTATAATATCAATCGGATTCTTGGGGTTCATCGTATGAGCTCATCATATATTCACAGTTGGAATAGACGTCGACACACGAGCTTACTTCACATCAGCTACCATAATTATTGCCATCCCAACCGGAGTAAAAGTCTTTAGCTGACTAGCGACACTCCATGGAGGTAATATCAAATGATCTCCCGCTATAATATGGGCCTTAGGCTTCATTTTCCTCTTCACAGTTGGAGGCCTAACCGGAATTGTCCTAGCCAACTCTTCTCTTGACATCGTTCTTCACGATACATATTATGTAGTCGCACATTTTCACTATGTGTTATCAATAGGAGCTGTATTCGCTATCATAGGAGGATTTGTACATTGATTTCCACTATTCTCAGGCTATACCTTAAACATAACATGAGCCAAAATCCATTTCGCAATTATGTTTGTAGGCGTGAACATAACATTCTTCCCACAACACTTCTTAGGCCTGTCTGGCATGCCACGACGATACTCTGATTACCCAGACGCATACACGATGTGAAATACTATCTCATCTATAGGCTCATTTATTTCACTAACAGCAGTAATACTAATAGTTTTCATTATCTGAGAGGCATTTGCATCCAAACGGGAAGTCTCGACCGTAGACCTGACCACAACTAACCTAGAGTGACTAAACGGATGTCCTCCACCATACCACACATTTGAAGAACCCGCATATGTAAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Addax nasomaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd; C1+2a(ii)

Version
3.1

Year Assessed
2008

Assessor/s
Newby, J. & Wacher, T.

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Critically Endangered as the species is believed to have undergone a decline well exceeding 80% over the past three generations (21 years). The total population is estimated at less than 300 individuals across the range, with the majority of the population in the Termit/Tin Toumma region of Niger. The population continues to decline due to ongoing threats of hunting and habitat loss. Along with the Dama Gazelle (Nanger dama), this species is considered to be the Saharan bovid species at highest risk of extinction in the near future.

History
  • 2006
    Critically Endangered
    (IUCN 2006)
  • 2006
    Critically Endangered
  • 2000
    Critically Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/02/2005
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Addax nasomaculatus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Extinct.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Addax are heavily built, slow running antelopes that are easy prey for humans with modern weapons. Hunting has decreased and eliminated many resident populations in many parts of its original range. Tourists in four-wheel-drive vehicles also affect the animals by chasing them until they die of exhaustion. Recent droughts, desertification of savanna lands, and increasing human population have all contributed to the decrease of addax populations.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1). Listed on Appendix I of CITES (3) and Appendix I of the Convention on Migratory Species (CMS or Bonn Convention) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Although long extinct in North Africa, Addax were still present in fair numbers in Mauritania, Mali, Niger and Chad up until the late 1960s and early 1970s (Newby in press). Today, the total global population is estimated at probably less than 300 animals surviving in the wild, distributed unevenly along a narrow, 600-km-long band lying between Termit/Tin Toumma in Niger and the Bodélé Depression in Chad (Newby in press). Ground and aerial surveys of Termit/Tin Toumma carried out in 2004 (Wacher et al. 2004) indicate a population of between 100 and 200 head. A total count carried out by SOS Faune du Niger in October 2004 returned a figure of 128 Addax for a little under 10,000 km² of prime habitat in Termit, Niger (see Newby in press). Otherwise, Addax seem to retain a highly fragmented distribution, based on sightings of individuals and small groups.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The primary factors in the decline of Addax are uncontrolled hunting and harassment. Drought and the extension of pastoralism into desert lands, thanks to the increase in wells, have also taken a heavy toll (Beudels-Jamar et al. 2005; Newby in press). Demographic factors (very small size of subpopulations, extreme fragmentation) are also expected to have an adverse effect.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The population of addax is today a mere fraction of what it once was and this dramatic decrease is mainly attributed to over-hunting. These slow-moving animals provide easy targets, particularly with motorized vehicles and automatic weapons, and their meat and leather are prized by local people (8). Other factors involved in the decline include desertification, drought and habitat encroachment by pastoral expansion and subsistence agriculture (5) (10). It is estimated that fewer than five hundred individuals survive in the wild today, with the bulk of these lying between the Termit area of Niger and the Bodélé region of Western Chad (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on CMS Appendix I, and included in the CMS Sahelo-Saharan Antelopes Action Plan (Beudels-Jamar et al. 2005). It is protected under national legislation in Morocco, Tunisia, and Algeria; in Libya and Egypt hunting of all gazelles is forbidden by law.

Although massive reserves, such as the Ahaggar and Tasilli in Algeria, the Aïr/Ténéré in Niger, the Ouadi Rimé-Ouadi Achim in Chad, and the newly established Wadi Howar N.P. in Sudan cover areas where Addax previously occurred, some are under-resourced and all no longer harbour Addax (Newby in press). Continued support for gazetted reserves in Chad and Niger, together with the establishment of new protected areas, especially along the Mali/Mauritania frontier (Majabat), Niger (Termit/Tin Toumma) and Chad (Bodélé, Egueï), is essential, but must be supported and combined with programmes to create incentives for the local people to protect wildlife wherever it is found (Newby in press).

Addax have been reintroduced to fenced sectors of protected areas in Tunisia (Bou Hedma NP) and Morocco (Souss-Massa: 70 animals released 1994-97, increased to c. 550 by 2007; Cuzin et al. in press). The first reintroduction in the wild is underway in Jebil National Park, Tunisia, in the Great Eastern Erg and another is planned in southern Morocco.

There are over 600 Addax in Europe, Libya (Sabratha), Egypt (Giza Zoo), North America, Japan and Australia in managed breeding programmes, and at least 1,000 more individuals are held in private collections and ranches in the United States and the Middle East (Newby in press, T. Jdeidi pers. comm.).

Listed in CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The addax is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), thus prohibiting international trade (3). Provided effective protection is granted for the last remaining pockets of populations, it is possible that the species can increase. With this in mind, the Sahara Conservation Fund has developed a regional strategy that when implemented will protect the remaining wild populations and facilitate the recolonisation of neighbouring suitable habitats (10). A protected population exists in the Yotvata Hai-Bar (Wildlife Preserve) Nature Reserve in Israel, to the north of Elat (11). The reserve was set up in 1968 with the view to bolster populations of endangered desert species (12). In Niger, a vast protected area is being established in the Termit region to protect the largest remaining addax population in the wild (10). There are currently around 2,000 individuals in captive populations around the world and these are being used in reintroduction programmes for the species in Tunisia and Morocco (7) (13) (14).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The meat and the skin of the addax are prized by local people, who use the hides for shoes and sandal soles.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Addax

For the GP2 Series racing team, see Addax Team.

The addax (Addax nasomaculatus), also known as the white antelope and the screwhorn antelope, is an antelope of the genus Addax, that lives in the Sahara desert. It was first described by Henri de Blainville in 1816. As suggested by its alternative name, this pale antelope has long, twisted horns - typically 55 to 80 cm (22 to 31 in) in females and 70 to 85 cm (28 to 33 in) in males. Males stand from 105 to 115 cm (41 to 45 in) at the shoulder, with females at 95 to 110 cm (37 to 43 in). They are sexually dimorphic, as the females are smaller than males. The colour of the coat depends on the season - in the winter, it is greyish-brown with white hindquarters and legs, and long, brown hair on the head, neck, and shoulders; in the summer, the coat turns almost completely white or sandy blonde.

The addax mainly eats grasses and leaves of any available shrubs, leguminous herbs and bushes. These animals are well-adapted to exist in their desert habitat, as they can live without water for long periods of time. Addax form herds of five to 20 members, consisting of both males and females. They are led by the oldest female. Due to its slow movements, the antelope is an easy target for its predators: lions, humans, African hunting dogs, cheetahs and leopards. Breeding season is at its peak during winter and early spring. The natural habitat of the addax are arid regions, semideserts and sandy and stony deserts.

The addax is a critically endangered species of antelope, as classified by the IUCN. Although extremely rare in its native habitat due to unregulated hunting, it is quite common in captivity. The addax was once abundant in North Africa, native to Chad, Mauritania and Niger. It is extinct in Algeria, Egypt, Libya, Sudan and Western Sahara. It has been reintroduced in Morocco and Tunisia.

Taxonomy and naming[edit]

The scientific name of the addax is Addax nasomaculatus. This antelope was first described by French zoologist and anatomist Henri Blainville in 1816. It is placed in the monotypic genus Addax and family Bovidae.[2] Henri Blainville observed syntypes in Bullock's Pantherion and the Museum of the Royal College of Surgeons. English naturalist Richard Lydekker stated their type locality to be probably Senegambia, though he did not have anything to support the claim. Finally, from a discussion in 1898, it became more probable that British hunters or collectors obtained the addax from the part of Sahara in Tunisia.[2]

The generic name Addax is thought to be obtained from an Arabic word meaning a wild animal with crooked horns.[4] It is also thought to have originated from a Latin word. The name was first used in 1693.[5] The species name nasomaculatus comes from the Latin words nasus (or the prefix naso) meaning nose, and macula, spot or spotted, and the suffix –atus refers to the spots and facial markings of the antelope. Bedouins use another name for the addax, the Arabic bakr (or bagr) al wahsh, which literally means the cow of the wild. The name can be used to refer to other ungulates, as well.[3][4] The other common names of addax are "white antelope" and "screwhorn antelope".[6]

Genetics[edit]

The addax has 27 male chromosomes and 28 female chromosomes. All chromosomes are acrocentric but the first pair of autosomes, which is submetacentric. The X chromosome is the largest acrocentric, and the Y chromosome a medium-sized one. The short and long arms of the pair of submetacentric autosomes correspond respectively to the 27th and first chromosome. In a study, the banding patterns of chromosomes in addax were found to be much similar to those in four other species of the subfamily Hippotraginae. Karyotypes of caprine and bovine species also highly resemble the banding patterns in addax.[3][7]

History and fossil record[edit]

In ancient times, the addax occurred from Northern Africa through Arabia and the Levant. Pictures in a tomb, dating back to the 2500 BCE show at least the partial domestication of the addax by the ancient Egyptians. These pictures show addax and some other antelopes tied with ropes to stakes. The number of addax captured by a person were considered an indicator of his high social and economic position in the society.[6] But today excess poaching has resulted in the extinction of this species in Egypt since the 1960s.[8]

Addax fossils have been found in four sites of Egypt - 7000 BCE fossil from Great Sandsee, 5000–6000 BCE fossil from Djara, 4000–7000 BCE fossil from Abu Ballas Stufenmland and 5000 BCE fossil from Gilf Kebir. Apart from these, fossils have also been excavated from Mittleres Wadi Howar (6300 BCE fossil), and Pleistocene fossils from Grotte Neandertaliens, Jebel Irhoud and Parc d'Hydra.[3]

Physical description[edit]

Summer coat
The coat colour in summer
Winter coat
The coat colour in winter

The addax is a spiral-horned antelope. Male addax stand from 105 to 115 cm (41 to 45 in) at the shoulder, with females at 95 to 110 cm (37 to 43 in). They are sexually dimorphic, as the females are smaller than males.[9] The head and body length in both sexes is 120 to 130 cm (47 to 51 in), with a 25 to 35 cm (9.8 to 13.8 in) long tail. The weight of males varies from 100 to 125 kg (220 to 276 lb), and that of females from 60 to 90 kg (130 to 200 lb).[3]

The coloring of the addax's coat varies with the season. In the winter, it is greyish-brown with white hindquarters and legs, and long, brown hair on the head, neck, and shoulders. In the summer, the coat turns almost completely white or sandy blonde.[3] Their head is marked with brown or black patches that form an 'X' over their noses. They have scraggly beards and prominent red nostrils. Long, black hairs stick out between their curved and spiralling horns, ending in a short mane on the neck.[10]

The horns, which are found on both males and females, have two to three twists and are typically 55 to 80 cm (22 to 31 in) in females and 70 to 85 cm (28 to 33 in) in males, although the maximum recorded length is 109.2 cm (43.0 in).[3] The lower and mid portions of the horns are marked with a series of 30 to 35 ring-shaped ridges.[3] The tail is short and slender, ending in a puff of black hair. The hooves are broad with flat soles and strong dewclaws to help them walk on soft sand.[10] All four feet possess scent glands.[3] The life span of the addax is up to 19 years in the wild,[4] which can be extended to 25 years under captivity.[3][9]

The addax closely resembles the scimitar oryx, but can be distinguished by its horns and facial markings. While the addax is spiral-horned, the scimitar oryx has straight, 127 cm (50 in) long horns. The addax has a brown hair tuft extending from the base of its horns to between its eyes. A white patch, continuing from the brown hair, extends till the middle of the cheek. On the other hand, the scimitar oryx has a white forehead with only a notable brown marking a brown lateral stripe across its eyes.[3] It differs from other antelopes by having large, square teeth like cattle, and lacking the typical facial glands.[3]

Parasites[edit]

The addax are most prone to parasites in moist climatic conditions.[11] Addax have always been infected with nematodes in the Trichostrongyloidea and Strongyloidea families.[12] In an exotic ranch in Texas, an addax was found host to the nematodes Haemonchus contortus and Longistrongylus curvispiculum in its abomasum,[3] out of which the former was more dominant.[13]

Behavior and ecology[edit]

These animals are mainly nocturnal, particularly in summers. In the day, they dig into the sand in shady locations and rest in these depressions, which also protect them from sandstorms. Addax herds contain both males and females, and have from five to 20 members. They will generally stay in one place and only wander widely in search of food. The addax have a strong social structure, probably based on age, and herds are led by the oldest female.[3] Herds are more likely to be found along the northern edge of the tropical rain system during the summer and move north as winter falls. They are able to track rainfall and will head for these areas where vegetation is more plentiful. Males are territorial, and guard females,[14] while the females establish their own dominance hierarchies.[15]

Due to its slow movements, the addax is an easy target for predators such as lions, humans, African hunting dogs, cheetahs and leopards. Caracals, hyenas and servals attack calves. The addax are normally not aggressive, though individuals may charge if they are disturbed.[3]

Adaptations[edit]

Addax grazing in dry conditions

The addax are amply suited to live in the deep desert under extreme conditions. They can survive without free water almost indefinitely, because they get moisture from their food and dew that condenses on plants. Scientists believe the addax has a special lining in its stomach that stores water in pouches to use in times of dehydration. They also produce highly concentrated urine to conserve water.[16] Pale colour of the coat reflects radiant heat, and the length and density of the coat helps in thermoregulation. In the day the addax huddle together in shaded areas, and in cool nights rest in sand hollows. These practices help in dissipation of body heat and saving water by cooling the body through evaporation.[3]

In a study, eight addax antelopes on a diet of grass hay (Chloris gayana) were studied to determine the retention time of food from the digestive tract. It was found that food retention time was long, taken as an adaptation to a diet including a high proportion of slow fermenting grasses; while the long fluid retention time could be interpreted to be due to water-saving mechanisms with low water turnover and a roomy rumen.[17]

Diet[edit]

A calf with its mother

The addax live in desert terrain where they eat grasses and leaves of what shrubs, leguminous herbs and bushes are available. Their staple foods are the Aristida, Artemisia, Citrullus and Acacia grasses;[18] perennials which turn green and sprout at the slightest bit of humidity or rain. The addax eat only certain parts of the plant and tend to crop the Aristida grasses neatly to the same height. By contrast, when feeding on Panicum grass, the drier outer leaves are left alone while they eat the tender, inner shoots and seeds. These seeds are important part of the addax diet, being their main source of protein.[10]

Reproduction[edit]

Females are sexually mature at two to three years of age and males at about two years. Breeding occurs throughout the year, but it peaks during winter and early spring. In the northern Sahara, breeding peaks at the end of winter and beginning of spring; in the southern Sahara, breeding peaks from September to October and from January to mid-April. Each estrus bout lasts for one or two days.[3]

In a study, the blood serum of female addax was analyzed through immunoassay to know about their luteal phase. Estrous cycle duration was of about 33 days. During pregnancy, ultrasonography showed the uterine horns as coiled. The maximum diameters of the ovarian follicle and the corpus luteum were 15 mm (0.59 in) and 27 mm (1.1 in). Each female underwent an anovulatory period lasting 39 to 131 days, during which there was no ovulation. Anovulation was rare in winter, which suggested the effect of seasons on the estrous cycle.[19]

Gestation period lasts 257–270 days (about 9 months). Females may lie or stand during the delivery, during which one calf is born. A postpartum estrus occurs after two or three days.[20] The calf weighs 5 kg (11 lb) at birth and is weaned at 23–29 weeks old.[21]

Habitat and distribution[edit]

The addax inhabits arid regions, semideserts and sandy and stony deserts.[16] They even occur in extremely arid areas, with less than 100 mm annual rainfall.[1] They also inhabit deserts with tussock grasses (Stipagrostis species) and succulent thorn scrub (Cornulaca).[22] Formerly, the addax was widespread in the Sahelo-Saharan region of Africa, west of the Nile Valley and all countries sharing the Sahara Desert; but today the only known self-sustaining population is present in the Termit Massif Reserve (Niger). However, there are reports of sightings from the eastern Air Mountains (Niger) and Equey (Chad). Rare nomads may be seen in north Niger, southern Algeria and Libya; and the antelope is rumoured to be present along the Mali/Mauritania border, though there are no confirmed sightings.[1] The addax was once abundant in North Africa, native to Chad, Mauritania and Niger. It is extinct in Algeria, Egypt, Libya, Sudan and western Sahara. It has been reintroduced in Morocco and Tunisia.[1]

Threats and conservation[edit]

Addax in Prague Zoo, Czech Republic

Decrease in the population of the addax has begun notably since the mid-1800s.[22] More recently, addax were found from Algeria to Sudan, but due mainly to overhunting, they have become much more restricted and rare.[1]

Addax are easy to hunt due to their slow movements. Roadkill, firearms for easy hunting and nomadic settlements near waterholes (their dry-season feeding places) have also decreased numbers.[23] Moreover, their meat and leather are highly prized. Other threats include chronic droughts in the deserts, habitat destruction due to more human settlements and agriculture. Less than 500 individuals are thought to exist in the wild today, most of the animals being found between the Termit area of Niger, the Bodélé region of western Chad,[1] and the Aoukar in Mauritania.[24]

Today there are over 600 addax in Europe, Yotvata Hai-Bar Nature Reserve (Israel), Sabratha (Libya), Giza Zoo (Egypt), North America, Japan and Australia under captive breeding programmes. There are 1000 more in private collections and ranches in United States and the Middle East. Addax is legally protected in Morocco, Tunisia, and Algeria; hunting of all gazelles is forbidden in Libya and Egypt. Although enormous reserves, such as the Hoggar Mountains and Tasilli in Algeria, the Ténéré in Niger, the Ouadi Rimé-Ouadi Achim Faunal Reserve in Chad, and the newly established Wadi Howar National Park in Sudan cover areas where addax previously occurred, some do not keep addax any more due to less resources. The addax has been reintroduced in Bou Hedma National Park (Tunisia) and Souss-Massa National Park (Morocco). The first reintroduction in the wild is ongoing in Jebil National Park (Tunisia), Grand Erg Oriental (Sahara) and another is planned in Morocco.[1]

References[edit]

  1. ^ a b c d e f g IUCN SSC Antelope Specialist Group (2008). Addax nasomaculatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 13 November 2008.Database entry includes justification for why this species is listed as critically endangered and the criteria used.
  2. ^ a b c d Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 717. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ a b c d e f g h i j k l m n o p q Krausman, P.R. & Casey, A.L. (2012). "Addax nasomaculatus". Mammalian Species: Number 807: pp. 1–4. doi:10.1644/807.1. 
  4. ^ a b c Huffman, B. "Addax". Ultimate Ungulate. Retrieved 13 January 2013. 
  5. ^ "Entry Addax". Encyclopaedia Britannica. Merriam-Webster. Retrieved 13 January 2013. 
  6. ^ a b Burton, M.; Burton, R. (2002). International Wildlife Encyclopedia (3rd ed.). New York: Marshall Cavendish. pp. 24–5. ISBN 978-0-7614-7266-7. 
  7. ^ Claro, F.; Hayes, H.; Cribiu, E.P. (1996). "The karyotype of the addax and its comparison with karyotypes of other species of Hippotraginae antelopes.". Hereditas 124 (3): 223–7. doi:10.1111/j.1601-5223.1996.00223.x. PMID 8931355. 
  8. ^ Manilus, N. (2000). "Historical ecology and biogeography of the addax in Egypt". Israel Journal of Zoology 46 (4): 261–71. doi:10.1560/H4XC-Y7PP-T1D9-014B. 
  9. ^ a b Atlan, B. "Addax nasomaculatus". University of Michigan Museum of Zoology. Animal Diversity Web. 
  10. ^ a b c Burton, M.; Burton, R. (1974). The Funk & Wagnalls Wildlife Encyclopedia 1. New York, N.Y.: Funk and Wagnalls. OCLC 20316938. 
  11. ^ Mungall, E. C. (2007). Exotic Animal Field Guide : Nonnative Hoofed Mammals in the United States (1st ed.). College Station: Texas A&M University Press. ISBN 1-58544-555-X. 
  12. ^ AAZPA Regional Conference Proceedings. American Association of Zoological Parks and Aquariums. 1993. p. 553. 
  13. ^ Craig, T.M. (1993). "Longistrongylus curvispiculum (Nematoda: Trichostrongyloidea) in free-ranging exotic antelope in Texas". Journal of wildlife diseases 29 (3): 516–7. doi:10.7589/0090-3558-29.3.516. PMID 8355363. 
  14. ^ Spevak, E.M., et al. (1993). "Species survival plan contributions to research and reintroduction of the addax Addax nasomaculatus". International Zoo Yearbook 32 (1): 91–98. doi:10.1111/j.1748-1090.1993.tb03520.x. 
  15. ^ Reason, R.C. & Laird, E.W. (1988). "Determinants of dominance in captive female addax (Addax nasomaculatus)". Journal of Mammalogy 69 (2): 375–377. doi:10.2307/1381391. 
  16. ^ a b "Addax". Wildscreen. ARKive. 
  17. ^ Hummel, J.; Steuer, P.; Südekum, Karl-Heinz; Hammer, S.; Hammer, C.; Streich, W. J.; Clauss, M. (2008). "Fluid and particle retention in the digestive tract of the addax antelope (Addax nasomaculatus)—Adaptations of a grazing desert ruminant". Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 149 (2): 142–9. doi:10.1016/j.cbpa.2007.11.001. 
  18. ^ Mallon, D.P.; Kingswood, S.C. (2001). Antelopes. Gland, Switzerland: IUCN. p. 44. ISBN 2-8317-0594-0. 
  19. ^ Asa, C.S.; Houston, E.W.; Fischer, M.T.; Bauman, J.E.; Bauman, K.L.; Hagberg, P.K.; Read, B.W. (1996). "Ovulatory cycles and anovulatory periods in the addax (Addax nasomaculatus).". Journal of reproduction and fertility 107 (1): 119–24. doi:10.1530/jrf.0.1070119. PMID 8699424. 
  20. ^ Densmore, M.A. & Kraemer, D.C. (1986). "Analysis of reproductive data on the addax (Addax nasomaculatus) in captivity". International Zoo Yearbook 24 (1): 303–306. doi:10.1111/j.1748-1090.1985.tb02559.x. 
  21. ^ Manski, D.A. (1991). "Reproductive behavior of addax antelope". Applied Animal Behaviour Science 29 (1): 39–66. doi:10.1016/0168-1591(91)90237-r. 
  22. ^ a b "Addax". Sahara Conservation Fund. Retrieved 14 January 2013. 
  23. ^ Newby, J. (2009). "Can Addax and Oryx be saved in the Sahel?". Oryx 15 (03): 262. doi:10.1017/S0030605300024662. 
  24. ^ Richard Trillo, The Rough Guide to West Africa
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!